Skip to main content
NCBI home page
Poultry Science logoLink to Poultry Science
. 2024 Jun 28;103(9):103996. doi: 10.1016/j.psj.2024.103996

Effects of oregano and/or rosemary extracts on growth performance, digestive enzyme activities, cecal bacteria, tight junction proteins, and antioxidants-related genes in heat-stressed broiler chickens

Mahmoud Madkour ⁎, Mohamad M Aboelenin †, Walid S Habashy ‡, Ibrahim A Matter §, Mohamed Shourrap #, Ahmed A Elolimy ⁎,ǁ,1, Osama Aboelazab *
PMCID: PMC11315179  PMID: 39024691

Abstract

The study examined the impact of adding oregano extract and/or rosemary to broiler diets to counteract the growth inhibition caused by heat stress (HS). It also investigated the effects on the activity of digestive enzymes, microbiological composition, and the expression of antioxidant and tight junction-related proteins. Three hundred- and fifty-day-old male broilers, were randomly assigned to 7 treatment groups, with each group comprising 5 replicates, and each replicate containing 10 chicks in a cage. The diets were: 1) a basal diet, 2) a diet supplemented with 50 mg/kg of rosemary, 3) a diet supplemented with 100 mg/kg of rosemary, 4) a diet supplemented with 50 mg/kg of oregano, 5) a diet supplemented with 100 mg/kg of oregano, 6) a combination diet containing 50 mg/kg each of rosemary and oregano, and 7) a combination diet containing 100 mg/kg each of rosemary and oregano. Dietary oregano extract enhanced the growth and feed utilization of heat-stressed birds, especially at a concentration of 50 mg/kg. Moreover, oregano extract improved jejunal protease and amylase activities. The extracts of rosemary and oregano significantly reduced IgG and IgM levels. Dietary 50 mg oregano extract significantly upregulated intestinal integrity-related genes including jejunal CLDNI, ZO-1, ZO-2, and MUC2. Dietary 50 mg oregano extract significantly downregulated hepatic NADPH oxidase 4 (NOX4) and nitric oxide synthase 2 (NOS2) expressions. Our results suggest that incorporating oregano leaf extract into the diet at a concentration of 50 mg/kg improves the growth performance of broilers exposed to heat stress. This improvement could be attributed to enhanced gut health and the modulation of genes associated with oxidative stress and tight junction proteins.

Key words: heat stress, rosemary and oregano leaf extract, broiler, tight junction protein, antioxidants-related gene

INTRODUCTION

Heat stress (HS) poses a substantial risk to the livestock industry, resulting in huge financial losses, especially in the context of climate change. HS can adversely impact the immune system, overall health, productivity, and animal well-being (Roushdy et al., 2018; Madkour etal.,2020; Wen et al., 2021; Hashem et al., 2024). Poultry are particularly susceptible to HS due to their extensive feather covering and lack of sweat glands, which hinders their ability to release body heat to the surrounding environment (Zhang et al., 2017). modern broiler chickens have higher productivity compared to their wild Gallus gallus counterparts, although they face challenges in adapting to fluctuations in their surroundings (Abd El-hack et al., 2020).

Various solutions have suggested alterations to the design of housing, cooling systems, and dietary composition to alleviate the detrimental impacts of temperature challenges in chickens. (Alagawany et al., 2017; Madkour et al., 2022). Lately, a range of plant oils or extracts have been utilized to alleviate the negative impacts of heat in chickens (Alagawany et al.,2022a). Oregano (Origanum vulgar L.) and Rosemary (Rosmarinus officinalis L.) have been notably researched for their characteristics. especially, the oregano essential oil has been found to have antibacterial (Lambert et al., 2001) and antioxidant (Botsoglou et al., 2004) characteristics in vitro and in Vivo studies, due to the presence of Carvacrol and thymol (Martinez-Tome et al., 2001; Kulisic et al., 2004). Rosemary, a member of the Labiatate family, possesses notable antioxidative characteristics. These properties are attributed to the presence of phenolic terpenes, including rosmarinic acid and rosmarol (Cuppett and Hall 1998). Multiple studies have documented enhanced performance in chickens that were fed a combination of plant extracts (Hernandez et al. 2004; Jamroz et al. 2006). However, there has been a scarcity of studies undertaken to assess the efficacy of combining oregano and rosemary extracts in broiler trials specifically in the context of HS. The present research investigated the effects of incorporating oregano extract and/or rosemary into broiler diets to counteract the growth inhibition caused by HS and mitigate any negative impacts on digestive enzyme activity, microbiological composition, and mRNA expressions of antioxidants and tight junction-related proteins.

MATERIALS AND METHODS

The research protocols received approval from the Medical Research Ethics Committee (MREC) of the National Research Centre, Egypt, under the ethical approval code (05410223).

Rosemary and Oregano, Preparation and Extraction

Rosemary and oregano leaves were harvested, desiccated, and subsequently pulverized using a mixer grinder to obtain a finely powdered form, which was utilized for the preparation of the extracts as reported (Madkour et al.,2024).

Experimental Procedures

Housing Procedures

Chicks were raised in 160 × 70 × 40 cm galvanized metal cages, each with a single feeder and a scaled water tank. Electric warmers and water utensils were used to control the temperatures inside the rearing unit.

