IL-33 signaling inhibition leads to a preeclampsia-like phenotype in pregnant rats

Abstract

Problem

Preeclampsia (PE) is a hypertensive pregnancy disorder that is a leading cause of maternal and fetal morbidity and mortality characterized by maternal vascular dysfunction, oxidative stress and chronic immune activation and excessive inflammation. No cure exists beyond delivery of the fetal-placental unit and the mechanisms driving pathophysiology are not fully understood. However, aberrant immune responses have been extensively characterized in clinical studies and shown to mediate PE pathophysiology in animal studies. One pathway that may mediate aberrant immune responses in PE is deficiencies in the IL-33 signaling pathway. In this study, we aim to investigate the impact of IL-33 signaling inhibition on cNK, T_H17, and T_Reg populations, vascular function, and maternal blood pressure during pregnancy.

Method of Study

In this study, IL-33 signaling was inhibited using two different methods: intraperitoneal administration of recombinant ST2 (which acts as a decoy receptor for IL-33) and administration of a specific IL-33 neutralizing antibody. Maternal blood pressure, uterine artery resistance index, renal and placental oxidative stress, cNK, T_H17, and T_Reg populations, various cytokines, and pre-proendothelin-1 levels were measured.

Results

IL-33 signaling inhibition increased maternal blood pressure, uterine artery resistance, placental and renal oxidative stress. IL-33 signaling inhibition also increased placental cNK and T_H17 and renal T_H17cells while decreasing placental T_Reg populations. IL-33 neutralization increased circulating cNK and T_H17s and decreased circulating T_Regs in addition to increasing pre-proendothelin-1 levels.

Conclusions

Data presented in this study demonstrate a role for IL-33 signaling in controlling vascular function and maternal blood pressure during pregnancy possibly by mediating innate and adaptive immune inflammatory responses, identifying the IL-33 signaling pathway as a potential therapeutic target for managing preeclampsia.

Introduction

Hypertensive disorders of pregnancy, such as preeclampsia (PE), are one of the leading contributors to maternal and fetal mortality and morbidity¹. In addition to maternal hypertension (HTN) after 20 weeks of gestation, PE manifests as the development of end organ dysfunction². PE has been recognized as a significant risk factor for cardiovascular diseases in the mother and child long-term³. There are limited treatment options for PE management due to limitations in understanding of PE etiology; and delivery of the fetal-placental unit is considered the only curative option, though it does not always result in symptom resolution⁴. Placental ischemia, whether resulting from abnormal spiral artery remodeling, injury, inflammation, or an imbalance between maternal perfusion and fetoplacental demands, is thought to incite PE development^5–9.

During normal gestation, the immune profile is typically represented as a fetal-tolerant phenotype, with a dominance of regulatory and anti-inflammatory immune cell populations such as Regulatory T cells (T_Regs) and cytokines such as interleukin-10 (IL-10)^10–13. Immune changes characterized by increased T helper 17 (T_H17) and cytolytic NK (cNK) populations, expansion of other pro-inflammatory cells, the enhanced release of pro-inflammatory cytokines, in addition to increased anti-angiogenic factors and oxidative stress are linked to PE pathophysiology^5,14,15. Activation of the NOD-like receptor and pyrin domain-containing protein 3 (NLRP3) inflammation is suggested to be a probable mediator between placenta ischemia and the pro-inflammatory immune changes observed in PE. Studies report increased NLRP3 expression in PE and other hypertensive and gestation disorders. Furthermore, it is proposed that NLRP3 activation plays a role in mediating the inflammatory and vascular changes associated with hypertension and recurrent spontaneous abortion^16–20. Studies in various inflammatory diseases as well as our own work have suggested that NLRP3 activation disrupts IL-33 signaling to activate T_H17s and cNKs^21–23. Canonically, the highly biologically active, cleaved form of IL-33 signals through binding to membrane bound ST2 receptors, which appear on the surfaces of many cell types including T_H17s and cNKs, to drive a type 2 immune response^24–27.

While previous studies have established a protective role for IL-33 signaling in the context of early gestation as well as pre-term labor^28–30, little is known about the role of IL-33 signaling in PE. Several clinical studies have hinted at a reduction of IL-33 signaling in PE samples, whether through decreased placental IL-33³¹ or through increased soluble ST2 (sST2)³², though no clear mechanistic link between IL-33 signaling and PE pathophysiology has previously been demonstrated. Our lab has recently shown a role for IL-33 supplementation in reducing inflammation and maternal HTN in the Reduced Uterine Perfusion Pressure (RUPP) rat model of placental ischemia³³. In this study, we expand upon our previous work to better characterize mechanisms by which IL-33 signaling may be protective against PE pathophysiology, particularly in regard to T_Reg, cNK, and T_H17 populations. Based on prior work, we hypothesized that inhibition of IL-33 signaling will decrease circulating and placental IL-33 levels, decrease T_Reg populations, increase cNK and T_H17 cell activation, inflammation, and oxidative stress leading to vascular dysfunction and maternal hypertension to mimic PE pathophysiology.

