Detection of fluorescent protein mechanical switching in cellulo

. 2024 Jul 9;4(7):100815. doi: 10.1016/j.crmeth.2024.100815

REAGENT or RESOURCE	SOURCE	IDENTIFIER
Bacterial and virus strains

NEB 5-alpha competent E. coli	New England Biolabs	C2987U

Chemicals, peptides, and recombinant proteins

Fibronectin	Thermo Fisher	33016015
Phalloidin-AF647	Thermo Fisher	A22287
Latrunculin A	Sigma-Aldrich	L5163
DMEMgfp-2 live cell visualization media	Sapphire North America	MC102
Lipofectamine 2000	Thermo Fisher	11668019
OptiMEM	Thermo Fisher	31985070
EcoRI-HF	New England Biolabs	R3101S
NotI-HF	New England Biolabs	R3189S
BamHI-HF	New England Biolabs	R3136S
T4 DNA Ligase	New England Biolabs	M0202S

Critical commercial assays

Gibson Assembly Master Mix	New England Biolabs	E2611S

Experimental models: Cell lines

NIH/3T3 cells	ATCC	Cat# CRL-1658; RRID:CVCL_0594
Vinculin −/− mouse embryonic fibroblasts	Gift from Dr. Ben Fabry and Dr. Wolfgang H. Goldmann, Friedrich-Alexander-Universität Erlangen-Nürnberg; Mierke et al. 2010⁵⁷	N/A

Oligonucleotides

Primer (forward) used in construction of ABDTS, specifically for the generation of fragment containing F-tractin and Linker 1 by PCR using pEGFP-C1 F-tractin-EGFP: CCACTAGTCCAGTGTGGTGGA TGGCGCGACCACGGGGC	Integrated DNA Technologies	N/A
Primer (reverse) used in construction of ABDTS, specifically for the generation of fragment containing F-tractin and Linker 1 by PCR using pEGFP-C1 F-tractin-EGFP: TGCTCACCATCATGGTGGCGA CCGGTAGCG	Integrated DNA Technologies	N/A
Primer (forward) used in construction of ABDTS, specifically for the generation of the fragment containing TSmod by PCR using pcDNA3.1-TSMod: CGCCACCATGATGGTGAGCAAGGGCGAG	Integrated DNA Technologies	N/A
Primer (reverse) used in construction of ABDTS, specifically for the generation of the fragment containing TSmod by PCR using pcDNA3.1-TSMod: CGCTGCCGCCCTTGTACAGCTCGTCCATGC	Integrated DNA Technologies	N/A
Primer (forward) used in construction of ABDTS, specifically for the generation of the fragment containing Linker 2 and F-tractin by PCR using pEGFP-C1 F-tractin-EGFP: GCTGTACAAGGGCGGCAGCGGCAGCGATCCCCC CGTGGCCACCATGGCGCGACCACGGGGC	Integrated DNA Technologies	N/A
Primer (reverse) used in construction of ABDTS, specifically for the generation of the fragment containing Linker 2 and F-tractin by PCR using pEGFP-C1 F-tractin-EGFP: CGGGCCCTCTAGACTCGAGCTTACCCTGCGGCCGCTGC	Integrated DNA Technologies	N/A

Recombinant DNA

pcDNA3.1-VinTS	Grashoff et al. 2010³⁰	Addgene 26019
pcDNA3.1-VinTS-I997A	Rothenberg et al. 2018³⁸	Addgene 111828
pcDNA3.1-VinTS-E1015A	Chirasani et al. 2024³⁹	Addgene 213415
pcDNA3.1-VinTS-E1021A	Chirasani et al. 2024³⁹	Addgene 213416
pcDNA3.1-VinTS-E1015A-E1021A	Chirasani et al. 2024³⁹	Addgene 213417
pRRL-VinTS	Rothenberg et al. 2018³⁸	Addgene 111830
pRRL-VinTS-E1015A-E1021A	Chirasani et al. 2024³⁹	Addgene 213411
pcDNA3.1-ABDTS	This paper	Addgene 215368
pcDNA3.1-ABDTL	This paper	Addgene 215371

Software and algorithms

MATLAB	Mathworks	N/A
MATLAB Code, Image Pre-processing	LaCroix et al. 2018¹⁶	Zenodo: https://doi.org/10.5281/zenodo.11625595 Also see Gitlab: https://gitlab.oit.duke.edu/HoffmanLab-Public/image-preprocessing
MATLAB Code, Three-Channel FRET Image Analysis	LaCroix et al. 2018¹⁶	Zenodo: https://doi.org/10.5281/zenodo.11625634 Also see Gitlab: https://gitlab.oit.duke.edu/HoffmanLab-Public/fret-analysis
MATLAB Code, Simulation and Analysis of Mathematical Models of FP Mechanical Switching in MTSs	This paper	Zenodo: Also see Gitlab: https://gitlab.oit.duke.edu/HoffmanLab-Public/fpmechanicalswitchinmts_model
JMP Pro	SAS	N/A