Animals Management

Throughout the five-week experimental period, 350 one-day-old male broilers were randomly assigned and divided into 7 equal treatments based on their weight, with an average weight of 41.0 g. The birds had ad libitum access to feed and water throughout the study. The group fed the basal diet served as the control group. The remaining groups, designated as the second, third, fourth, fifth, sixth, and seventh groups, were supplemented with various concentrations of rosemary and oregano leaf extracts. The second group was provided with 50 mg/kg of rosemary extract (R1), the third group was administered 100 mg/kg of rosemary extract, labeled as R2, the fourth group was given 50 mg/kg of oregano extract (O1), while the fifth group received 100 mg/kg of oregano extract (O2), the 6th group received 50 mg/kg of both rosemary and oregano extracts (R1O1), and the 7th group received 100 mg/kg of both rosemary and oregano extracts (R2O2) in their diets (Table 1). The basal diets were developed following the National Research Council (NRC), (1994) recommendations for growing broiler chickens.

Table 1.

Formulation and nutrient composition of the basal diets.

Ingredients Starter diet (%) Grower-finisher diet (%)
Yellow corn 61.55 66.15
Soybean meal, 44% 16.05 15.75
Corn gluten meal 16.25 12.15
Sunflower oil 1.00 1.00
Di-Ca-P 1.85 1.85
Ground limestone 1.95 1.95
Premix1 0.30 0.30
NaCl (salt) 0.30 0.30
L-lysine-HCl 0.60 0.40
DL-Methionine 0.15 0.15
Total 100 100
Calculatedanalysis2 (as feed basis)
Metabolizable energy (kcal/kg) 3150 3142
Crude protein, % 23.02 20.17
Ether extract, % 3.90 3.97
Crude fiber, % 2.70 2.69
Calcium, % 1.20 1.20
Available phosphorus, % 0.45 0.45
Lysine, % 1.21 1.11
Methionine, % 0.45 0.40
Methionine+ cystine, % 0.85 0.75
Open in a new tab
1

Vitamin premix supplied per Kg of diet: Vit A, 12000 IU; Vit D3, 2200 IU; Vit E, 10 mg; Vit K3, 2 mg; Vit B1, 1mg; Vit B2, 4mg; Vit B6, 1.5mg; Vit B12, 10mg; Niacin, 20 mg; Pantothenic acid, 10 mg; Folic acid, 1 mg; Biotin, 50 mg; phytase enzyme and xylanase enzyme.

2

According to NRC (1994).

Each treatment had 5 cages, which were considered five replicates, with ten chicks in each cage. The chicks received the starter diet for the first 21 d and the finisher diet from 22 to 35 d of age.

Temperature-Humidity Index

Throughout the experiment, the ambient temperature (Tm) and relative humidity (RH) were monitored twice daily via using 3 hydro-thermograph devices. The temperature humidity index (THI), derived from the relationship between Tm and RH, was utilized to indicate the presence or absence of heat stress (HS). Marai et al. (2001) adapted the THI to suit small animals. The obtained values are categorized as follows:

Below 27.8 signifies no heat stress (HS). Between 27.8 and 28.9 denotes moderate HS. Ranging from 28.9 to 30.0 indicates severe HS. A total of 30.0 and above signifies very severe HS. In this study, the average values of temperature (Tm) and relative humidity (RH) were 31.9°C and 50%, respectively (refer to Figure 1). Weekly, the temperature humidity index (THI) varied from a minimum of 27.37 to a maximum of 31.08. The average THI computed was 29.19, indicating that the birds experienced severe heat stress conditions throughout the entire experimental period.

Figure 1.

Figure 1

Open in a new tab

The ambient temperature (Tm), relative humidity (RH), and the temperature humidity index (THI) throughout the experimental period.

MEASUREMENTS

Growth Performance

The broilers were weighed according to their cages on d 1, 21, and 35. Additionally, the feed allocated to each cage was measured and recorded. Body weight gain (BWG), feed consumption (FC), and feed-to-gain ratio (FCR) were computed for each cage to assess the growth performance of the broilers. No mortality was observed during the experimental period.

Physiological Parameters

At the end of the trial time, five birds were randomly selected from each experimental group. Heparinized tubes were used to collect blood samples at slaughter time and centrifuged at 4,000 rpm for 10 min at 4°C. The resulting plasma was kept at -20°C until biochemical analysis (El-Wardany et al.,2016, Alagawany et al.,2022b).

Henry (1974) approach was applied to measure the plasma total protein concentration (g/dL). An established colorimetric method for measuring plasma albumin (g/dL) was reported by Dumas et al. (1997). The A/G ratio was computed after subtracting the albumin level from the total protein level, which yielded the globulin level. The technique outlined by Bianchi et al. (1995) was used to quantify the immunoglobulins IgG and IgM.

Isolation of Total RNA and RT-PCR Analysis

Upon slaughtering, jejunum, and liver samples (5 per group) were swiftly dissected, and liquid nitrogen was used to flash-frozen and subsequently stored at -80°C for further gene expression analyses. Total RNA extraction from the jejunum and liver samples implemented the procedure as previously outlined by Madkour et al. (2021). To assess both the quality and quantity of RNA, agarose gel electrophoresis and the NanoDrop 1,000 were utilized, respectively. qPCR analyses and cDNA synthesis were conducted following Hemida et al. (2023). The primer pairs used in the current study are listed in Table 2, with beta-actin and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) serving as reference genes.

Table 2.

The primer's sequences and annealing temperature (Tm) used in the present study.

