Skip to main content
Molecules and Cells logoLink to Molecules and Cells
letter
. 2024 Jun 25;47(7):100087. doi: 10.1016/j.mocell.2024.100087

Guide for generating single-cell–derived knockout clones in mammalian cell lines using the CRISPR/Cas9 system

Taeyeon Hong 1,, Seung-Min Bae 2,, Gwonhwa Song 3,, Whasun Lim 1,2,
PMCID: PMC11292505  PMID: 38936509

Abstract

Genome editing has developed rapidly in various research fields for targeted genome modifications in many organisms, including cells, plants, viruses, and animals. The clustered regularly interspaced short palindromic repeats-associated protein 9 system stands as a potent tool in gene editing for generating cells and animal models with high precision. The clinical potential of clustered regularly interspaced short palindromic repeats-associated protein 9 has been extensively reported, with applications in genetic disease correction, inhibition of viral replication, and personalized or targeted therapeutics for various cancers. In this study, we provide a guide on single-guide RNA design, cloning single-guide RNA into plasmid vectors, single-cell isolation via transfection, and identification of knockout clones using next-generation sequencing. In addition, by providing the results of insertion into mammalian cell lines through next-generation sequencing, we offer useful information to those conducting research on human and animal cell lines.

Keywords: Clustered regularly interspaced short palindromic repeats-associated protein 9, Culture system, Genome editing, Single-guide RNA

INTRODUCTION

Genome editing involves engineering a specific target genomic site through the insertion, deletion, modification, and replacement of DNA in various cell types and living organisms (Charpentier and Marraffini, 2014). Over the last decade, genome-editing technologies have rapidly developed and have begun to show exceptional utility in diverse fields, ranging from basic research to biomedical research (Cornu et al., 2017, Park et al., 2023). The clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) system, derived from the bacterial adaptive immune system, is one of the most powerful genome-editing tools for generating cell and animal models with high efficiency and accuracy (Xu and Li, 2020).

The CRISPR/Cas9 system consists of 2 essential parts: single-guide RNA (sgRNA) and Cas9 proteins, which combine to form a ribonucleoprotein (RNP) complex as a functional unit. The RNP induces double-strand breaks at specific target sites. After CRISPR-mediated double-strand break, these breaks can be repaired via nonhomologous end-joining or homology-directed repair pathways, leading to frameshift mutations or gene knock-ins (Asmamaw and Zawdie, 2021).

CRISPR/Cas9-mediated knockout is widely used because of its versatility and simplicity compared to traditional systems, such as zinc-finger nucleases and transcription activator-like effector nucleases. CRISPR-knockout cell lines are powerful tools for studying gene regulation, function, and downstream pathways in cell biology, genetics, and cancer biology (Bae et al., 2023, Carroll, 2023, Zou et al., 2018). Several strategies are available for enhancing the efficiency and precision of CRISPR/Cas9 knockout, and these involve the consideration of (1) the number of sgRNAs transfected into cell lines and (2) the type of CRISPR/Cas9: plasmid, mRNA, and protein. In this study, we proposed an efficient method for deleting target genes from the genome using the CRISPR/Cas9 system. The protocol is divided into 4 sections, as shown in Figure 1.

Fig. 1.

Fig. 1

Workflow for generating the CRISPR/Cas9 knockout cell line. The process involves (1) dual sgRNA design and cloning, (2) CRISPR/Cas9 transfection with sgRNA, (3) single-cell isolation, and (4) validation of knockout clones using NGS. NGS, next-generation sequencing.

DESIGNING AND CLONING OF SGRNAS IN PRG2

First, the sgRNAs targeting the gene of interest must be cloned into a selected sgRNA expression vector. One sgRNA is generally used to knockout a target gene; however, we recommend using 2 sgRNAs to completely eliminate the target gene. The plasmid pRG2 (Addgene #104174) is used for sgRNA cloning. A vector system is chosen, and each sgRNA oligo is annealed and ligated into the linearized pRG2 vector using restriction enzyme sites. But the plasmid sgRNA expression vector can be chosen based on the user’s experimental purpose. Depending on the user’s goals, the design of the plasmid can be customized. Here are several vectors with experimental options to suit the user’s needs (Table 1). The sgRNA cloning protocol includes 3 steps: (1) Cas9 sgRNA design; (2) sgRNA cloning into the pRG2 vector; and (3) plasmid purification and sequencing.

Table 1.