Materials and Methods

Animals

Virgin female Sprague-Dawley rats between 10–12 weeks of age were mated overnight to age-matched males. A positive pregnancy was indicated by the presence of a sperm plug the day after mating and deemed gestational day 0 (GD0). Animals were maintained on ad libitum access to 2020X Teklad Global Soy Protein-Free Extruded rodent diet (Envigo) and water, standard bedding, and a 12:12h light-dark cycle. Animals were group-housed from GD0 until surgeries were performed. Animals were housed in the Center for Comparative Research at the University of Mississippi Medical Center (UMMC). The UMMC Institutional Animal Care and Use Committee approved the protocols (#2021-1162) in this study, which are also in accordance with the National Institutes of Health guidelines for the use and care of animals. Randomized allocation and blinded analysis are routinely employed in our laboratory and were utilized for all protocols in this study.

sST2 and anti-IL-33 Administration

On GD14, a mini osmotic pump (model 2002, Alzet Scientific Corporation) was placed intraperitoneally to infuse either saline vehicle, goat IgG isotype control (1 μg/kg/day, NB410-28088, Novus Biologicals), mouse IL-33 antibody (1 μg/kg/day, AF3626, R&D Systems), or recombinant mouse ST2 (1 μg/kg/day, 1004-MR-050, R&D Systems) from GD14 through GD19. Dosing was chosen based on our preliminary studies demonstrating an effect to increase blood pressure and uterine artery resistance in NP pregnant rats (Supplemental Figure 1).

Mean Arterial Pressure Measurement

Catheters constructed from V3 tubing (BB21785, Scientific Commodities) were placed into the carotid arteries and tunneled to the back of the neck under 3% isoflurane anesthesia on GD18. On GD19, rats were placed in individual restrainers and connected to a pressure transducer. Using PowerLab software (AD Instruments), conscious mean arterial pressure (MAP) was monitored and recorded for 30 min following a 30 min stabilization period.

Uterine Artery Resistance Index Measurement

On GD18, Doppler sonography was performed on rats under 3% isoflurane anesthesia to measure the uterine artery resistance index (UARI). Doppler velocimetry measurements on the uterine arteries (one placenta midway between the ovary and cervix visualized on each uterine horn) were taken on a Vevo 770 unit (Visual Sonics) with a 30-Hz transducer (model no. 710B). One placenta from each uterine horn was imaged to capture waveforms representing the peak systolic velocity (PSV) and end-diastolic flow velocity (EDV). Three waveforms were measured for velocities per frame. UARI was calculated using the equation UARI = (PSV – EDV)/ PSV.

Sample Collection and Protein Isolation

After MAP measurement, rats were anesthetized under 3% isoflurane anesthesia for blood and tissue collection. Animals were exsanguinated via blood collection followed by bilateral pneumothorax for euthanasia. Total litter size, number of live fetuses per litter, placental weights, and fetal weights were recorded for each dam and averaged. Fetal crown to rump and fetal abdominal circumference measurements were taken with a tape measure and averaged for each dam. Reabsorption rates were calculated as the percentage of reabsorbed fetuses over the total number of fetuses in the litter. Randomly selected placenta tissues were immediately frozen in liquid nitrogen and stored at −80°C until analysis. Placenta (including the decidua) and kidney samples were homogenized in T-PER Tissue Protein Extraction Reagent (78510, Thermo Fisher Scientific) supplemented with 1 mM activated vanadate (BP-440, Boston BioProducts), protease inhibitor cocktail (P8340, MilliporeSigma), and 1X HALT protease and phosphatase inhibitor (78441, Thermo Fisher Scientific).

IL-33 and ST2 Quantification

IL-33 and ST2 levels were quantified in homogenized placental samples and plasma using the IL-33 ELISA kit (M3300, R&D Systems) and the ST2 ELISA kit (MST200, R&D Systems). Undiluted samples were assayed in duplicate and analyzed according to manufacturer’s instructions. Data is reported as pg/mL (plasma) and pg/mg (tissue). Placental data was normalized to protein concentration, determined via the Pierce BCA Protein Assay Kit (23225, Thermo Fisher Scientific). Plasma and placenta IL-33 to ST2 ratios were calculated by dividing the IL-33 level by the ST2 level.

Cytokine Quantification

Blood samples in EDTA tubes were spun at 2000 × g for 10 minutes at 4°C to collect plasma. A custom Bio-Plex multiplex immunoassay (12005641, Bio-Rad) was used to quantify and analyze cytokines on a Bio-Rad Bio-Plex 200 system according to manufacturer’s instructions. Circulating IL-6, IL-10, IFN-γ, MIP-3a, and TNF-α was quantified in undiluted plasma samples and expressed as pg per mL. Placental IL-6, IL-10, IFN-γ, MIP-3a, TNF-α, and CXCL1 were quantified in undiluted homogenized placental samples and reported as pg per mg. Placental granzyme A, granzyme B, and perforin were quantified in undiluted placental samples using the rat granzyme A ELISA (NBP3–11789, Novus Biologicals), rat granzyme B ELISA (NBP3–11792, Novus Biologicals), and rat perforin ELISA (NBP3–00483, Novus Biologicals), respectively, and reported as pg per mg. Placental cytokines were normalized to protein concentration, determined via the Pierce BCA Protein Assay Kit (23225, Thermo Fisher Scientific).