Gene Primer sequence (5–3) PCR product size (bp) Accession number Annealing Tm (ºC)
SOD F AGGGGGTCATCCACTTCC 122 NM_205064.2 54
R CCCATTTGTGTTGTCTCCAA
SOD2 F CTGACCTGCCTTACGACTATG 131 NM_204211.2 56
R CGCCTCTTTGTATTTCTCCTCT
CAT F GAAGCAGAGAGGTTCCCATTTA 142 NM_001031215.2 56
R CATACGCCATCTGTTCTACCTC
NOS2 F ACTGAAGGTGGCTATTGGGC 149 NM_204961.2 55
R TGTTTGTCTCCTTCCGCTGT
GSH-Px 4 F GGGGAATGCCATCAAGTGGAA 117 NM_204220.3 57
R TAGGCGGGCAGATCCTTCTC
GR F GCCATCGTGAAAAGAGAAGG 94 NM_001037826.1 54
R TTTCAACCACATCGTGCAT
NOX4 F CCAGACCAACTTAGAGGAACAC 126 NM_001101829.3 55
R TCTGGGAAAGGCTCAGTAGTA
Mucin-2 (MUC2) F CCCTGGAAGTAGAGGTGACTG 143 JX284122.1 53
R TGACAAGCCATTGAAGGACA
Occludin (OCLD) F ACGGCAGCACCTACCTCAA 123 NM_205128.1 57
R GGGCGAAGAAGCAGATGAG
Claudin-1 (CLDN1) F CTTCATCATTGCAGGTCTGTCAG 103 NM_001013611.2 55.5
R AAATCTGGTGTTAACGGGTGTG
Zonula occludens-1 (Zo-1) F TACCACAAGGAGCCATTCCA 198 XM_046925214.1 55
R CAGGGGTCATAGACGCACA
Zonula occludens-2 (Zo-2) F GCCCAGAAGCATCCAGACATT 220 XM_046934789.1 57
R GTGGCTGTCCGTAGTAACCT
Zonula occludens-3 (Zo-3) F GACTATGATGACACGGATGGT 190 XM_015299757.4 56
R GCTCGTAATTCCTGATGTGTTC
GAPDH F CTTTGGCATTGTGGAGGGTC 128 NM_204305.2 58-60
R ACGCTGGGATGATGTTCTGG
ß-actin F CACAATGTACCCTGGCATTG 158 L08165.1 54-56
R ACATCTGCTGGAAGGTGGAC
Open in a new tab

Microbiological Study

Bacterial Enumerations in Chicken Intestinal Samples

The bacterial population in chicken intestine samples was quantified using the serial dilution technique, following the standard method reported by Reynolds (2005) with few adjustments. Concisely, aseptically, 10 g of samples of intestinal material were combined with 90 mL of a solution of sodium chloride with a concentration of 0.1% (w/v). After 30 min of homogenization, the solution underwent decimal dilution (ranging from 10−1 to 10−7). Subsequently, 100 µL portions of the suitable dilutions were evenly distributed over the nutrient agar plates. Following a 5-d period of incubation at a temperature of 30°C, the number of colonies forming units (CFU) was determined and the CFU count per gram of sample was calculated.

Measurement of Total Microbial Activity of Intestinal Content

The total microbial enzyme activities of the intestinal content were evaluated by measuring the rate of fluorescein diacetate (FDA) hydrolytic activity. This was done using a modified version of the approach described by Patle et al. (2018).

Protease Activity

Protease activity in intestinal digesta was determined spectrophotometrically following Nasri et al., (2011) and Patil and Rebecca (2014) with some modifications. The digesta were diluted at a ratio of 1:5 (weight/volume) for 5 min using the extraction buffer (10 mM Tris-HCl, pH 8.0). The final preparations underwent a 30-min, 8,500-× g centrifugation at 4°C. After discarding the pellets, the supernatants were utilized as unrefined protease extracts. A total of 0.5 mL of partially purified enzyme was combined with an equal volume of casein. The reaction mixture was left to incubate at 37°C for 1 h, after which it was terminated by adding a 10% trichloroacetic acid (TCA) solution (1 mL). The combination underwent centrifugation, resulting in the collection of the supernatant. A volume of 0.5 milliliters of the supernatant was combined with Na2CO3, NaOH, and Folin Phenol. The solution was vigorously agitated, and the optical density was determined at a wavelength of 650 nm. The amount of enzyme activity is defined as the quantity of enzyme that produces 0.5 µg/mL/min of tyrosine.

Alpha Amylase Activity

α-amylase activity was measured in intestinal digesta after extraction and dilution as described in the previous section (protease activity). The determination was done following Routman et al. (2003). The procedures of measurement were applied as reported by Dhavale et al. (2018) with minor modifications. In summary, 50 μL of the enzyme solution was mixed with 450 μL of 0.5% (w/v) soluble starch in phosphate buffer (0.02 M, pH 7.0). The mixture was allowed to incubate for a duration of 20 min, following that, the enzymatic reaction was halted by introducing 500 μL of DNS reagent. The combination of DNS, enzyme, and starch was then boiled for 10 min in a water bath before being allowed to cool to room temperature. The absorbance was determined using spectrophotometry after suitable diluting with DW at 540 nanometers. Stander curves of increased concentrations of glucose were prepared and measured simultaneously with the samples. The quantity of enzyme that produced one micromole of glucose per minute at 37°C was considered as one unit of enzyme activity.

