USP15, activated by TFAP4 transcriptionally, stabilizes SHC1 via deubiquitination and deteriorates renal cell carcinoma

Abstract

Ubiquitin‐specific peptidase 15 (USP15), a critical deubiquitinating enzyme, has been demonstrated to improve substrate stabilization by hydrolyzing the bond between the substrate and ubiquitin, and is implicated in multiple carcinogenic processes. Prompted by the information cited from The Cancer Genome Atlas (TCGA) database and the Cancer Proteogenomic Data Analysis Site (cProSite), USP15 is selectively overexpressed in clear cell renal cell carcinoma (ccRCC) samples. We aimed to investigate the function of USP15 on ccRCC malignant features, which was emphasized in its deubiquitination of SHC adaptor protein 1 (SHC1). The overexpression of USP15 promoted the capacity of proliferation, migration, and invasion in ccRCC CAKI1 and 769‐P cells, and these malignant biological properties were diminished by USP15 deletion in 786‐O cells. USP15 accelerated tumor growth and lung metastasis in vivo. In addition, deubiquitinase USP15 was further identified as a new protector for SHC1 from degradation by the ubiquitination pathway, the post‐translational modification. In sequence, transcription factor activating enhancer binding protein 4 (TFAP4) was shown to be partly responsible for USP15 expression at the level of transcription, as manifested by the chromatin immunoprecipitation and pull‐down assay. Based on the in vitro and in vivo data, we postulate that USP15 regulated by TFAP4 transcriptionally deteriorates ccRCC malignant biological properties via stabilizing SHC1 by deubiquitination.

Upregulation of USP15 promotes ccRCC malignant behavior by increasing SHC1 stabilization via deubiquitination. In addition, the transcription factor TFAP4 contributes to higher expression of USP15 in ccRCC progression.

1. INTRODUCTION

Affecting more than 400,000 individuals worldwide annually, renal cell carcinoma (RCC) is the third most common urologic malignancy in developed regions. ¹ Based on histopathological differences, RCC is divided into three major subtypes: clear cell RCC (ccRCC), papillary renal cell carcinoma (pRCC), and chromophobe renal cell carcinoma (chRCC). ² It is worth noting that more than 70% of patients are diagnosed with the ccRCC subtype, while 15% are pRCC and 5% are chRCC. At present, the main interventions of ccRCC contain radical nephrectomy, nephron‐sparing surgery, and ablative approaches (radiofrequency ablation, microwave thermal ablation, or cryoablation). ³ Although long‐term disease‐free survival is observed in early‐stage patients who had received the standard treatment, no fewer than 30% of individuals develop or present with metastases. ⁴ In order to achieve a better prognosis, seeking a novel target whose expression or activity contributes to ccRCC malignant behavior regulation is worthwhile.

Among various post‐translational modifications, protein ubiquitination and deubiquitination are the common processes related to metabolic reprogramming in cancer cells. ⁵ It is well understood that deubiquitination is the reverse process of ubiquitination and is driven by deubiquitinating enzymes (DUBs), which detach ubiquitin from the substrates. ⁶ Numerous studies describing the imbalance between ubiquitination and deubiquitination have been conducted in various types of cancers, including RCC. ⁷ , ⁸ A systematic exploration completed by Hong et al. illustrated that ubiquitin‐specific peptidase 37 (USP37) serves as a tumor‐promoting factor in ccRCC cells, which is implemented by stabilizing hypoxia‐inducible factor‐2α protein via the deubiquitination approach. ⁹ As another DUB member, ubiquitin‐specific peptidase 15 (USP15) regulates specific substrate stability, and thereby is involved in multiple cancer‐relevant mechanisms. ¹⁰ A recent publication demonstrated that USP15 is selectively overexpressed in CD34‐positive hematopoietic stem and progenitor cells (HSPCs) of patients with acute myeloid leukemia and that USP15 deletion restrained the function and the viability of HSPCs in vitro and in vivo. ¹¹ It has also been reported that deubiquitinase USP15 possesses the specific capacity to inhibit the degradation of estrogen receptor α (ERα), which is considered the essential element for ERα‐targeted breast cancer therapy. ¹² Based on previous research, the role of USP15 in cancer development has been revealed in part, but its function in ccRCC has been seldom reported. When searching the data from The Cancer Genome Atlas (TCGA) database and the Cancer Proteogenomic Data Analysis Site (cProSite), we found that USP15 levels were upregulated in ccRCC samples and that individuals with high USP15 expression had a shorter survival time, emphasizing the importance of USP15 in ccRCC progression. However, whether USP15 expression participates in ccRCC malignant regulation has been seldom explored.