RNA Isolation and Real-Time Quantitative PCR

Using the Qiagen RNeasy Plus Mini Kit (74134, Qiagen), placental RNA was isolated according to the manufacturer’s protocol. RNA sample quality was assessed using an A₂₆₀/A₂₈₀ ratio of 1.8 – 2.2 on a Take3 multi-volume plate (BTTAKE3TRIO, Agilent) with a BioTek Synergy H1 microplate reader (Agilent). Isolated RNA was converted to cDNA with iScript Reverse Transcription Supermix for RT-qPCR (1708841, BioRad). Real-time quantitative PCR (RT-qPCR) was performed with Bio-Rad SYBR Green Supermix (1725271), PPET-1 primers (forward: CTAGGTCTAAGCGATCCTTG and reverse: TCTTTGTCTGCTTGGC)³⁴, and the PrimePCR SYBR Green Assay for GAPDH (10025636) on a BioRad iCycler under the following conditions: 1 cycle of 95°C for 2 minutes (activation), 40 cycles of 95°C for 5 seconds(denaturation) and 60°C for 30 seconds (extension). With melt curve analysis from 65–95°C in 0.5°C increment at 5 seconds/step, qPCR products were verified to be single amplicons. PPET-1 expression levels were normalized to GAPDH and quantified using the comparative CT method (^ΔΔCT).

Flow Cytometry

Leukocyte single-cell suspensions from blood, placenta, and kidney were prepared as previously described^35,36 and blocked with 10% goat, rabbit, and mouse serum prior to staining for flow cytometry. Antibodies used to stain for NK cells (defined as CD3⁻ANK61⁺ cells for total NK cells and CD3⁻ANK61⁺ANK44⁺ cells for activated NK cells), T_H17 cells (defined as CD3⁺CD4⁺CD25⁻RORγ⁺), and T_Reg cells (defined as CD3⁺CD4⁺CD25⁺FoxP3⁺) were as follows: adenomatous polyposis coli protein (APC)-Vio770-conjugated anti-CD3 (1:50, Miltenyi Biotec Cat# 130–122-015, RRID:AB_2784112), mouse anti-rat ANK61 (1:50, Abcam Cat# ab36392, RRID:AB_776652), mouse anti-rat ANK44 (1:100, Abcam Cat# ab36388, RRID:AB_776651), goat anti-mouse IgG FITC (1:50, Abcam Cat# ab6785, RRID:AB_955241), rabbit anti-mouse IgG AlexaFluor405 (1:100, Abcam Cat# ab175651, RRID:AB_2923541), phycoerytherin (PE)-Vio770-conjugated anti-CD4 antibody (1:50, Miltenyi Biotec Cat# 130–107-503, RRID:AB_2657947), PE-conjugated anti-CD25 (1:50, BD Biosciences Cat# 554866, RRID:AB_395564), peridinin-chlorophyll-protein (PerCP)-conjugated anti-RORγt (1:5, R and D Systems Cat# IC6006C, RRID:AB_10571437), and Alexa Fluor 647-conjugated anti-FoxP3 (1:5, R and D systems Cat# IC8970R). Flow cytometry was carried out on a Miltenyi MACSQuant Analyzer 10 (Miltenyi Biotec) and underwent analysis using FlowLogic software (Innovai). After dead cell exclusion using Viobility Fixable dye staining (130–109-814, Miltenyi Biotec) and doublet exclusion, lymphocytes were gated in the forward and side scatter plots and analyzed with fluorescence minus one (FMO) controls. Data is reported as the percentage of live cells in the gated lymphocyte population.

NK Cell Cytotoxicity Assay

Fresh NK cells were isolated from placentas on the day of harvest as previously described by our laboratory³⁷. Each data point represents NK cells isolated from four pooled placentas from a single dam. Lymphocytes were subject to MACS magnetic bead cell separation (Miltenyi). Briefly, NK cells were isolated using biotin-conjugated anti-CD3 antibody (1:10, Miltenyi Biotec Cat# 130–123-858, RRID:AB_2904993), PE-conjugated anti-CD161 antibody (1:10, Miltenyi Biotec Cat# 130–102-712, RRID:AB_2655445), anti-biotin microbeads (1:10, Miltenyi Biotec Cat# 130–090-485, RRID:AB_244365), and anti-PE microbeads (1:5, Miltenyi Biotec Cat# 130–048-801, RRID:AB_244373). Isolated CD3⁻CD161⁺NK cells were cultured for 48 hours at 37°C, 5% CO₂ in a humidified incubator in culture media (RPMI, 10% FBS, 1% penicillin-streptomycin, and 2 ng/mL recombinant rat IL-2 (502-RL-010, R&D Systems)). NK cell cytotoxic activity against YAC1 target cells (ATCC) was measured using the Cytotox 96 Non-Radioactive Cytotoxicity Assay kit (Promega). Samples were plated in duplicate at a ratio of 50:1 of NK:YAC1 and incubated for 5 hours. Data calculations were performed according to manufacturer’s instructions and are reported as fold change in cytotoxic activity, normalized to NP NK cytotoxic activity.