Histological Examination

During necropsy, liver and small intestine samples were collected from each experimental group, as outlined by Abdel-Fattah et al. (2024). Five samples were obtained from each group at the time of slaughter. A 10% formalin-saline solution was used to preserve samples before histological slice preparation. These slices were then stained with hematoxylin and eosin using the method described by Bancroft and Gamble (2008).

Furthermore, a histo-morphometric analysis of the small intestine was carried out according to Helal et al. (2021) using stereological image software (OTIKA PROVIEW v. x86),to determine the crypt depth and villi height, which utilized a micrometric ruler to have its scale calibrated to the micrometer unit (μm). The villus surface area was estimated according to Metzler-Zebeli et al. (2018).

Villus surface area=2π×(average villus width/2)×villus height.

To illustrate the findings more clearly, photography images of the chosen specimens were captured.

Statistical Analysis

The data obtained in this study were subjected to a single-way analysis of variance. To identify significant differences between treatment means at a 5% probability level, Duncan's multiple range test (Duncan, 1955) was applied. The SAS (1994) general linear model for PC was employed to delineate the primary differences between treatments.

RESULTS

Impact of Dietary Oregano and /or Rosemary Extracts on Productive Performance

Chickens administered with dietary 50 mg oregano extract exhibited a significant increase in body weight, surpassing the unsupplemented one by 10.2%. Following closely were the chickens in the R2O2 and O2 groups, respectively. Surprisingly, chickens fed dietary 100 mg rosemary extract (R2) displayed the lowest body weight compared to the other treatments. (Figure 2 A). Regarding body weight gain during the first three weeks of age, no significant changes were obtained among the groups. However, during the last 2 wk of the experimental period and considering the overall average over the 5 wk, the O1 group demonstrated the highest weight gain, showing a significant rise of 9.92% relative to the unsupplemented 1. Conversely, the R2 group exhibited the lowest body weight gain among all the experimental groups (Figure 2B). The O2, R2, O1, and R2O2 groups of chickens displayed the highest feed intake values, exhibiting increases of 3.33, 3.28, 3.03, and 2.65%, respectively, relative to the control group (Figure 3A). Regarding the feed conversion ratio (FCR) for birds challenged with heat stress, the supplementation of rosemary and oregano extracts had a significant effect. Chickens given dietary 50 mg oregano extract (O1 group) showed a significant reduction in overall FCR by 5.84% in comparison to unsupplemented ones. In contrast, chickens that received dietary 100 mg rosemary extract (R2 group) exhibited the poorest FCR among the experimental groups, with an increase of 9.74% in comparison to unsupplemented ones (Figure 3B).

Figure 2.

Figure 2

Open in a new tab

Effect of rosemary, oregano leaves extracts, and their combinations on (A) body weight (B) body weight gain of heat-stressed broilers. a,b,c,d Means with no common superscript differ significantly. R1: 50mg rosemary extract; R2: 100 mg rosemary extract; O1: 50mg oregano extract; O2: 100mg oregano extract; R1O1: 50 mg rosemary extract+50mg oregano extract; R2O2: 100 mg rosemary extract+100mg oregano extract.

Figure 3.

Figure 3

Open in a new tab

Effect of rosemary, oregano leaves extracts, and their combinations on (A) feed consumption and (B) feed conversion ratio of heat-stressed broilers. a,b,c Means with no common superscript differ significantly. R1: 50 mg rosemary extract; R2: 100 mg rosemary extract; O1: 50 mg oregano extract; O2: 100 mg oregano extract; R1O1: 50 mg rosemary extract+50 mg oregano extract; R2O2: 100mg rosemary extract+100mg oregano extract.

Impact of Dietary Oregano and/or Rosemary Extracts on Liver and Intestinal Histological Observations

Figure 4 shows the histological structure of liver sections when influenced by the addition of rosemary, oregano extracts, and their various combinations in the diet

Figure 4.

Figure 4

Open in a new tab

Light micrographs of broiler chicken's liver from different treatments at 35 DOA. BS: blood sinusoids; CV: central vein; FC: fatty cirrhosis; H: hepatocyte; N: necrotic area; R: hemorrhage. High magnification (H&E × 400). (Con: control; R1: 50 mg rosemary extract; R2: 100 mg rosemary extract; O1: 50 mg oregano extract; O2: 100 mg oregano extract; R1O1: 50 mg rosemary extract+50mg oregano extract; R2O2: 100mg rosemary extract+100mg rosemary extract).

A histological investigation of liver sections from several groups demonstrated that all broilers had the most parenchymal liver structure. The typical hepatic parenchyma of the chicken consists of hepatic lobules with distinct outlines. Each lobules possess a central vein, hepatic artery, bile ductuli, lymphatic vessels, and branch of vagus nerve. Hepatocytes are structured in lobules, which are comprised of polyhedral and angular-shaped cells. These hepatocytes are arranged in a radial pattern around a central vein and expand toward the outer edges of the lobules.

The liver sections from the control, R1, R2, O1, and R2O2 groups in this study exhibit fatty degeneration characterized by vacuolation (formation of fatty cirrhotic regions) together with sinusoidal dilation. In addition, a few necrotic regions were detected in some locations of the liver tissue, along with a few instances of liver hemorrhaging and congestion. However, lymphocytes were more evident in hepatic parenchyma for control, O1, and O2 treatments, as compared with the other treatments. Conversely, the R1O1 group demonstrated beneficial outcomes in liver tissues, characterized by reduced fatty cirrhotic regions, little hepatocyte necrosis, and decreased hepatic congestion. In addition, hepatocytes of regular size were observed. These findings coincide with group O2 except for their invasion by lymphocytes.