Publicly available databases BioGRID (https://thebiogrid.org/) and HitPredict (http://www.hitpredict.org/) predicted that SHC adaptor protein 1 (SHC1) is one of the potential substrates for USP15. SHC1 is present ubiquitously in three isoforms (SHCp46, SHC p52, and SHC p66) and is recognized as a participator in regulating apoptosis. ¹³ In light of the preceding published data, SHC1 is an important driver in many malignant tumors, especially in bladder cancer, breast cancer, and lung cancer. ¹⁴ , ¹⁵ , ¹⁶ Given the predicted binding relationship between SHC1 and deubiquitinase USP15, it is worth investigating whether SHC1 affects the malignant phenotype of renal cancer cells.

Mounting evidence has also suggested the tumor‐promoting activity of transcription factor activating enhancer binding protein 4 (TFAP4) in malignancies. ¹⁷ TFAP4 is positively related to tumorigenic activity upregulation in hepatocellular carcinoma cells via transcriptionally activating disheveled segment polarity protein 1 (DVL1) and lymphoid enhancer binding factor 1 (LEF1). ¹⁸ Considering the binding between TFAP4 and the USP15 promoter predicted by JASPAR (https://jaspar.genereg.net/), it was unclear whether the biological function of USP15 was regulated by TFAP4.

In order to verify the aforementioned hypothesis, both gain‐of‐function and loss‐of‐function experiments were carried out to investigate the role and the mechanism of USP15 in ccRCC progression.

2. MATERIALS AND METHODS

2.1. Patients

Fresh RCC tissues (n = 63) and the corresponding adjacent tissues (n = 40) were collected during surgery at Shengjing Hospital of China Medical University from September 14, 2021 to March 30, 2023. After esection, the paired tissues were subjected to real‐time PCR and immunohistochemical analysis as described below. [Correction added on 4 August 2024, after first online publication: The sample collection date range has been amended from “January 1, 2022 to March 30, 2022” to ”September 14, 2021 to March 30, 2023”.]

2.2. Cell culture

Human clear cell renal cell cancer cells 786‐O (iCell‐h235), 769‐P (iCell‐h236), OS‐RC‐2 (iCell‐h166), A498 (iCell‐h010), and CAKI1 (iCell‐h033) and renal tubular epithelial HK‐2 (iCell‐h096) cells were obtained from iCell Bioscience Inc. (Shanghai, China). Next, 786‐O, 769‐p and OS‐RC‐2 cells were cultured in RPMI‐1640 medium (Solarbio, Beijing, China), A498 cells were seeded in DMEM (Solarbio, Beijing, China), and CAKI1 were grown in McCoy's 5A medium (Biological Industries). HK‐2 cells were subjected to their specialized medium provided by iCell Bioscience Inc. (Shanghai, China); 10% FBS (Tianhang, Huzhou, China) was used as the supplement. All cells were kept in an incubator with 5% CO₂ in air at 37°C.

2.3. Stable transfection

PLJM1‐EGFP‐puro and pLKO.1‐EGFP‐puro plasmids (Hunan Fenghui Biotechnology Co., Ltd., Changsha, China) were used to mediate the overexpression and knockdown, respectively, of USP15 in ccRCC cells. The USP15 CDS fragments were inserted into the PLJM1‐EGFP‐puro plasmid system and two shRNAs (targeting sequences: 5′‐GGATGCTGGTTTATACCAAGG‐3′; 5′‐GCAGCAAGACTGTCAAGAACT‐3′) were inserted into the pLKO.1‐EGFP‐puroplasmid system. These plasmids were packaged by lentivirus vectors. To establish a cell line with stable high/low expression of USP15, CAKI1 and 769‐P cells were infected with lentivirus vectors carrying USP15 expressing PLJM1‐EGFP‐puro plasmids (OV‐USP15) and 786‐O cells were subjected to lentivirus vector carrying USP15 short hairpin RNA (shRNA1/2‐USP15). The corresponding negative control (OV‐NC/shRNA‐NC) infection served as the control. As all plasmids co‐expressed green fluorescent protein (GFP), flow cytometry was used to sort GFP‐positive cells, which were cultured as stably infected cell lines.