Oxidative Stress Measurement

As previously described by our laboratory, superoxide production was measured in homogenized placenta and kidney samples using lucigenin^36,38. Homogenized samples and lucigenin (5 μM), with or without NADPH (0.163 M), were incubated together and allowed to equilibrate at 37 °C for 15 minutes in the dark. 10s of luminescence were then measured with a BioTek Plate Reader. An assay blank with only lucigenin was subtracted from the reading. Data was normalized to protein concentration, determined via the Pierce BCA Protein Assay Kit (23225, Thermo Fisher Scientific), and reported as relative light units (RLU) per minute per mg protein.

Statistical Analysis

Data was analyzed using a one-way ANOVA followed by the Tukey’s multiple comparison test if a significant interaction was detected and presented as mean ± SD. Statistical analyses were performed in GraphPad Prism 10 (GraphPad Software). For the one-way ANOVA analyses, column factors were defined as NP, NP+sST2, NP+IgG, and NP+anti-IL-33. Data was evaluated for normality using the Shapiro-Wilk test and for outliers using the ROUT method. A p-value < 0.05 was considered statistically significant.

Results

sST2 infusion decreases circulating and placental IL-33 to ST2 ratios.

IL-33 and ST2 levels were measured in both the circulation and the placenta and the IL-33:ST2 ratio was calculated for both compartments. In the circulation (Figure 1A), IL-33 levels significantly decreased in NP+sST2 group at 9.52±4.63 pg/mL compared to 32.71±27.64 pg/mL in the NP group (p=0.016) and averaged at 15.14±6.08 pg/mL in the NP+IgG and 4.90±2.50 pg/mL in the NP+anti-IL-33 groups. In the circulation (Figure 1B), ST2 levels were 67.75±30.52 pg/mL in NP, 72.50±22.30 pg/mL in NP+sST2, 62.88±19.30 pg/mL in NP+IgG, and 59.00±5.40 pg/mL in NP+anti-IL-33 groups. The IL-33:ST2 ratio in the circulation (Figure 1C) significantly lowered in the NP+sST2 group at 0.13±0.07 compared to 0.46±0.33 in the NP group (p=0.0061), while the ratio was not significantly different when comparing NP+IgG to NP+anti-IL-33 (0.25±0.13 vs 0.08±0.04, respectively).

Figure 1. Circulating and placental IL-33 to ST2 ratios are decreased by sST2 treatment in pregnant rats.

(A) Circulating IL-33 and (B) ST2 levels as measured via ELISAs. (C) Circulating IL-33 to ST2 ratio as calculated by dividing IL-33 levels by ST2 levels. (D) Placental IL-33 and (E) ST2 levels as measured by ELISAs. (F) Placental IL-33 to ST2 ratios as calculated by dividing IL-33 levels by ST2 levels. Data is presented as mean ± SD. *p < 0.05 vs NP, + p < 0.05 vs NP+IgG, n = 8.

In the placenta (Figure 1D), IL-33 was 6.03±1.26 pg/mg protein in NP, 4.30±1.85 pg/mg protein in NP+sST2, 3.93±1.61 pg/mg protein in NP+IgG, and 2.18±0.88 pg/mg protein in NP+anti-IL-33. Placental ST2 (Figure 1E) was 8.87±7.61 pg/mg protein in NP, 14.21±3.50 pg/mg protein in NP+sST2, 5.06±2.75 pg/mg protein in NP+IgG, and 4.90±2.61 pg/mg protein in NP+anti-IL-33. The ratio of IL-33 to ST2 in the placenta (Figure 1F) was significantly lowered in the NP+sST2 group at 0.31±0.13 compared to 0.99±0.58 in the NP group (p=0.0099); and was not different between NP+IgG (0.96±0.48) and NP+anti-IL-33 (0.54±0.26).

IL-33 inhibition causes increases in maternal blood pressure and uterine vascular resistance index.

Mean arterial pressure (MAP) averaged at 98±8 mmHg fin NP and 100±4 mmHg fin NP+IgG dams (Figure 2A). With sST2 or anti-IL-33 antibody infusion, MAP was significantly increased: MAP rose to 113±14 mmHg in NP+sST2 (p=0.0112 vs NP) and 111±7 mmHg in NP+anti-IL-33 (p=0.0336 vs NP+IgG) dams. When examining uterine artery resistance index (UARI), we found NP (0.49±0.06 a.u, Figure 2B) and NP+IgG (0.48±0.04 a.u.) groups were comparable. Both the NP+sST2 (0.58±0.04 a.u., p=0.0329 vs NP) and the NP+anti-IL-33 (0.64±0.06 a.u., p=0.0002 vs NP+IgG) groups displayed significantly increased UARI when compared to their respective controls.

Figure 2. IL-33 signaling inhibition increases maternal hypertension and uterine vascular artery resistance in pregnant rats.

. (A) Maternal MAP as measured through direct carotid catheterization. (B) UARI as measured through Doppler sonography. Data is presented as mean ± SD. *p < 0.05 vs NP, + p < 0.05 vs NP+IgG, n = 6–8.

Anti-IL-33 antibody infusion increases fetal reabsorption rats in pregnant rats.