The list of transient vectors for CRISPR in mammalian cells

Vector name pRG2 pGL3-U6-sgRNA-PGK-puromycin pX330A-1×2 pU6- (Bbs1)_CBh-Cas9-T2A-mCherry
Addgene No. #104174 #51133 #58766 #64324
Vector type Mammalian expression
Purpose sgRNA expression Expresses humanized SpCas9 nuclease and sgRNA
Restriction cloning Bsa1 Bbs1
Selectable markers - Puromycin - -
Tags - - - mCherry

Step 1. Cas9 sgRNA Design

A broad range of online tools is available for designing appropriate guide sequences. In this guideline, we used CRISPR RGEN Tools (www.rgenome.net) to design the guide sequences. The steps outlined below can be followed to obtain the sgRNA sequence of the target region.

  • 1.

    On the RGEN Tool website, click on “Cas-designer.”

  • 2.

    Select the NGG PAM sequence and human genome.

  • 3.

    Input the target sequence for sgRNA design.

    (NOTE: We recommend designing 2 pairs of sgRNAs targeting an early exon and large flanks over 100bp.)

  • 4.

    Click on “Design sgRNA.”

  • 5.

    Choose sgRNA sequences that exhibit high specificity and lower predicted off-target effects.

Step 2. Cloning of sgRNA into the pRG2 Vector

  • 1.

    Two oligos with the following sequences are required for sgRNA polymerase chain reaction (PCR) amplification:

    Forward (F) oligo:

    GAAATTAATACGACTCACTATAG-sgRNA sequence-GTTTTAGAGCTAGAAATAGC

    Reverse (R) oligo:

    AAAAAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTT GCTATTTCTAGCTCTAAAAC

  • 2.

    Prepare the following reaction in a PCR tube: 10 µl of 5× Phusion High-Fidelity (HF) buffer, 2.5 µl of deoxyribonucleotide triphosphate (dNTP) (each 2.5 mM), 0.5 µl of F oligo (100 pmol/µl), 0.5 µl of R oligo (100 pmol/µl), 0.5 µl of Phusion DNA polymerase, and 36 µl of nuclease-free water.

  • 3.

    Perform annealing of the 2 oligonucleotides on a thermocycler with the following program: 95℃ for 5 minutes, followed by a ramp-down of temperature to 25℃ at 5℃/min.

  • 4.

    Dilute the annealed oligos 250-fold with nuclease-free water.

  • 5.

    For ligation, digest the pRG2 vector using Eco31I (BsaI).

  • 6.

    Prepare the following reaction in a PCR tube: 1 µl of destination pRG2 vector, 1 µl of diluted annealed oligos, 1 µl of 10× New England Biolabs (NEB) ligation buffer, 1 µl of NEB T4 ligase, and 6 µl of nuclease-free water.

  • 7.

    Incubate the mixture at room temperature for 3 to 4 hours or 16℃ overnight.

  • 8.

    Transform the ligated plasmid into a DH5α strain of Escherichia coli and spread it on an agar plate.

  • 9.

    Incubate the plates at 37℃ overnight.

Step 3. Plasmid Purification and Sequencing

  • 1.

    Inoculate colonies from the agar plate into a tube containing 2.5 ml of Luria Bertani (LB) broth supplemented with 100 µg/ml ampicillin. Permit the bacteria to incubate overnight at 37℃ while continuously shaking at 250 rpm.

  • 2.

    Isolate the plasmid from inoculated colonies using a plasmid purification kit.

  • 3.

    Verify the sequences of the plasmids via Sanger sequencing, using primers spanning the U6 promoter.

CRISPR TRANSFECTION

Various methods can be used to deliver CRISPR/Cas9 into cells: (1) transfection with Cas9 and sgRNA plasmids; (2) transfection with Cas9 mRNA and sgRNA; and (3) transfection with Cas9 protein and sgRNA (RNP). In this protocol, we select transient expression of Cas9 to reduce off-target effects (Lee et al., 2017) instead of stable transfection with a viral vector or transposon system. Numerous Cas9 variants have been engineered, with spCas9 with NGG PAM being the most widely used CRISPR/Cas9 system owing to its robust DNA targeting and cleavage capabilities. Therefore, spCas9 is used in this protocol. To introduce the Cas9 plasmid (CMV-spCas9-RFP-puro), we used Lipofectamine 2000 according to the manufacturer’s protocol.

Step 1. Preparation of Cells

Approximately 18 to 24 hours before transfection, plate an appropriate number of target cells (eg, HEK293T, HeLa, or the cell line of interest), which shall reach approximately 50% to 70% confluency the following day.

Step 2. Preparation of DNA for Transfection

  • 1.

    Prepare a mixture of Cas9 and 2 sgRNA plasmid in a 1:1:1 ratio.

  • 2.

    Add Lipofectamine 2000 (diluted with Opti-MEM) to the mixture.

  • 3.

