Key resources table
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| APC anti-mouse CD4, rat monoclonal (clone GK1.5) | Biolegend | Cat# 100412; RRID: AB_312697 |
| PE/Cy7 anti-mouse CD4, rat monoclonal (clone GK1.5) | Biolegend | Cat# 100422; RRID: AB_312707 |
| APC/Cy7 anti-mouse CD8b, rat monoclonal (clone YTS156.7.7) | Biolegend | Cat# 126620; RRID: AB_2563951 |
| AF700 anti-mouse CD45, rat monoclonal (clone 30-F11) | Biolegend | Cat# 103128; RRID: AB_493715 |
| APC/Cy7 anti-mouse CD45, rat monoclonal (clone 30-F11) | Biolegend | Cat# 103116; RRID: AB_312981 |
| PE anti-mouse CD45, rat monoclonal (clone 30-F11) | Biolegend | Cat# 103106; RRID: AB_312971 |
| FITC anti-mouse CD45, rat monoclonal (clone 30-F11) | Biolegend | Cat# 103108; RRID: AB_312973 |
| APC/Cy7 anti-mouse CD44, rat monoclonal (clone IM7) | Biolegend | Cat# 103028; RRID: AB_830785 |
| BV711 anti-mouse CD62L, rat monoclonal (clone MEL-14) | Biolegend | Cat# 104445; RRID: AB_2564215 |
| PE anti-mouse CD45.1, mouse monoclonal (clone A20) | Biolegend | Cat# 110707; RRID: AB_313496 |
| PE/Cy7 anti-mouse CD45.1, mouse monoclonal (clone A20) | Biolegend | Cat# 110730; RRID: AB_1134168 |
| APC/Cy7 anti-mouse CD45.2, mouse monoclonal (clone 104) | Biolegend | Cat# 109824; RRID: AB_830789 |
| Pacific Blue anti-mouse CD11b, rat monoclonal (clone M1/70) | Biolegend | Cat# 101224; RRID: AB_755986 |
| PerCP/Cy5.5 anti-mouse CD11b, rat monoclonal (clone M1/70) | Biolegend | Cat# 101228; RRID: AB_893232 |
| PE/Cy7 anti-mouse CD11c, armenian hamster monoclonal (clone N418) | Biolegend | Cat# 117318; RRID: AB_493568 |
| APC anti-mouse CD80, Armenian hamster monoclonal (clone 16-10A1) | Biolegend | Cat# 104714; RRID: AB_313135 |
| AF700 anti-mouse I-A/I-E, rat monoclonal (clone M5/114.15.2) | Biolegend | Cat# 107622; RRID: AB_493727 |
| PE/Cy7 anti-mouse integrin α5, rat monoclonal (clone 5H10-27 (MFR5) | Biolegend | Cat# 103816; RRID: AB_2734165 |
| BV711 anti-mouse TCR β Chain, armenian hamster monoclonal (clone H57–597) | Biolegend | Cat# 109243; RRID: AB_2629564 |
| PE anti-mouse TCR γ/δ, armenian hamster monoclonal (clone GL3) | Biolegend | Cat# 118108; RRID: AB_313832 |
| PerCP/Cy5.5 anti-mouse Ki67, rat monoclonal (clone 16A8) | Biolegend | Cat# 652424; RRID: AB_2629531 |
| PE anti-mouse IL-2, rat monoclonal (clone JES6-5H4) | Biolegend | Cat# 503808; RRID: AB_315302 |
| PerCP/Cy5.5 anti-mouse IL17A, rat monoclonal (clone TC11–18H10.1) | Biolegend | Cat# 506920; RRID: AB_961384 |
| FITC anti-mouse IFN-γ, rat monoclonal (clone XMG1.2) | Biolegend | Cat# 505806; RRID: AB_315400 |
| FITC anti-mouse Ly-6C, rat monoclonal (clone HK1.4) | Biolegend | Cat# 128006; RRID: AB_1186135 |
| PerCP/Cy5.5 anti-mouse Ly-6C, rat monoclonal (clone HK1.4) | Biolegend | Cat# 128011; RRID: AB_1659242 |
| PE anti-mouse Ly-6G, rat monoclonal (clone 1A8) | Biolegend | Cat# 127608; RRID: AB_1186099 |
| BV711 anti-mouse CD64, mouse monoclonal (clone X54-5/7.1) | Biolegend | Cat# 139311; RRID: AB_2563846 |
| APC anti-mouse Foxp3, rat monoclonal (clone FJK-16s) | ThermoFisher Scientific | Cat# 17-1577-82; RRID: AB_469457 |
| Biotin conjugated anti-CD11b, rat monoclonal (clone M1/70) | Biolegend | Cat# 101204; RRID: AB_312787 |
| Biotin conjugated anti-CD45, rat monoclonal (clone 30-F11) | Biolegend | Cat# 103104; RRID: AB_312969 |
| Biotin conjugated anti-CD31, rat monoclonal (clone MEC13.3) | Biolegend | Cat# 102504; RRID: AB_312911 |
| Biotin conjugated anti-CD117, rat monoclonal (clone 2B8) | Biolegend | Cat# 105804; RRID: AB_313213 |