We found no significant differences in fetal weights (Figure 3A), placental weights (Figure 3B), or placental efficiency (Figure 3D) across all groups. Additional measurements of fetal growth, such as crown to rump lengths (Supplemental Figure 2A) and abdominal circumference measurements (Supplemental Figure 2B), also did not differ. With fetal reabsorption rates (Figure 3C), the NP+anti-IL-33 group reabsorbed at a rate of 15.68±15.02% (p=0.0128 vs NP+IgG), which was higher than NP (0±0 %), NP+sST2 (6.51±9.07%), and NP+IgG (0.96±2.72%).

Figure 3. Fetal reabsorption is increased with anti-IL-33 treatment in pregnant rats.

(A) Fetal weight expressed as average pup weight in each litter. (B) Placental weight expressed as average placental weight in each litter. (C) Fetal reabsorption, calculated as number of reabsorbed fetuses divided by total litter size. (D) Placental efficiency calculated as average fetal weight divided by average placental weight. Data is presented as mean ± SD. *p < 0.05 vs NP, + p < 0.05 vs NP+IgG, n = 8.

Inflammation and oxidative stress are increased in sST2 and anti-IL-33 infused rats.

Circulating, placental, and renal cytolytic NK (cNK), T helper 17 (T_H17), and T Regulatory (T_Reg) cells were quantified in all groups (Table 1). Circulating cNKs increased in NP+anti-IL-33 rats to 6.54±3.28% of total NK cells compared to NP+IgG rats which were 0.72±0.85% of total NK cells (p<0.0001). Placental cNKs increased in NP+sST2 rats to 5.99±4.85% of total NK cells compared to NP rats at 1.70±1.58% (p=0.0266) of total NK cells. In NP+anti-IL-33 rats, placental cNKs were 5.37±3.47% of total NK cells compared to 1.28±0.49% of total NK cells in NP+IgG rats (p=0.0292). No significant changes were observed in renal cNKs among the groups.

Table 1.

IL-33 inhibition increases placental and renal cNKs and T_H17s but decreases placental T_Regs. Anti-IL-33 treatment increases circulating cNK and T_H17 but decreases circulating T_Regs.

	Treatment Group
	NP (n=8)	NP+sST2 (n=8)	NP+IgG (n=8)	NP+anti-IL-33 (n=8)
cNKs (% Total NK)
Circulation	1.62 ± 1.31	2.91 ± 1.88	0.72 ± 0.85	6.54 ± 3.28 +
Placenta	1.70 ± 1.58	7.06 ± 4.85 *	1.28 ± 0.49	6.62 ± 3.93 +
Kidney	0.61 ± 0.81	1.43 ± 1.17	0.55 ± 0.46	1.55 ± 1.51
TH17s (% CD3+ T Cells)
Circulation	0.17 ± 0.25	1.16 ± 1.55	0.13 ± 0.17	2.48 ± 2.81 +
Placenta	0.61 ± 0.46	3.47 ± 1.88 *	0.95 ± 1.14	3.53 ± 2.60 +
Kidney	0.48 ± 0.81	3.27 ± 3.07 *	0.47 ± 0.30	3.19 ± 1.94 +
TRegs (% CD3+ T Cells)
Circulation	4.95 ± 1.88	4.02 ± 3.38	6.17 ± 3.38	1.56 ± 0.67 +
Placenta	4.46 ± 1.74	2.15 ± 1.32 *	4.05 ± 1.71	1.21 ± 1.20 +
Kidney	2.70 ± 2.94	2.05 ± 2.45	2.63 ± 1.49	2.21 ± 2.27

Data is presented as mean ± SD.

^*p < 0.05 vs NP,

⁺p < 0.05 vs NP+IgG

Circulating T_H17s increased from 0.13±0.17% of CD3⁺ T cells in NP+IgG rats to 2.48±2.81% of CD3⁺ T cells in NP+anti-IL-33 rats (p=0.0338). Placental T_H17s were increased in NP+sST2 rats to 3.47±1.88% of CD3⁺ T cells compared to NP rats at 0.61±0.46% (p=0.0246) of CD3⁺ T cells and are increased in NP+anti-IL-33 rats to 3.53±2.60% of CD3⁺ T cells compared to NP+IgG rats at 0.95±1.14% of CD3⁺ T cells (p=0.0438). Renal T_H17s were increased in NP+sST2 rats to 3.27±3.07% of CD3⁺ T cells compared to NP rats at 0.48±0.81% of CD3⁺ T cells (p=0.0201) and were increased in NP+anti-IL-33 rats to 3.19±1.94% of CD3⁺ T cells compared to NP+IgG rats at 0.47±0.30% of CD3⁺ T cells (p=0.0241).

Circulating T_Regs decreased in NP+anti-IL-33 rats to 1.56±0.67% of CD3⁺ T cells from 6.17±3.38% of CD3⁺ T cells in NP+IgG rats (p=0.0268). Placental T_Regs were decreased in NP+sST2 rats to 2.15±1.32% of CD3⁺ T cells compared to NP rats at 4.46±1.74% (p=0.0495) of CD3⁺ T cells and decreased in NP+anti-IL-33 rats at 1.21±1.20% of CD3⁺ T cells compared to NP+IgG rats at 2.63±1.49% of CD3⁺ T cells (p=0.0412). No significant changes were observed in renal T_Regs.