Figure 5 represents the microarchitecture of the jejunum from heat-stressed broilers in the various experimental groups. All sections of the jejunum displayed the normal layers, including the muscularis mucosa layer, submucosa, mucosa, Lieberkühn crypts, and villi. This description was described by Bacha and Bacha (2012). The histo-morphoic measurements of heat-stressed broilers’ jejunum as influenced by rosemary, and oregano extracts and their combinations are presented in Table 3. The data clearly show that significant variations (P ≤ 0.001) in the intestinal villi's height were detected within the experimental sets. The dietary 50 mg oregano extract group (O1) recorded the highest villi height as it increased by 23.6% above the unsupplemented one, which showed the lowest villi height. However, the average villi width was not significantly affected by dietary rosemary and oregano extracts.

Figure 5.

Figure 5

Open in a new tab

Cross section through jejunum from heat-stressed broilers affected by rosemary, oregano leaves extracts, and their combinations at 35 DOA (H&E, 40x), M: muscularis mucosa; Cr: crypts of Lieberkühn; V: Villi; L: lumen. (Con: control; R1: 50 mg rosemary extract; R2: 100 mg rosemary extract; O1: 50 mg oregano extract; O2: 100 mg oregano extract; R1O1: 50mg rosemary extract+50mg oregano extract; R2O2: 100 mg rosemary extract+100 mg rosemary extract).

Table 3.

Effect of rosemary, oregano leaves extracts, and their combinations on jejunum histo-morphoic measurements (mean ± SE) of heat-stressed broilers.

Item Experimental groups
 Significance
Control R1 R2 O1 O2 R1O1 R2O2
Villus height (μm) 740c±19.6 786bc±15.9 797bc±19.6 915a±33.7 810bc±28.0 831b±20.2 828b±24.9 1
Villus width (μm) 247±8.3 247±11.3 231±8.4 260±10.8 240±10.5 260±10.8 259±9.2 NS
Crypt depth (μm) 150c±6.5 172ab±5.7 144c±3.9 158bc±6.9 187a±9.4 162bc±5.3 154bc±4.8 1
Musculosa depth (μm) 242ab±11.9 252a±10.8 205cd±10.6 174de±6.2 230abc±9.5 166e±5.5 210bc±13.9 1
Villus: crypt ratio 5.08bc±0.196 4.69c±0.159 5.66ab±0.192 5.99a±0.319 4.51c±0.175 5.36ab±0.265 5.42ab±0.123 1
Villus surface area (mm2) 0.57c±0.020 0.61bc±0.027 0.58c±0.023 0.74a±0.037 0.61bc±0.034 0.69ab±0.039 0.67abc±0.027 1
Open in a new tab
a,b,c,d,e

Means within the same row with no common superscript differ significantly.

R1: 50 mg rosemary extract; R2: 100 mg rosemary extract; O1: 50 mg oregano extract; O2: 100 mg oregano extract; R1O1: 50 mg rosemary extract+50 mg oregano extract; R2O2: 100mg rosemary extract+100 mg oregano extract.

1

P ≤ 0.001, NS, non-significant.

Conversely, the depth of the muscularis layer was significantly reduced (P ≤ 0.001) in the O1 and R1O1 groups. Additionally, the ratio of villus height to crypt depth and the surface area of villi were significantly impacted by the two extracts in this study, with the O1 group showing the most favorable values for these measurements among the experimental groups. It is noteworthy that crypt depth was significantly influenced by rosemary and oregano leaves, with the fifth group (O2) recording a depth of 187 μm, 24.7% more than the control group.

Impact of Dietary Oregano and/or Rosemary Extracts on Blood Biochemical and Digestive Enzyme Activities

As shown in Table 4, chickens fed 50mg oregano extract and 100mg rosemary extract+100mg oregano extract had higher levels of total protein and globulins. Meanwhile, the level of plasma albumins was significantly increased in the R2O2 group compared to the other treatments. There were no statically differences among groups in plasma albumins/Globulin ratio.

Table 4.

Effect of rosemary, oregano leaves extracts, and their combinations on plasma proteins and A/G ratio (mean ± SE) of heat-stressed broilers.

Item Experimental groups
 Significance
Control R1 R2 O1 O2 R1O1 R2O2
Total proteins (g/dl) 2.68b±0.21 2.59b±0.23 2.66b±0.09 3.12a±0.08 2.81b±0.07 2.60b±0.13 3.13a±0.14 1
Albumins (g/dL) 0.88b±0.09 0.82b±0.07 0.82b±0.04 0.88b±0.04 0.84b±0.02 0.82b±0.12 0.98a±0.04 1
Globulins (g/dL) 1.81c±0.06 1.77c±0.07 1.84c±0.06 2.24a±0.08 1.98b±0.05 1.77c±0.08 2.15a±0.08 1
A/G ratio 0.49±0.05 0.46±0.05 0.44±0.01 0.40±0.03 0.42±0.01 0.47±0.02 0.46±0.02 NS
Open in a new tab

A/G ratio: albumins/ globulins ratio.

a,b,c

Means within the same row with no common superscript differ significantly.