2.4. Transient transfection

To manipulate SHC1/TFAP4 expression in ccRCC cells, the cells were separately exposed to the corresponding overexpressing/interference plasmids (OV‐SHC1, OV‐TFAP4, or shRNA‐TFAP4) without GFP according to the manufacturer's instructions. The cells subjected to the negative control (OV‐NC/shRNA‐NC) transfection were used as the control. The cells were harvested 48 h post transfection for the following procedures.

2.5. In vivo tumor formation assay

To evaluate the in vivo growth ability of stably transfected ccRCC cells, BALB/c nude mice received a subcutaneous injection of CAKI1 cells with stable high USP15 expression or 786‐O cells with stable low expression of USP15 into the axillary fat pads (5 × 10⁶ cells per mouse). The corresponding control cell injection served as the control. The tumor was allowed to grow for 21 days and tumor volume surveillance was performed at 3‐day intervals. After euthanasia, the tumor was isolated for the future detection described below.

2.6. Tumor pathology

USP15 and proliferating cell nuclear antigen (PCNA) expression in the xenografted tumor/clinical samples was detected using immunohistochemistry. Half of the above tumors were embedded in paraffin and sectioned into slices at 5 μm. Then, the sections were exposed to a set of prescribed operations, including dewaxing, antigen retrieval, and blockage. The tissue sections were incubated in diluted primary anti‐USP15 (sc‐515,688, Santa, USA) or anti‐PCNA (A12427, ABclonal, Wuhan, China) antibody at 4°C overnight and HRP‐labeled secondary antibody (#31460, #31430, Thermo Fisher Scientific, USA) at 37°C for 1 h. The USP15/PCNA‐positive cells were visualized using a 3,3′‐diaminobenzidine (DAB) chromogenic kit (Maixin Biotechnology Development Co. Ltd., Fuzhou, China) and photographed under an inverted phase contrast microscope (Olympus, Japan).

2.7. In vivo pulmonary metastatic assay

BALB/c nude mice received an injection of the above‐mentioned CAKI1 cells (2 × 10⁶ cells per mouse) with stable high USP15 expression via the tail vein and the CAKI1 cells were allowed to metastasize in vivo for 4 weeks. After anesthesia, the fluorescence signal was detected using the IVScope 8200 Imaging System. The lung tissues were collected and hematoxylin and eosin (H&E) staining was carried out to detect the presence of tumor cells.

2.8. Dual‐luciferase reporter gene assay

HEK‐293 T cells were co‐transfected with the pGL3‐basic vector carrying the USP15 promoter fragment and TFAP4 expressing plasmid with lipofectamine 3000 to assess the interaction between the USP15 promoter and transcription factor TFAP4. The respective plain vector intervention was as the control.

2.9. Chromatin immunprecipitation (ChIP)

Formaldehyde‐fixed 786‐O cells were lysed and sheared into small fragments (the target size of chromatin fragments was 500–1000 bp) using sonication. The chromatin fragments were immunoprecipitated by the ChIP‐grade antibody against IgG or TFAP4 at 4°C overnight. Then, the chromatin–antibody mixture was added with protein A/G agarose beads according to the manufacturer's instructions (Wanlei Biological Technology Co., Ltd., Shenyang, China). After purification, the DNA fragments were amplified by PCR, which was repeated using three‐pair primers.

2.10. DNA pull‐down assay

A DNA pull‐down assay was performed to confirm the binding between TFAP4 protein and the USP15 promoter using a DNA pull‐down assay kit (BersinBio, Guangzhou, China) according to the manufacturer's protocol. In brief, USP15 promoter probes (Generalbiol, Chuzhou, China) were used for crosslinking in magnetic DNA beads to generate probe‐coated beads. The 786‐O cells were lysed and incubated with the probe‐coated beads for 30 min. Then, the DNA–protein complexes loaded on the surface of magnetic beads were eluted to obtain the proteins bound to the DNA probes. Finally, these proteins were extracted for western blot, described as follows.