In addition to an expansion in placental cNK populations in NP+sST2 and NP+anti-IL33 infused rats, NK cells isolated from the placentas of these animals also displayed an increase in cytotoxic activity in an in vitro assay (Figure 4). We observed a 2.21±0.14-fold increase in cytotoxic activity in NP+sST2 rats compared to NP rats (p=0.0056), and an 8.99±0.34-fold increase in cytotoxicity of NK cells isolated from NP+anti-IL-33 rats compared to those from NP+IgG rats (p<0.0001). To further investigate this increased cytotoxicity in treated animals, perforin and granzymes, which are toxins released from lytic granules by NK cells to carry out their cytotoxic functions³⁹, were measured in placental tissue. Correspondingly, NP+sST2 rats had increased placental granzyme B levels at 13.07±2.37 pg/mg protein compared to NP levels of 8.55±1.72 pg/mg protein (p=0.0082, Table 2). The NP+anti-IL-33 group displayed increased placental levels of granzyme A, granzyme B, and perforin compared to the NP+IgG group. NP+anti-IL-33 animals had granzyme A levels of 453.50±157.60 pg/mg protein compared to NP+IgG levels of 266.50±70.60 pg/mg protein (p=0.0042). NP+anti-IL-33 animals had granzyme B levels of 17.32±3.71 pg/mg protein compared to NP+IgG levels of 11.24±2.11 pg/mg protein (p=0.0003). NP+anti-IL-33 animals had perforin levels of 4.18±2.05 pg/mg protein compared to NP+IgG levels of 2.49±0.64 pg/mg protein (p=0.0327).

Figure 4. IL-33 signaling inhibition increases NK cell cytotoxic activity in pregnant rats.

Data is presented as mean ± SD. *p < 0.05 vs NP, + p < 0.05 vs NP+IgG, n = 3–5.

Table 2.

sST2 increased circulating TNF-α and placental Granzyme B. Anti-IL-33 treatment in pregnant rats reduced circulating and placental IL-10 and increased placental Granzyme A, Granzyme B, and Perforin.

	Treatment Group
	NP (n=8)	NP+sST2 (n=8)	NP+IgG (n=8)	NP+anti-IL-33 (n=8)
Circulation (pg/mL)
IL-6	248.10 ± 144.60	220.5 ± 132.70	251.10 ± 75.55	178.90 ± 151.60
IL-10	80.79 ± 51.02	63.86 ± 36.35	85.77 ± 39.88	29.87 ± 15.20 +
IFN-γ	59.10 ± 38.30	75.46 ± 34.94	62.46 ± 30.49	51.60 ± 34.57
MIP-3a	8.58 ± 3.83	11.52 ± 6.04	10.91 ± 4.18	9.19 ± 7.91
TNF-α	84.81 ± 55.71	225.4 ± 71.80*	91.96 ± 50.19	132.00 ± 79.26
Placenta (pg/mg protein)
IL-6	0.13 ± 0.09	0.17 ± 0.07	0.19 ± 0.14	0.19 ± 0.25
IL-10	117.30 ± 37.24	74.41 ± 30.66	119.30 ± 38.04	64.39 ± 18.58 +
IFN-γ	17.68 ± 8.66	30.72 ± 10.88	22.36 ± 9.71	27.10 ± 7.62
MIP-3a	17.87 ± 4.33	33.20 ± 18.10	26.98 ± 3.14	30.35 ± 10.44
TNF-α	144.10 ± 57.41	161.10 ± 67.89	135.90 ± 58.48	140.10 ± 31.53
CXCL1	1722 ± 1075	2795 ± 1527	1339 ± 1977	3618 ± 2249
Granzyme A	276.30 ± 36.35	352.30 ± 92.13	266.50 ± 70.60	453.50 ± 157.60+
Granzyme B	8.55 ± 1.72	13.07 ± 2.38*	11.24 ± 2.11	17.32 ± 3.71+
Perforin	2.22 ± 0.34	2.99 ± 0.81	2.49 ± 0.64	4.18 ± 2.05+

Data is presented as mean ± SD.

^*p < 0.05 vs NP,

⁺p < 0.05 vs NP+IgG

A panel of pro-and anti-inflammatory cytokines were also measured in the plasma and placentas of all groups (Table 2). Circulating TNF-α was significantly higher in NP+sST2 rats at 225.40±71.80 pg/mL compared to NP rats at 84.81±55.71 pg/mL (p=0.0037). Circulating IL-10 was lower in NP+anti-IL-33 rats at 29.87±15.20 pg/mL compared to NP+IgG rats at 85.77±39.88 (p=0.0305). Similarly, placental IL-10 levels were lower in NP+anti-IL-33 rats at 64.39±18.58 pg/mg protein compared to NP+IgG rats at 119.30±38.04 pg/mg protein (p=0.0129). There were also trending increases in placental MIP-3a (33.20±18.10 pg/mg protein in NP+sST2 vs 17.87±4.33 pg/mg protein in NP, p=0.0717) and IFN-γ levels (30.72±10.88 pg/mg protein in NP+sST2 vs 17.68±8.66 pg/mg protein in NP, p=0.0705).