    Incubate the mixture for 20 minutes at room temperature.

Step 3. Transfection

  • 1.

    Add the DNA-Lipofectamine 2000 complexes to each well and mix gently.

  • 2.

    Change the culture medium to puromycin 24 hours post-transfection.

    (NOTE: Please check the working concentration of puromycin for your cell line.)

  • 3.

    Harvest the cells 72 hours after puromycin selection.

SINGLE-CELL ISOLATION

Clonal selection is the best method for obtaining a population of homogeneous cells harboring gene knockouts. Two methods are commonly used for creating single-cell colonies after sgRNA transfection: (1) limiting dilution cloning and (2) fluorescence-activated cell sorting. Compared to fluorescence-activated cell sorting of single cells, limiting dilution cloning is more common because of its low cost, independence from specialized instruments, and minimal cellular stress (Ye et al., 2021). Therefore, we describe a method for isolating single-cell clones by limiting dilution as follows.

Step 1. Preparation of the Plate

Add 100 µl of medium into each well of 4 sterile 96-well plates, except for well A1, which should remain empty.

Step 2. Serial Dilution

  • 1.

    Add 4,000 cells (2 × 104 cells/ml) to well A1.

  • 2.

    Transfer 100 µl from well A1 to well B1, ensuring no bubble formation. Perform a 1:2 dilution by repeating this process in column 1. Finally, add 100 µl of medium to each well in column 1, for a total final volume of 200 µl in wells A1 to H1 (Fig. 2).

  • 3.

    Mix the cells thoroughly and transfer 100 µl from column 1 to column 2. Mix gently by pipetting. Repeat this 1:2 dilution process across plates.

  • 4.

    Add 100 µl of medium to each well (except the last column), for a total volume of 200 µl per well.

  • 5.

    Incubate the plates at 37℃.

Fig. 2.

Fig. 2

Plate setup for the array dilution method. Two-fold serial dilutions are performed horizontally across plates.

Step 3. Identification of a Single Colon

Cells will be monitored under a microscope for 3 days and should be ready for counting within 7 days, with potential variations depending on their individual growth rates. Each well on the plate cover will be marked to indicate the location of a single colony. These colonies are then transferred from the wells to larger plates for further culturing. Specific areas where single-cell clones are expected are highlighted for ease of identification.

VALIDATION OF KNOCKOUT CLONES WITH NGS

Once single-cell–derived knockout clones have been established, it is important to verify whether each clone contains the desired insertion or deletion. Western blotting is the most commonly used method to check for knockouts; however, it is difficult to characterize the precise alterations caused by CRISPR/Cas9 at the DNA level. PCR screening can easily identify the knockout status of numerous potential clones using 2 sgRNA knockout approaches. Here, we recommend the use of PCR and next-generation sequencing (NGS) for confirmation of the knockout clones.

Step 1. Genomic DNA Extraction

The extraction of genomic DNA follows the protocol provided by the manufacturer using the QIAGEN DNeasy Blood & Tissue Kit (Cat No. 69504).

Step 2. Validation of Knockout Clones and PCR for NGS

The amplification workflow is illustrated in Figure 3. The first-round PCR is performed using target-specific primers with an overhang adapter sequence, and the second-round PCR is performed using indexing primers. Here is the link to download the file containing the index and adapter sequence information provided by Illumina. Please refer to the attached file to order index primers suitable for your NGS equipment [https://support-docs.illumina.com/SHARE/AdapterSequences/1000000002694_19_illumina_adapter_sequences.pdf].

  • 1.

    Prepare the first-round PCR (Cat No. M0530) in a PCR tube: 10 µl of 5× Phusion HF buffer, 2.5 µl of dNTP (each 2.5 mM), 0.5 µl of F oligo (100 pmol/µl), 0.5 µl of R oligo (100 pmol/µl), 0.5 µl of Phusion DNA polymerase, 1 µl of 10 ng genomic DNA, and 3 µl of nuclease-free water.

  • 2.

    Perform PCR for 30 cycles.

  • 3.

    Perform gel electrophoresis on the PCR products using a 1.5% agarose gel.

  • 4.

    Select clones with the desired deletion as shown in Figure 4.

  • 5.

    Set up the second-round PCR (Cat No. M0530) in a PCR tube: 10 µl of 5× Phusion HF buffer, 2.5 µl of dNTP (2.5 mM each), 0.5 µl of F oligo (100 pmol/µl), 0.5 µl of R oligo (100 pmol/µl), 0.5 µl of Phusion DNA polymerase, 1 µl of selected first-round PCR amplicon (100-fold dilution), and 3 µl of nuclease-free water.

  • 6.