2.11. Real‐time PCR

Total RNA extracted from ccRCC cells or clinical samples was used to synthesize cDNA by reverse transcription; procedures were conducted in an Exicycler TM96 real‐time quantitative system using the SYBR Green PCR Kit (Solarbio, Beijing, China). The primers were: USP15 forward, 5′‐GCTTTGACAGTTGGGACA‐3′; USP15 reverse, 5′‐CACCTTTCGTGCTATTGG‐3′; TFAP4 forward, 5′‐CCAGTCCCTCAAGACCCTC‐3′; and TFAP4 reverse, 5′‐CTCGTCCTCCCAGATGTCC‐3′

2.12. Statistical analysis

GraphPad Prism 8.0 was used to conduct data analysis. The data from two groups were analyzed using two‐tailed paired or unpaired Student's t‐test and one‐way or two‐way analysis of variance (ANOVA) followed by Tukey's multiple comparison test, applied for these for three or more groups. The data were represented as mean ± SD and a p‐value < 0.05 was considered to be significant statistically.

3. RESULTS

3.1. USP15 expression in clinical ccRCC samples

The expression levels of USP15 were markedly elevated in kidney tumor samples compared with the adjacent tissues and the normal tissues by analyzing TCGA and cProSite information (Figure 1A, Normal (n = 159), Adjacent (n = 72), ccRCC (n = 530); Figure 1B, Adjacent (n = 110), Kidney tumor (n = 110), p < 0.001), in addition, the survival of ccRCC patients with high USP15 expression was shorter than that of patients with low USP15 expression (Figure 1C, ccRCC (n = 101), p < 10.05). Higher expression of USP15 was notably correlated with the primary tumor stage, Fuhrman grade, and Tumour, Node, Metastasis (TNM) stage (Table 1, p < 0.05). Although the real‐time PCR and immunohistochemical assays targeting USP15 were used to confirm its high expression in our collected ccRCC tumors (Figure 1D, Adjacent (n = 40), ccRCC (n = 40), Figure 1E, Adjacent (n = 40), ccRCC (n = 40), p < 0.001), whether USP15 was involved in the progression of ccRCC remained to be investigated.

FIGURE 1.

USP15 expression in clinical RCC samples. (A) Left: USP15 mRNA expression in ccRCC samples and non‐cancerous samples cited from TCGA database. Right: Welch's t‐test is used to estimate the significant difference in expression levels between normal or adjacent tissues and ccRCC tumors from TCGA+GTEx database. ***p < 0.001 versus the normal/adjacent group. Normal (n = 159), Adjacent (n = 72), ccRCC (n = 530). (B) USP15 protein expression in kidney cancer samples and adjacent normal samples citing from the cProSite database . A t‐test is used to estimate the significant difference in expression levels between adjacent tissues and kidney tumors. ***p < 0.001 versus the adjacent group. Adjacent (n = 110), kidney tumor (n = 110). (C) Survival curve for the overall survival (OS) of ccRCC patients in the high‐risk group and low‐risk group according to the best cut‐off value cited from Kaplan–Meier Plotter in the E‐MTAB‐1980 datasets. *p < 0.05. ccRCC (n = 101). (D) USP15 mRNA levels in RCC tumors and adjacent tissues of the collected clinical samples. Adjacent (n = 40), RCC (n = 40). (E) USP15 immunohistochemistry in RCC and the peritumoral samples. Adjacent (n = 40), RCC (n = 40). Data are represented as the mean ± SD and analyzed by paired t‐test. ***p < 0.001 vs. the adjacent group.

TABLE 1.

Correlation between USP15 expression level and clinic pathological parameters of RCC patients.

Clinical parameters	Cases	USP15 expression level		p‐value
		Low	High
Sex				0.781
Male	46	18	28
Female	17	6	11
Age
≤60	34	11	23	0.310
>60	29	13	16
pT
pT1 + pT2	55	24	31	0.047
pT3 + pT4	8	0	8
Fuhrman grade
G1 + G2	45	21	24	0.027
G3 + G4	18	3	15
TNM stage
I + II	54	24	30	0.030
III + IV	9	0	9

