Table 5 |.
Primers to install amber stop codon (TAG) at SC’s Lys(31)
| Primer name | Sequence 5’→3’ |
|---|---|
| SpyCatcher-SDM-Forward | attctcatagcgtgatgaggacggcaaagagttag |
| SpyCatcher-SDM-Reverse | catcacgctatgagaatttaatatgggtagcactatcttc |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.