    Run the PCR cycling conditions as in step 2.

  • 7.

    Perform gel electrophoresis on the PCR products using a 1.5% agarose gel.

  • 8.

    Purify the DNA using AMPure XP beads according to the manufacturer’s protocol.

  • 9.

    Perform sequencing using the MiSeq system (Illumina).

Fig. 3.

Fig. 3

Schematic outline of NGS library preparation. NGS library amplification can be divided into 3 steps: first-round PCR, second-round PCR, and PCR cleanup.

Fig. 4.

Fig. 4

Validation strategy for fragment knockout cell lines.

In conclusion, the target sgRNA and insertion/deletion were confirmed through sequencing results using the MiSeq system (Illumina) (Fig. 5).

Fig. 5.

Fig. 5

Sequencing analysis of fragment knockout mammalian cell lines.

Author contributions

Taeyeon Hong and Seung-Min Bae: Investigation, Validation, Data curation, Visualization, Writing–original draft. Gwonhwa Song and Whasun Lim: Conceptualization, Validation, Supervision, Project administration, Funding acquisition, Writing–review & editing.

Declaration of Competing Interests

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Acknowledgments

This research was supported by the Basic Science Research Program through the National Research Foundation of Korea (NRF), funded by the Ministry of Education (grant number: 2019R1A6A1A10073079), and the SKKU Dissertation Support Program. This research was supported by a grant from the Korea Health Technology R&D Project through the Korea Health Industry Development Institute (KHIDI), funded by the Ministry of Health and Welfare, Republic of Korea (grant number: HI22C1424).

ORCID

Taeyeon Hong: https://orcid.org/0000-0002-1827-7062.

Seung-Min Bae: https://orcid.org/0009-0002-0239-9214.

Gwonhwa Song: https://orcid.org/0000-0003-2817-5323.

Whasun Lim: https://orcid.org/0000-0002-1328-0465.

Contributor Information

Gwonhwa Song, Email: ghsong@korea.ac.kr.

Whasun Lim, Email: wlim@skku.edu.

References

  1. Asmamaw M., Zawdie B. Mechanism and applications of CRISPR/Cas-9-mediated genome editing. Biologics. 2021;15:353–361. doi: 10.2147/BTT.S326422. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Bae S.G., Kim H.J., Kim M.Y., Kim D.D.H., Shin S., Ahn J.S., Park J. Identification of cell type-specific effects of mutations on relapse in acute myeloid leukemia. Mol. Cells. 2023;46:611–626. doi: 10.14348/molcells.2023.0093. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Carroll D. RNA in therapeutics: CRISPR in the clinic. Mol. Cells. 2023;46:4–9. doi: 10.14348/molcells.2022.0163. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Charpentier E., Marraffini L.A. Harnessing CRISPR-Cas9 immunity for genetic engineering. Curr. Opin. Microbiol. 2014;19:114–119. doi: 10.1016/j.mib.2014.07.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Cornu T.I., Mussolino C., Cathomen T. Refining strategies to translate genome editing to the clinic. Nat. Med. 2017;23:415–423. doi: 10.1038/nm.4313. [DOI] [PubMed] [Google Scholar]
  6. Lee K., Conboy M., Park H.M., Jiang F., Kim H.J., Dewitt M.A., Mackley V.A., Chang K., Rao A., Skinner C., et al. Nanoparticle delivery of Cas9 ribonucleoprotein and donor DNA in vivo induces homology-directed DNA repair. Nat. Biomed. Eng. 2017;1:889–901. doi: 10.1038/s41551-017-0137-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Park T., Ye S., Shin S.K., Kim K., Hur J.K., Hur J.W. CRISPR-Cas9-generated mouse model of neurofibromatosis type 1. Mol. Cell. Toxicol. 2023;19:277–282. [Google Scholar]
  8. Xu Y., Li Z. CRISPR-Cas systems: overview, innovations and applications in human disease research and gene therapy. Comput. Struct. Biotechnol. J. 2020;18:2401–2415. doi: 10.1016/j.csbj.2020.08.031. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Ye M., Wilhelm M., Gentschev I., Szalay A. A modified limiting dilution method for monoclonal stable cell line selection using a real-time fluorescence imaging system: a practical workflow and advanced applications. Methods Protoc. 2021;4:16. doi: 10.3390/mps4010016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Zou X., Owusu M., Harris R., Jackson S.P., Loizou J.I., Nik-Zainal S. Validating the concept of mutational signatures with isogenic cell models. Nat. Commun. 2018;9:1744. doi: 10.1038/s41467-018-04052-8. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Molecules and Cells are provided here courtesy of Korean Society for Molecular and Cellular Biology

RESOURCES