3.2. USP15 functioned as a tumor‐promoting factor in vitro

As shown in Figure 2A and Figure S1A, the basal expression levels of USP15 and SHC1 were determined. Unsurprisingly, both USP15 and SHC1 protein expression was observably increased in ccRCC cell lines compared with renal tubular epithelial HK‐2 cells. Next, CAKI1 and 769‐P cells with stably high expression of USP15 and 786‐O cells with stably low expression were established (Figure 2B and Figure S1B, p < 0.001). We found that the proliferation ability was elevated with USP15 overexpression in CAKI1 and 769‐P cells, as shown by the data from the CCK‐8 assay and clone formation assay (Figure 2C,D and Figure S1C, p < 0.05). Flow cytometry detection further exhibited that stably overexpressed USP15 accelerated the cell cycle in CAKI1 and 769‐P cells (Figure 2E, p < 0.01), which was confirmed by the expression changes in P21, P27, and PCNA (Figure 2F and Figure S1D, p < 0.001). These malignant behaviors were reversed by USP15 silencing in 786‐O cells, suggesting that USP15 was involved in proliferation enhancement in ccRCC cells.

FIGURE 2.

USP15 functions as a tumor‐promoting factor in vitro. (A) Protein levels of USP15 and SHC1 in human renal tubular epithelial HK‐2 cells and ccRCC cells, including A498, 769‐P, 786‐O, OS‐RC‐2, and CAKI1 cells. (B) Protein levels of USP15 in CAKI1, 769‐P, and 786‐O cells after the corresponding stable transfection. (C) Proliferation curve in stably transfected CAKI1, 769‐P, and 786‐O cells. (D) Clone formation assay of USP15‐manipulated CAKI1, 769‐P, and 786‐O cells. (E) Cell cycle distribution in CAKI1, 769‐P, and 786‐O cells with stable transfection. (F) Representative western blots for P21, P27, and PCNA in USP15‐overexpressing CAKI1 and 769‐P cells and USP15‐silenced 786‐O cells. Data are represented as the mean ± SD (n = 3) and analyzed by one‐way analysis of variance (ANOVA) followed by Tukey's multiple comparison test. *p < 0.05, **p < 0.01, and ***p < 0.001 vs. the corresponding control group.

3.3. The growth promotion effect of USP15 in vivo

Furthermore, stably transfected CAKI1 or 786‐O cells were injected subcutaneously into male nude mice to investigate oncogenicity. As exhibited in Figure 3A, faster tumor growth was found in mice with the injection of CAKI1 with stable high USP15 expression (p < 0.01). By contrast, 786‐O cells with stable low expression of USP15 were smaller than the controls. Consistent with the above tumor growth trend, more USP15 and PCNA‐positive cells were presented within the bigger tumor mass (Figure 3B, p < 0.001). These in vivo results showed the tumor‐promoting effect of USP15 in ccRCC progression.

FIGURE 3.

The growth promotion effect of USP15 in vivo. (A) Tumor growth trends and typical images at day 21 after subcutaneous injection. (B) Immunohistochemistry targeting USP15 and PCNA of the tumor at ×400 magnification. Data are represented as the mean ± SD (n = 8) and analyzed by unpaired two‐tailed Student's t‐test or one‐way analysis of variance (ANOVA) followed by Tukey's multiple comparison test. **p < 0.01, and ***p < 0.001 vs. the corresponding control group.

3.4. USP15 played an active role in ccRCC metastasis

By performing wound healing and transwell assay, the abilities to migrate and invade were visualized in ccRCC cells. As shown in Figure 4A, stable USP15 overexpression improved the migratory and invasive capacity in CAKI1 and 769‐P cells (p < 0.01). Conversely, USP15 depletion resulted in the opposite changes in 786‐O cells (p < 0.05). The in vitro experiment prompted us to investigate whether a similar phenomenon occurred in vivo. Hence, NOD/SCID mice received an injection of CAKI1 cells overexpressing USP15 into the tail veins and bioluminescence intensity was detected (Figure 4B, p < 0.001). Combined with lung nodule HE staining, pulmonary metastases were accelerated in USP15 overexpression in CAKI1 cells. The results demonstrated the facilitating effects of USP15 on ccRCC metastasis.

FIGURE 4.