| Biotin conjugated anti-CD140a, rat monoclonal (clone APA5) | Biolegend | Cat# 135910; RRID: AB_2043974 |
| APC armenian Hamster IgG Isotype Control (clone: HTK888) | Biolegend | Cat# 400911; RRID: AB_2905474 |
| AF700 rat IgG2b κ Isotype Control (clone: RTK4530) | Biolegend | Cat# 400628; RRID: AB_493783 |
| Purified anti-mouse CD3, rat monoclonal (clone 17A2) | Biolegend | Cat# 100202; RRID: AB_312659 |
| Anti-GFP, rabbit polyclonal | Abcam | Cat# ab290; RRID: AB_2313768 |
| Purified anti-Keratin 14, chicken polyclonal (clone Poly9060) | Biolegend | Cat# 906004; RRID: AB_2616962 |
| Purified anti-Keratin 10, rabbit polyclonal (clone Poly19054) | Biolegend | Cat# 905404; RRID: AB_2616955 |
| Purified anti-integrin α5, rat monoclonal (clone 5H10–27 (MFR5)) | BD Biosciences | Cat# 553319; RRID: AB_394779 |
| Purified anti-Ly6G, rat monoclonal (clone 1A8) | Biolegend | Cat# 127602; RRID: AB_1089180 |
| Anti-mouse CD80, goat polyclonal | R&D systems | Cat# AF740, RRID: AB_2075997 |
| AF488 anti-rabbit IgG, donkey polyclonal | Jackson ImmunoResearch Laboratories | Cat# 711-545-152; RRID: AB_2313584 |
| AF488 anti-chicken IgG, donkey polyclonal | Jackson ImmunoResearch Laboratories | Cat# 703-545-155; RRID: AB_2340375 |
| AF488 anti-goat IgG, donkey polyclonal | Jackson ImmunoResearch Laboratories | Cat# 705-545-147; RRID: AB_2336933 |
| AF647 anti-rabbit IgG, donkey polyclonal | Jackson ImmunoResearch Laboratories | Cat# 711-605-152; RRID: AB_2492288 |
| AF647 anti-chicken IgG, donkey polyclonal | Jackson ImmunoResearch Laboratories | Cat# 703-605-155; RRID: AB_2340379 |
| RRX anti-rat IgG, donkey polyclonal | Jackson ImmunoResearch Laboratories | Cat# 712-295-150; RRID: AB_2340675 |
| CD3e monoclonal antibody (clone 145-2C11) | ThermoFisher Scientific | Cat# 14-0031-82; RRID: AB_467049 |
| CD28 monoclonal antibody (clone 37.51) | ThermoFisher Scientific | Cat# 16-0281-82; RRID: AB_468921 |
| Mouse CXCL5 antibody, rat monoclonal (clone 61905) | R&D Systems | Cat# MAB433; RRID: AB_2086587 |
| Chemicals, peptides, and recombinant proteins | ||
| Tamoxifen | Sigma-Aldrich | Cat# T5648 |
| Diptheria toxin | Sigma-Aldrich | Cat# D0654 |
| TRIzol | ThermoFisher Scientific | Cat# 15596026 |
| Liberase | Sigma-Aldrich | Cat# 5401020001 |
| Deoxyribonuclease I from bovine pancreas | Sigma-Aldrich | Cat# D4263 |
| Zombie Aqua viability dye | Biolegend | Cat# 423101 |
| Cell stimulation cocktail | ThermoFisher Scientific | Cat# 00-4970-03 |
| Brefeldin A | ThermoFisher Scientific | Cat# 00-4506-51 |
| 2-Mercaptoethanol | ThermoFisher Scientific | Cat# 21985-023 |
| HEPES buffer | Corning | Cat# 25-060-C1 |
| Penicillin-Streptomycin | ThermoFisher Scientific | Cat# 15140122 |
| MEM | ThermoFisher Scientific | Cat# 11140–050 |
| Sodium pyruvate | Corning | Cat# 25-000-C1 |
| Gentamicin | ThermoFisher Scientific | Cat# 15710-064 |
| Mitomycin C | Fisher Bioreagents | Cat# BP25312 |
| OVA 323–339 | InvivoGen | Cat# vac-isq |
| DQ Ovalbumin | ThermoFisher Scientific | Cat# D12053 |
| Recombinant Mouse IL-2 | R&D Systems | Cat# 402-ML-020 |
| Mouse TGFβ | Cell Signaling Technology | Cat# 5231LF |
| Critical commercial assays | ||
| MojoSort mouse CD4 naive T cell isolation kit | Biolegend | Cat# 480040 |
| Foxp3/Transcriptional factor staining buffer set | ThermoFisher Scientific | Cat# 00-5521-00 |
| RNAscope Multiplex Fluorescent Reagent Kit v2 | Advanced Cell Diagnostics | Cat# 323100 |
| RNAscope Probe-Mm-Cxcl5-C1 | Advanced Cell Diagnostics | Cat# 467441 |