We quantified reactive oxygen species (ROS) in both placental (Figure 5A) and kidney (Figure 5B) samples. NP+sST2 rats showed higher placental oxidative stress compared to NP rats (776.9±222.4 RLU/min/mg protein vs 254.4±96.8 RLU/min/mg protein, p=0.0002), and NP+anti-IL-33 rats showed higher placental oxidative stress compared to NP+IgG rats (714.8±240.7 RLU/min/mg protein vs 271.2±58.55 RLU/min/mg protein, p=0.0013). Similarly, NP+sST2 rats showed increased renal oxidative stress compared to NP rats (806.1±161.8 RLU/min/mg protein vs 505.5±65.5 RLU/min/mg protein, p=0.0165), and NP+anti-IL-33 rats showed increased renal oxidative stress compared to NP+IgG rats (626.8±232.1 RLU/min/mg protein vs 357.7±118.1 RLU/min/mg protein, p=0.0349).

Figure 5. IL-33 signaling inhibition increases placental and renal oxidative stress in pregnant rats.

(A) Placental and (B) renal ROS as measured via a lucigenin assay. Data is presented as mean ± SD. *p < 0.05 vs NP, + p < 0.05 vs NP+IgG, n = 6.

Anti-IL-33 antibody infusion increases placental expression of preproendothelin-1 mRNA.

We examined several factors that may contribute to the vascular dysfunction indicated by increased maternal blood pressure and uterine artery resistance in our animals. In the circulation, vascular endothelial growth factor (VEGF) levels are significantly reduced by anti-IL-33 antibody infusion (p=0.0280 vs NP+IgG, Supplemental Figure 3C) at 7.17±8.62 pg/mL compared to 58.58±45.70 pg/mL in NP+IgG rats though circulating nitric oxide (NO) bioavailability, as indicated by nitrate nitrite levels, were not affected (Supplemental Figure 3A). Placental nitrate nitrite (Supplemental Figure 3B), VEGF (Supplemental Figure 3D), Ser-1177 phosphorylated endothelial nitric oxide synthase (p-eNOS) (Supplemental Figure 4A), and endothelial nitric oxide synthase (eNOS) (Supplemental Figure 4B) levels also did not differ among the four groups.

However, we did observed differences in placental pre-proendothelin-1 (PPET-1) mRNA levels in the anti-IL-33 antibody infused group with a 1.80±0.39-fold increase compared to NP+IgG group (p=0.0078, Figure 6A). Renal PPET-1 mRNA levels did not vary among the groups (Figure 6B).

Figure 6. Anti-IL-33 treatment increases placental pre-proendothelin-1 mRNA expression in pregnant rats.

(A) Placental and (B) PPET-1 expression as measured via qRT-PCR. Data is presented as mean ± SD. *p < 0.05 vs NP, + p < 0.05 vs NP+IgG, n = 6.

Discussion

In our current study, we observe many changes that are in line with our previous findings indicating probable mechanisms through which IL-33 signaling is mediating immune and possibly vascular changes during gestation. With our previous IL-33 supplementation study utilizing the RUPP model, we saw beneficial changes in maternal MAP and UARI, which we postulated were likely mediated by the decreases in cNK and T_H17s alongside decreases in renal ROS and placental PPET-1 levels³³. Though there have been studies suggesting IL-33 signaling can modify the eNOS/NO pathway^40,41, we did not observe significant changes in those markers with IL-33 inhibition in this study nor in our previous study³³. This study expands upon our previous work by showing a role for IL-33 in mediating T_Reg expansion, which we previously hypothesized to be partially driving the decreases in cNK and T_H17s observed with IL-33 supplementation in a rat model of placental ischemia³³. Normal pregnancy requires sufficient T_Reg and T_H2 populations to promote maternal-fetal tolerance, and the importance of a T_Reg/T_H2 predominance in immune cells has been extensively characterized^42,43. Multiple clinical studies report an imbalance of T_H17 to T_Reg cells during PE^44–47 in addition to animal studies demonstrating an increase in T_H17 populations contributes to increased oxidative stress and maternal HTN during pregnancy^11,12,48. The loss of IL-33 signaling in our study led to increases in cNK and T_H17s and oxidative stress and a decrease in T_Regs, which have been shown to mediate PE pathophysiology^13,36. The increase in renal oxidative stress with IL-33 inhibition is in line with findings from Liu et al that IL-33 inhibition increased endoplasmic reticulum stress and apoptosis in glomerular endothelial cells⁴⁹. This suggests the maternal hypertension and increased uterine artery resistance we observed with IL-33 signaling inhibition may be a combined effect of these factors, and IL-33 signaling may play a protective role during pregnancy by upregulating T_Regs and downregulating cNK and T_H17s.