USP15 plays an active role in ccRCC metastasis. (A) Cell migration and invasion were assessed by wound healing (at ×100 magnification) and transwell assay (at ×100 magnification) in ccRCC cells with stable transfection, respectively (n = 3). (B) Bioluminescence images of NOD/SCID mice injected with CAKI1 cells overexpressing USP15 and H&E staining of tumor tissues in lungs at ×100 magnification. Data are represented as the mean ± SD (n = 6) and analyzed by one‐way analysis of variance (ANOVA) followed by Tukey's multiple comparison test. *p < 0.05, **p < 0.01 and ***p < 0.001 vs. the corresponding control group.

3.5. USP15 contributed to SHC1 stabilization via deubiquitination

By searching publicly available databases BioGRID and Hitpredict, we found that SHC adaptor protein 1 (SHC1) was a potential substrate for USP15 (Figure S2A,B). The expression of SHC1 was increased with USP15 overexpression in CAKI1 cells, but decreased in 786‐O cells depleted of USP15 (Figure 5A and Figure S3A, p < 0.001). The reduced malignant behaviors, including increased proliferation ability and robust metastatic capability, were observed in CAKI1 cells overexpressing SHC1 (Figure 5B–D and Figure S3B, p < 0.05). In addition, the anti‐proliferative, anti‐migratory, and anti‐invasive functions of USP15‐depleted 786‐O cells were abolished after the SHC1 gain‐of‐function procedure (Figure 5E–G and Figure S3B, p < 0.05). In addition, the percentages of apoptosis in USP15‐silenced 786‐O cells were increased but this effect was partly attenuated by SHC1 reacquisition (Figure S4A,B, p < 0.001). By staining USP15 and SHC1 using the immunofluorescence method, we found that USP15 and SHC1 were mostly co‐located in the cytoplasm (Figure 5H). Cell lysates of CAKI1 and 786‐O cells were subjected to co‐immunoprecipitation (co‐IP) assay and the data in Figure 5I confirmed this assumption. SHC1 degradation suppression induced by proteasome inhibitor MG132 incubation was enhanced by USP15 overexpression in CAKI1 cells (Figure 5J). The following co‐IP assay not only proved the existence of binding between SHC1 and ubiquitin, but also suggested that their interaction was regulated by USP15 in ccRCC cells (Figure 5K). These results together exhibited that SHC1 possessed the ability to regulate ccRCC malignant phenotypes, which conferred the regulatory effects of USP15 on ccRCC.

FIGURE 5.

USP15 contributes to SHC1 stabilization via deubiquitination. (A) Protein levels of SHC1 in CAKI1 and 786‐O cells after the corresponding stable transfection. (B) A CCK8 assay was used to assess the proliferation in CAKI1 cells with transient transfection of OV‐SHC1. (C) Representative western blots for P21, P27, and PCNA in CAKI1 cells with SHC1 overexpression. (D) Cell migratory and invasive abilities are detected in SHC1 overexpressing CAKI1 cells. (E) Proliferation in USP15‐silenced 786‐O cells after SHC1 reacquisition. (F) Representative western blots for P21, P27, and PCNA in 786‐O cells with SHC1 overexpression. (G). Migration and invasion in USP15‐silenced 786‐O cells after SHC1 reacquisition. (H) Double immunofluorescence staining targeting USP15 and SHC1 in CAKI1 and 786‐O cells. (I) Interaction between USP15 and SHC1 was detected by co‐IP assay in CAKI1 and 786‐O cells. (J) Degradation of SHC1 was detected in CAKI1 cells after 10 μM MG132 incubation. (K) SHC1 and ubiquitin binding was verified by co‐IP assay. Data are represented as the mean ± SD (n = 3) and analyzed by unpaired two‐tailed Student's t‐test or one‐way analysis of variance (ANOVA) followed by Tukey's multiple comparison test. *p < 0.05 and **p < 0.01 versus the corresponding control group.

3.6. USP15 expression is transcriptionally regulated by TFAP4

According to the prediction using the JASPAR CORE database (https://jaspar.genereg.net/), the USP15 promoter was a target of transcription factor TFAP4 (Figure S2C). Both the mRNA and protein levels of USP15 were positively related to TFAP4 expression (Figure 6A and Figure S3C, D, p < 0.01). It was not difficult to find that overexpressing TFAP4 promoted proliferation and invasion in 786‐O cells (Figure 6B,C, p < 0.05). Next, the binding between the USP15 promoter and transcription factor TFAP4 was verified by dual‐luciferase assay (Figure 6D, p < 0.001); these results were also confirmed by chromatin immunoprecipitation (ChIP) and pull‐down assay (Figure 6E,F). The results demonstrated that TFAP4 served as a transcriptional activator of USP15 in ccRCC cells.