| Direct-zol RNA Miniprep Kit | Zymo Research | Cat# 11-331 |
| NEBNext Single Cell/Low input RNA library prep kit for Illumina | New England Biolabs | Cat# E6420S |
| Illumina Tagment DNA Enzyme and Buffer kits | Illumina | Cat# 15027866 |
| MiniElute PCR Purification Kit | Qiagen | Cat# 28004 |
| Deposited data | ||
| RNA-sequencing data | This paper | GEO: GSE220241 |
| ATAC-sequencing data | This paper | GEO: GSE220241 |
| Single cell RNA-sequencing data | Haensel et al.26 | GEO: GSE142471 |
| Experimental models: Organisms/strains | ||
| Mouse: K14CreER | Fuchs lab | N/A |
| Mouse: K14cre | Fuchs lab | N/A |
| Mouse: Sox9CreER | Fuchs lab | N/A |
| Mouse: Foxp3ΔCNS1-GFP | Rudensky lab | N/A |
| Mouse: Foxp3tm2Ayr | Rudensky lab | N/A |
| Mouse: C57BL/6J | The Jackson Laboratory | Cat# 000664 |
| Mouse: B6;129S6-Gt(ROSA)26Sortm9(CAG-tdTomato)Hze/J | The Jackson Laboratory | Cat# 007905 |
| Mouse: B6.129S4-Cd80tm1Shr/J | The Jackson Laboratory | Cat# 003611 |
| Mouse: B6;129-Gt(ROSA) 26Sortm1(CAG-cas9*,-EGFP)Fezh/J | The Jackson Laboratory | Cat# 248857 |
| Mouse: B6.129(Cg)-FOXP3tm3(DTR/GFP)Ayr/J | The Jackson Laboratory | Cat# 016958 |
| Mouse: Foxp3CreER-GFP | The Jackson Laboratory | Cat# 016961 |
| Mouse: B6(Cf)-Rag2tm1.1Gn/J | The Jackson Laboratory | Cat# 008449 |
| Mouse: B6.Cg-Tg(TcraTcrb)425Cbn/J | The Jackson Laboratory | Cat# 004194 |
| Mouse: B6.SJL-Ptprca Pepcb/Boyd | The Jackson Laboratory | Cat# 002014 |
| Mouse: B6.129X1-H2-Ab1 tm1Koni/J | The Jackson Laboratory | Cat# 013181 |
| Mouse: B6.129S2-H2dlAb1-Ea/J | The Jackson Laboratory | Cat# 003584 |
| Oligonucleotides | ||
| Mouse Cd80 sgRNA1: CATCAATACGACAATTTCCC | Miao et al.20 | N/A |
| Mouse Cd80 sgRNA2: CGTGTCAGAGGACTTCACCT | Miao et al.20 | N/A |
| Recombinant DNA | ||
| pLKO-H2BGFP-CD80 sgRNA | Miao et al.20 | N/A |
| Software and algorithms | ||
| Fuji (Image J) | Fuji (Image J) | https://fiji.sc/ |
| FlowJo | FlowJo | https://www.flowjo.com |
| Biorender | Biorender | www.biorender.com |
| Cutadapt (v3.2) | Martin et al.39 | https://cutadapt.readthedocs.io/en/v3.4/ |
| Pseudo-aligner Kallisto (v0.44.0) | Bray et al.40 | https://github.com/pachterlab/kallisto |
| DESeq2 R package (v1.30.0) | Love et al.41 | https://bioconductor.org/packages/release/bioc/html/DESeq2.html |
| clusterProfiler package | Yu et al.42 | https://guangchuangyu.github.io/software/clusterProfiler/ |
| MSigDB (Molecular signature database, v7.4) | Broad Institute | https://www.gsea-msigdb.org/gsea/msigdb |
| Bowtie2 (v2.3.4.3) | Langmead and Salzberg.43 | http://bowtie-bio.sourceforge.net/owtie2/index.shtml |
| Picard (v2.18.7) | Broad Institute | http://github.com/broadinstitute/picard/releases/tag/2.7.1 |
| DeepTools | Ramirez et al.44 | https://pypi.org/project/deepTools/ |
| Gviz package | Hahne et al.45 | https://github.com/ivanek/Gviz |
| MACS2 (v2.2.7.1) | Zhang et al.46 | https://pypi.org/project/MACS2/ |
| Bedtools (v2.30.0) | Quinlan et al.47 | https://bedtools.readthedocs.io/en/latest/ |
| FeatureCounts (v1.5.3) | Liao et al.48 | https://subread.sourceforge.net |
| Seurat (v.4.1.0) | Hao et al.49 | https://github.com/satijalab/seurat |
| R | R Project | https://www.r-project.org/ |
| RStudio | Posit | https://posit.co/download/rstudio-desktop/ |
| Other | ||
| BD FACSAria II Cell Sorter | BD Biosciences | N/A |
| BD LSR II Analyzer | BD Biosciences | N/A |
| BD LSR-Fortessa analyzer | BD Biosciences | N/A |
| Axio Observer Z1 | Zeiss | N/A |
| Leica Stellaris 8 Confocal microscope | Leica | N/A |