R1: 50mg rosemary extract; R2: 100mg rosemary extract; O1: 50mg oregano extract; O2: 100mg oregano extract; R1O1: 50mg rosemary extract+50mg oregano extract; R2O2: 100mg rosemary extract+100mg oregano extract.

1

P ≤ 0.05, NS= non-significant

The plasma concentrations of IgG and IgM were reduced significantly in various treatments relative to the unsupplemented one. the most significant reductions were observed in the chickens administered combinations of rosemary and oregano extracts (R1O1 and R2O2) among the experimental groups (Figure 6, Figure 7).

Figure 6.

Figure 6

Open in a new tab

Effects of rosemary, and oregano leaves extracts, and their combinations on plasma IgG of heat-stressed broilers (R1: 50mg rosemary extract; R2: 100mg rosemary extract; O1: 50mg oregano extract; O2: 100mg oregano extract; R1O1: 50mg rosemary extract+50mg oregano extract; R2O2: 100mg rosemary extract+100mg) rosemary extract).

Figure 7.

Figure 7

Open in a new tab

Effects of rosemary, Oregano leaves extracts, and their combinations on plasma IgM of heat-stressed broilers (R1: 50mg rosemary extract; R2: 100mg rosemary extract; O1: 50mg oregano extract; O2: 100mg oregano extract; R1O1: 50mg rosemary extract+50mg oregano extract; R2O2: 100mg rosemary extract+100mg rosemary extract).

Digestive enzyme activities of jejunum were presented in figures (8 A and B). The highest recorded protease activity in the jejunum was recorded in the O1 and O2 groups without significant differences from other groups. Regarding amylase activity, the O2 group exhibited the highest activity, significantly differing from the other groups (Figure 8B).

Figure 8.

Figure 8

Open in a new tab

Effects of rosemary, and oregano leaves extracts, and their combinations on jejunum (A) protease activity, (B) amylase activity of heat-stressed broilers. C: control, R1: 50 mg rosemary extract, R2: 100 mg rosemary extract, O1: 50 mg oregano extract, O2: 100 mg oregano extract, R1O1: 50 mg rosemary extract + 50 mg oregano extract, R2O2: 100 mg rosemary extract + 100 mg oregano extract. Mean values with different superscript letters (a, b,c,d and e) were significantly different (P < 0.05).

Impact of Dietary Oregano and/ or Rosemary Extracts on mRNA Expression of Glucocorticoid Receptor and Genes Associated With Pro-oxidants

The expression of the glucocorticoid receptor (GR) was downregulated significantly (P ≤ 0.001) in all treatments (Figure 9), except for the treatment that administered a high dosage of oregano extract alone (O2, fifth group). The most substantial reductions were noted in the broiler groups receiving lower levels of the extracts investigated in the study (R1, O1, and R1O1 groups).

Figure 9.

Figure 9

Open in a new tab

Effect of rosemary, oregano leave extract, and their combinations on the expression pattern of glucocorticoid receptor and genes associated with pro-oxidants in liver of heat-stressed broilers. NOS2: Nitric oxide synthase 2, NOX4: NADPH oxidase 4, GR: glucocorticoid receptor. C: control, R1: 50 mg rosemary extract, R2: 100 mg rosemary extract, O1: 50 mg oregano extract, O2: 100 mg oregano extract, R1O1: 50 mg rosemary extract + 50 mg oregano extract, R2O2: 100 mg rosemary extract + 100 mg oregano extract. Mean values with different superscript letters (a, b and c) were significantly different (P < 0.05).

The hepatic expression of (NOS2) showed a significant reduction (P ≤ 0.001) in the fourth, sixth, and seventh groups when compared to the unsupplemented one. However, the chickens in the fifth group (100 mg oregano extract) were the only ones to exhibit higher levels of NOS2 mRNA when compared to the unsupplemented one, displaying an increase of 35.18% above the control. Similarly, the trend persisted in Figure 9, where hepatic expression of NADPH oxidase 4 (NOX4) mirrored the same pattern. The fifth group displayed the highest expression of NOX4 among all the groups, while the fourth group (O1, 50 mg oregano extract/kg) exhibited the most significant downregulation in NOX4 expression among the experimental groups.

Hepatic mRNA Expression of Antioxidant Enzymes in Response to Dietary Oregano and/ or Rosemary Extracts

In Figure 10, hepatic catalase expression in heat-stressed broilers was significantly impacted (P ≤ 0.001) by dietary rosemary and oregano extracts. The inclusion of low levels of both extracts (R1 & O1 groups) resulted in reduced catalase gene expression within the treatments. However, the treatment receiving the high-level combination (R2O2) exhibited the highest catalase expression, displaying an increase of 363% relative to the unsupplemented one. The expressions of SOD and SOD2 were significantly influenced (P ≤ 0.001) among the treatments. The second group (R1) showed the most significant downregulations of SOD and SOD2, followed by the fourth and fifth groups to a lesser extent. Moreover, the inclusion of 50 mg rosemary extract and 100 mg oregano extract in the diet significantly decreased (P≤0.001) glutathione peroxidase 4 (GSH-Px 4), with reductions of 55% and 51%, respectively, compared to the control group (Figure 10). It's worth mentioning that the control group exhibited the highest GSH-Px 4 expression among all the experimental groups.

Figure 10.