FIGURE 6.

USP15 expression was transcriptionally regulated by TFAP4. (A) mRNA and protein levels of TFAP4 and USP15 in 786‐O cells after TFAP4 manipulation. (B) Proliferation ability and (C) invasion ability of 786‐O cells with TFAP4 overexpression. (D) Relationship between transcription factor TFAP4 and the USP15 promoter was assessed by dual‐luciferase assay. (E) ChIP assay (by qPCR method) and (F) oligonucleotide pull‐down assay were used to verify TFAP4 and USP15 promoter binding in 786‐O cells. Data are represented as the mean ± SD (n = 3) and analyzed by one‐way analysis of variance (ANOVA) followed by Tukey's multiple comparison test. *p < 0.05 and ***p < 0.001 vs. the corresponding control group.

4. DISCUSSION

Due to the selectively higher USP15 expression in ccRCC samples based on database information, we investigated the biological function and mechanism of USP15 in ccRCC cells and xenograft models. The pro‐ccRCC effects of USP15 were supported by our in vitro and in vivo results. In addition to promoting proliferation, migration, and invasion of ccRCC cells, USP15 accelerated tumor in situ growth and lung metastasis in experimental animals. Notably, we found that the latent mechanism by which USP15 acted as a ccRCC promoter was through stabilizing SHC1 via deubiquitination. In addition, TFAP4 was shown to be partly responsible for USP15 expression at the level of transcription. Our study demonstrated that USP15 regulated by TFAP4 transcriptionally promoted ccRCC malignant biological properties. These were via SHC1 stabilization by deubiquitination and provided a novel insight into developing ccRCC therapeutic strategies (Figure 7).

FIGURE 7.

Graphical abstract. Upregulation of USP15 promotes ccRCC malignant behavior by increasing SHC1 stabilization via deubiquitination. In addition, the transcription factor TFAP4 contributes to higher expression of USP15 in ccRCC progression.

Based on our search of TCGA database, the higher USP15 expression and shorter overall survival were observed in patients diagnosed with ccRCC, hinting at the participation of USP15 in ccRCC. Recently, USP15's role in tumor promotion was certified in breast cancer and acute myeloid leukemia. ¹¹ , ¹² To date, other USP members were also considered as oncogenes in various types of malignancies. For instance, USP10 levels were decreased in clear cell RCC without p53 mutation. Mechanically, USP10 deubiquitinates p53, contributes to p53 stability, and thereby retains its activity. ¹⁹ Similarly, the process of ZHX2 deubiquitination catalyzed by USP13 is the committed step in the tumorigenesis of ccRCC. ²⁰ Due to such evidence, all the findings indicated that USP15 serves as a probable tumor‐promoting factor in ccRCC, furthermore USP15 suppression might achieve the purpose of ccRCC symptom management. In turn, we reconfirmed the higher USP15 levels in a series of ccRCC cells by assessing its expression, two ccRCC cell lines with low USP15 expression (CAKI1 and 769‐P cells) and one with high expression (786‐O cells) were chosen to manipulate USP15. Similar to that mentioned previously, our data showed that USP15 overexpression reduced malignant behavior in ccRCC cells, while USP15 silencing had the opposite effect, suggesting the pro‐ccRCC role of USP15. More importantly, the dual‐function of USP15 in regulating different cancer progression has been determined. As a tumor‐inhibiting factor, USP15 knockout in lung cancer cells promotes malignant phenotype transformation, including increasing proliferation and metastasis, which was attributed to the stabilization of BECN1 by deubiquitination, thereby attenuating autophagy induction. ²¹ Therefore, other molecular regulatory mechanisms for USP15 deserve further investigation, which will be done in a future study.