We do see differential changes in several cytokines as well as PPET-1 with sST2 and anti-IL-33 antibody treatment, which we believe is due to their differential mechanisms of action and a slight differential sequence similarity compared to the native rat forms. The sST2 and anti-IL-33 antibody we utilize in the study are both manufactured according to the mouse sequences, which respectively have an 81% and 90% amino acid sequence similarity to the rat sequences according to manufacturer provided information. The anti-IL-33 antibody used also binds both the full-length and processed forms of IL-33 while sST2 preferentially binds the mature, processed forms of IL-33 with a 10-fold greater potency compared to the full-length form of IL-33 to initiate canonical IL-33 signaling⁵⁰. In our quantifications of plasma and placental IL-33 levels, though sST2 infusion significantly decreased plasma and placental IL-33 to ST2 ratios, the anti-IL-33 antibody infusion did not. We believe several factors may contribute to this as well as to the decrease in plasma IL-33 seen in the IgG group, though that difference was not significant. The anti-IL-33 antibody used in our study was polyclonal and may leave epitope sites that may still be recognized by endogenous ST2 (soluble or membrane-bound). In addition, the IL-33 ELISA employs a polyclonal primary and secondary antibody, which may lead to cross-reactivity with other proteins in the samples. When canonical ST2-dependent signaling is inhibited, circulating TNF-α levels significantly increased, which is in line with a previous study reporting IL-33 induced TNF-α secretion from mast cells⁵¹ along with work showing a definitive role for TNF-α in PE pathophysiology^52–54. Placental MIP-3a and IFN-γ levels had a trending increase, which are consistent with previous reports linking them to cNK and T_H17 activation^55–57.

Recent studies have begun to survey full-length IL-33 as a possible initiator of non-canonical, ST2-independent signaling, mostly examining its effects on epithelial cells and fibroblasts^58,59. These non-canonical, ST2-independent signaling actions of full-length IL-33 have also been attributed to its function as a transcription regulator of the p65 subunit of the NF-κB complex^60,61. Interestingly, a study from Hussey et al. has indicated full-length IL-33 can direct macrophage differentiation towards a M2 phenotype⁶², which studies have shown to be expanded during normal pregnancy and impaired during PE⁶³. Cottagiri et al. have also shown IL-33 to upregulate T_Regs, independent of ST2, to reduce hepatitis⁶⁴. Several studies have indicated IL-33 to be essential for T_Reg stability as well^65,66 and that it drives IL-10 expression from macrophages, which then drives T_Reg function and expansion^67,68. Taken together with previous work showing improvement in PE pathophysiology with both IL-10 and T_Reg supplementation^69–71 alongside work showing T_Reg to suppress both cNK and T_H17s, the differential effects of sST2 and anti-IL-33 antibody on circulating and placental IL-10 levels as well as circulating cNKs, T_H17s, and T_Regs could be due to ST2 independent IL-33 signaling. The decreased T_Regs could also contribute to the decrease in placental PPET-1 levels, similar to our previous observation that infusion of NP T_Regs into RUPP rats decreased placental PPET-1 levels⁶⁹. The decrease in PPET-1 levels indicate a likely decrease in endothelin-1 (ET-1), which our work and others have previously linked as a mediator of maternal HTN in PE^72,73. Though both sST2 and anti-IL-33 antibody treatment increased NK cell cytotoxicity, anti-IL-33 treated animals had higher cytotoxic activity than sST2 treated animals. We also see increased levels of granzyme A and perforin with anti-IL-33 treatment that are not observed with sST2 treatment, which likely contribute to the increase in cytotoxic activity. A study from Schuijs et al. demonstrated IL-33 activates group 2 innate lymphoid cells (ILC2) to downregulate NK cell cytotoxicity by decreasing the efficiency of glycolysis-dependent NK cell effector functions⁷⁴, and inhibition of ILC2s by IL-10⁷⁵ may also account for the difference in cytotoxic activity increase between sST2 and anti-IL-33 antibody-treated groups.

With the data presented in this study and prior work by us and others, we can reason that deficiencies in IL-33 signaling modulate cNK, T_H17, and T_Reg populations and their respective cytokines, which are shown to mediate the increased oxidative stress that drive the maternal HTN and increased uterine artery resistance seen in PE. This indicates that both IL-33 as well as ST2 may be worthy targets in the search to develop PE therapeutics.

Non-standard Abbreviations and Acronyms

AT1-AA

angiotensin II type 1 receptor agonistic autoantibody

cNK

cytolytic NK cell

CXCL1

CXC motif chemokine ligand 1

eNOS

endothelial nitric oxide synthase

ET-1

endothelin-1

FGR

fetal growth restriction

GD

gestational day

HTN

hypertension

ILC2

group 2 innate lymphoid cells

IL-10

interleukin-10

IL-17

interleukin-17

IL-33

interleukin-33

MAP

mean arterial pressure

MIP-3ɑ

macrophage inflammatory protein-3

NLRP3

NOD-like receptor and pyrin domain-containing protein 3

NO

nitric oxide

NP

normal pregnant

p-eNOS

Ser-1177 phosphorylated endothelial nitric oxide synthase

PE

preeclampsia

PPET-1

preproendothelin-1

ROS

reactive oxygen species

RT-PCR

real-time polymerase chain reaction

RUPP

reduced uterine perfusion pressure

ST2

interleukin 1 receptor-like 1

sST2

soluble interleukin 1 receptor-like 1

T_H2

T helper type 2 cell

T_H17

T helper 17 cell

T_Reg

Regulatory T cell

UARI

uterine artery resistance index

VEGF

vascular endothelial growth factor

Data Availability

Data that supports the findings of this study is available from the corresponding author upon reasonable request.