Figure 10

Open in a new tab

Effect of rosemary, oregano leave extract, and their combinations on the expression pattern of antioxidant genes in the liver of heat-stressed broilers. GSH-PX4: glutathione peroxidase 4, SOD: superoxide dismutase, SOD2: superoxide dismutase2. C: control, R1: 50 mg rosemary extract, R2: 100 mg rosemary extract, O1: 50 mg oregano extract, O2: 100 mg oregano extract, R1O1: 50 mg rosemary extract + 50 mg oregano extract, R2O2: 100 mg rosemary extract + 100 mg oregano extract. Mean values with different superscript letters (a, b, c, d, and f) were significantly different (P < 0.05).

Impact of Dietary Oregano and/ or Rosemary Extracts on the mRNA Expression of Genes Involved With Tight Junction-Related Proteins

As shown in Figure 11, the oregano treatment groups had much higher levels of mRNA expression for OCLD, Claudin 1 (CLDN1), Zonula occludens 1 (ZO1), and Zonula occludens 2 (ZO2), peaking at the O1, R1O1, and R2O2. In contrast, there were no significant changes observed in the mRNA expression of Zonula occludens 3 (ZO3) across the treatment groups. Additionally, the birds given a diet incorporating 50 mg/kg of oregano exhibited significantly higher levels of MUC2 mRNA expression compared to the other treatments.

Figure 11.

Figure 11

Open in a new tab

Effect of rosemary, oregano leave extract, and their combinations on the expression pattern of tight junction-related genes in the jejunum of heat-stressed broilers. The relative expression of MUC2 (A), OCLD (B), CLDN1 (C), ZO-1 (D), ZO-2 (E) and ZO-3 was determined in the jejunum tissue using real-time quantitative PCR. MUC2: mucin-2, OCLD: occludin, CLDN1: claudin-1, ZO-1/2/3: zonula occludens-1/2/3. C: control, R1: 50 mg rosemary extract, R2: 100 mg rosemary extract, O1: 50 mg oregano extract, O2: 100 mg oregano extract, R1O1: 50 mg rosemary extract + 50 mg oregano extract, R2O2: 100 mg rosemary extract + 100 mg oregano extract. Mean values with different superscript letters (a, b and c) were significantly different (P < 0.05).

Impact of Oregano and/or Rosemary Extracts on Microbiological Count

The effect of dietary oregano and/or rosemary on microbiological count in broiler groups is shown in Figure 12. The groups fed R1 and O1 had significantly increased total microbial activity in the cecum (Figure 12). The total bacterial count (TBC) values increased in the cecum of the R2 group compared to the R1, O2, R1O1, and R2O2 groups (Figure 13).

Figure 12.

Figure 12

Open in a new tab

Effects of rosemary, and oregano leaves extracts, and their combinations on cecum total microbial activity of heat-stressed broilers. C: control, R1: 50 mg rosemary extract, R2: 100 mg rosemary extract, O1: 50 mg oregano extract, O2: 100 mg oregano extract, R1O1: 50 mg rosemary extract + 50 mg oregano extract, R2O2: 100 mg rosemary extract + 100 mg oregano extract. Mean values with different superscript letters (a and b) were significantly different (P < 0.05).

Figure 13.

Figure 13

Open in a new tab

Effects of rosemary, and oregano leaves extracts, and their combinations cecum total bacterial count activity of heat-stressed broilers. C: control, R1: 50 mg rosemary extract, R2: 100 mg rosemary extract, O1: 50 mg oregano extract, O2: 100 mg oregano extract, R1O1: 50 mg rosemary extract + 50 mg oregano extract, R2O2: 100 mg rosemary extract + 100 mg oregano extract. Mean values with different superscript letters (a, b and c) were significantly different (P < 0.05).

DISCUSSION

Many scientists have supported that poultry exposure to HS leads to high economic loss, mostly in the form of higher mortality rates and poor productivity (Wasti et al., 2020). The primary causes of the decrease in performance during the HS phase are the following: reduced food consumption is induced by peripheral heat receptors, which transmit nerve signals that inhibit appetite center activities in the hypothalamus (Marai et al., 2007); additionally, an imbalance in the digestive system's microbial community, which lowers nutrient utilization. Moreover, exposure to oxidative stress is made more likely by heat stress. Prior research has demonstrated that using some dietary supplements can help mitigate the detrimental impacts of HS (Abdel-Moneim et al., 2022; Elbaz et al., 2022). Phytogenic additive have been found to have a significant impact as antioxidative activity (Ruan et al., 2021), and improve productive performance in farm animals (Khattak et al., 2014). In the present investigation, broilers that were given 50 mg of oregano extract performed more productively. The O1 group had more feed consumption (7.15%), body weight (9.71%), and improved FCR (-5.84%) than the control group. The improvement in productive performance in 50 mg oregano-supplemented birds may be due to the containing 1.69% carvacrol and 37.2% thymol which had a beneficial influence on BW and FI (Madkour et al.,2024). This aligns with Mathlouthi et al. (2012), whose study demonstrated that feeding Arbor Acres broiler chickens 100 mg/kg of oregano oil, rich in carvacrol and thymol at levels of 69.55% and 4.09% respectively, improved body weight, weight gain, and feed conversion ratio. Our data revealed that dietary oregano extract (5 and 100 mg/kg) led to a substantial enhancement in the protease and amylase activity of broiler chickens subjected to HS.