For the deubiquitylation activity of USP15, the role of its substrate cannot be ignored. As described above, the positive relationship between SHC1 and USP15 was presented. As the adapter protein in signal transduction pathways, SHC1 may potentially be involved in the regulation of numerous signaling pathways critical for metabolism in pan‐cancer cells, as well as the phosphorylated protein‐related functions. Large‐scale pan‐cancer studies analyses and systematic studies based on GTEx, TCGA, and Oncomine databases and the National Cancer Institute's Clinical Proteomic Tumor Analysis Consortium (CPTAC) have presented a robust acceleration of SHC1 in tumorigenesis. ²² It has been reported that polymerase I and transcript release factor (PTRF) levels, which are modulated by molecule SHC1, were detected in urine exosomes and are a ccRCC potential biomarker. ²³ Except for noting the co‐localization of SHC1 and USP15, we found regulation of deubiquitination between them based on additional co‐IP data. Here, we preliminarily deduced that SHC1 deubiquitination mediated by USP15 was one of the key points related to ccRCC malignancy. Moreover, dysfunction of the von Hippel‐Lindau (VHL) tumor suppressor gene is a feature of ccRCC. As VHL targets hypoxia‐inducible transcription factor (HIF‐α) for degradation, VHL inactivation and HIF‐α activation were associated with the oncogenic driver. ²⁴ USP15 is a component of the COP9 signalosome complex (CSN), which is associated with VHL. ²⁵ , ²⁶ Therefore the interaction between USP15 and VHL requires intensive study in the future.

It has been well established that dysregulated transcriptional programs are closely related to the occurrence and development of various neoplasias, including ccRCC. ²⁷ As predicted by the JASPAR bioinformatics database, there is a highly plausible binding site between transcription factor TFAP4 and the USP15 promoter. Belonging to the basic helix–loop–helix‐zipper family possessing a basic DNA binding domain, TFAP4 activates target gene transcription by binding to the symmetrical DNA sequence CAGCTG. ²⁸ Several preceding attempts have been made to exposit the involvement of TFAP4 in different types of malignancies, such as prostate cancer and colorectal cancer. ²⁹ , ³⁰ Hence, we looked into the biological functions of TFAP4 in ccRCC cells and whether TFAP4 had a transcriptional regulatory role on USP15. Fortunately, the enhancement of ccRCC proliferation and metastasis was observed with TFAP4 overexpression as expected. Moreover, the activation of USP15 by TFAP4 as a transcription factor was validated by the following ChIP and pull‐down assay, which would provide a novel theoretical basis for a deeper understanding of renal carcinogenesis.

Collectively, our study demonstrated that USP15 upregulation accelerates ccRCC malignant behavior, which may attributed to increased SHC1 stabilization via deubiquitination. Additionally, the transcription activator TFAP4 contributes to higher USP15 levels in ccRCC, providing a preclinical basis for ccRCC management.

AUTHOR CONTRIBUTIONS

Yaxing Shi: Conceptualization; data curation; formal analysis; investigation; methodology; visualization; writing – original draft. Jing Zhang: Conceptualization; data curation; formal analysis; investigation; methodology; visualization; writing – original draft. Jiaxing Li: Methodology; visualization. Jieqian He: Methodology; visualization. Si Wu: Data curation; resources. Miao Yu: Data curation; resources. Da Yang: Investigation; validation. Lincheng Ju: Conceptualization; funding acquisition; project administration; resources; supervision; writing – review and editing.

FUNDING INFORMATION

This work was supported by the 345 Talent Project of Shengjing Hospital of China Medical University (Lincheng Ju).

CONFLICT OF INTEREST STATEMENT

The authors declare no conflict of interest.

ETHICS STATEMENTS

Approval of the research protocol by an Institutional Review Board: This study was in compliance with the Helsinki Declaration and approved by the Ethics Committee of Shengjing Hospital of China Medical University (2020PS749K).

Informed Consent: Informed consents were signed by all patients.

Registry and the Registration No. of the study/trial: N/A.

Animal Studies: The mice were well cared for during the experiment, which was conducted in strict accordance with the requirements of the Health Guide for the Care and Use of Laboratory Animals and approved by the Committee Ethics of Shengjing Hospital of China Medical University (2022PS695K).

Supporting information

Figure S1.

Shi Y, Zhang J, Li J, et al. USP15, activated by TFAP4 transcriptionally, stabilizes SHC1 via deubiquitination and deteriorates renal cell carcinoma. Cancer Sci. 2024;115:2617‐2629. doi: 10.1111/cas.16237

DATA AVAILABILITY STATEMENT

All relevant data are available from the authors upon request.