Skip to main content
. 2000 Nov 1;28(21):4382–4390. doi: 10.1093/nar/28.21.4382

Figure 3.

Figure 3

Figure 3

Figure 3

Incorporation of AB-dATP and DB-dATP by DNA polymerase I is efficient and does not preclude further primer extension. (A) Scheme of incorporation. The primer extension reaction was performed on immobilized DNA template pXP10/XEH annealed with complementary oligonucleotide d(pCCATCCAAGTACTAACCAGGCCC). In the first step [α-32P]dGMP was incorporated using the exonuclease-free Klenow fragment of DNA polymerase I and the immobilized DNA was extensively washed to remove unincorporated nucleotide. Primer extension was continued with varying amounts of modified dATP and later all four nucleotides were added to chase the product to full length. (B) Samples were loaded onto a 10% polyacrylamide gel containing 8.3 M urea and the dried gel analyzed by autoradiography. Lane 1 is the sample after incorporation of [α-32P]dGTP and lanes 3, 5, 7, 9, 11 and 13 are samples containing the [α-32P]dGMP-labeled primer incubated with the Klenow fragment and varying concentrations of AB-dATP. In lanes 2, 4, 6, 8, 10 and 12 dATP was added in place of AB-dATP. Lanes 2′–13′ are samples from lanes 2–13 in which all four dNTP were added. (C) Lane 1 is the sample after incorporation of [α-32P]dGTP and lanes 3, 5, 7, 9, 11 and 13 are samples with varying concentration of DB-dATP. In lanes 2, 4, 6, 8, 10 and 12 dATP was added in place of DB-dATP and in lanes 2′–13′ the samples with DB-dATP were subsequently chased by addition of all four dNTPs.