The improvement in these enzymes reflected the improvement in nutritional digestibility caused by OEOs and suggested the reason for an increase in body weight as shown in this study. Our current findings correspond to the findings of Jang et al., 2007; Boyen et al., 2008; Zhang et al., 2021 who reported that adding OEO as a dietary supplement enhanced the digestibility of all nutrients and thus all digestive enzymes, ultimately leading to better broiler growth performance. Slaughter et al. (2001) state that elevated amylase levels in the gastrointestinal tract suggest that starch's enzymatic hydrolysis may be the main obstacle factor in the digestion of carbohydrates, primarily because of aspects that involve its chemical and physical properties.

However, Osman and Tanios (1983) found that HS consistently raises the activity of the enzyme amylase in broilers. This could lead to a notable increase in the breakdown of starch and, consequently, an increase in glucose available for internal oxidation and subsequent production of metabolic heat. In line with our findings, Attia et al. (2019) found that dietary EO improved the growth indices of chickens reared in the summer.

The relationship between the elongation of villi and the reduction in crypt length has been proven to enhance the process of nutritional absorption (Wani et al.,2022). The impairment of intestinal integrity caused by HS is a significant determinant of broiler performance, leading to decreased feed consumption and compromised digestive and absorption abilities (Khonyoung and Yamauchi, 2019). This study examined the impact of HS (31.9°C) on the intestinal morphology of broiler chickens. It was shown that HS caused the villi's surface area, crypt depth, and height to decrease. Furthermore, supplementing the basal diet with 50 mg of oregano extract led to enhancements in villus morphology, including increased villi height, reduced crypt depth in the jejunum, and a higher ratio of villi height to crypt depth. The results of the current study align with those reported by Zhang et al. (2021), demonstrating a statistically significant rise in the ratio of villus height to crypt depth in the ileum of broilers. Additionally, the inclusion of 600 mg/kg OEO in the control diet led to an increase in villus height in laying hens (Gul et al. 2019). According to Behnamifar et al. (2018), The application of oregano extract led to an enhancement in the villus height (VH) in the ileum of quails. This indicates that oregano extract may serve as a beneficial and safe supplement for poultry. An enhanced VH and VH/CD ratio in the jejunum can expand the surface area accessible for absorption, enhancing efficiency in digestion as well as absorption (Mohammadi et al., 2014). Furthermore, Windisch et al. (2008) proposed that the enhancement of intestinal morphology caused by herbal essential oils is a result of their antioxidant properties.

Chickens that were exposed to HS showed a significant elevation in IgG and IgM levels in their blood plasma. Previous studies have demonstrated that conditions that cause stress, like high temperatures and exposure to ammonia, can raise immunoglobulin G (IgG) levels (Nasrin et al., 2013; Honda et al., 2015; Wu et al., 2017). These findings align with the outcomes reported in the present investigation.

Immunoglobulin G (IgG) is present throughout the later stages of infection and is distinguished by its extended duration within the body, hence protecting against rapid reinfection (Ewert et al., 1979). In this investigation, the concentrations of IgG and IgM in the plasma were gradually lowered by adding oregano and/or rosemary extract. According to Zhang et al. (2017), the presence of HS resulted in an elevated prevalence of pathogens, including Clostridium sp., Salmonella sp., and Escherichia coli, within the gastrointestinal tract of chickens. Several studies indicate that the concentrations of IgA, IgG, and IgM increase following viral infection due to the activation of a specific immune response (Selhorst et al., 2021; Ruytinx et al., 2023; Kusakabe et al., 2023). Carvacrol and thymol, which have molecular structures like volatile fatty acids, are the main ingredients in oregano essential oil. According to (Yoshihara et al., 2015; Capozzi et al., 2016), volatile fatty acids can effectively reduce inflammation, maintain intestinal mucosal morphology and promote intestinal mucosal proliferation, and prevent neutrophil myeloperoxidase activity and lymphocyte activation. Additionally, 1,8-Cineole (15.22%) and Ferruginol (26.39%) are the primary constituents of rosemary extract, known for their crucial role in antimicrobial activity against bacteria (Madkour et al.,2024). A recent study by Chodkowska et al. (2022) revealed the effectiveness of 1,8-Cineole against various strains of E. coli isolated from broiler chickens. It has been determined that the incorporation of these essential oils possesses a strong capacity to protect the digestive system against bacterial invasion under heat stress. Thus, based on the histopathology data, we postulated that the reduced immunoglobulin levels in the treatment groups could be attributed to the potential of the extracted components from oregano and/or rosemary to suppress the inflammatory response.

Oxidant status in animals can be evaluated by studying the expression of genes for oxidant and antioxidant enzymes. Transmembrane enzymes called NADPH oxidases (NOXs) transport an electron from NADPH to molecular oxygen, producing the reactive oxygen species superoxide anion (O2-) Quinn MT (2013). There may be a significant role for NOX-derived ROS in mediating the internal biological alterations observed in hens exposed to HS. The NOX family includes seven unique members: NOX1, NOX2 (also known as CYBB), NOX3, NOX4, NOX5, and the Dual Oxidase enzymes DUOX1 and DUOX2 (Jiang and Török, 2014). The current study found that dietary 50 mg oregano extract reduced the expression of the genes encoding NOX enzymes. In avian muscle cells cultivated at 41°C, Kikusato et al., 2015 demonstrated increased expression of the NOX4 gene, followed by decreased expression after supplementation with a superoxide scavenger (4-hydroxy-TEMPO). Therefore, Oregano extracted may have played a crucial role as scavengers of reactive oxygen species. As an enzyme, (NOS2) is a member of the NOS family. It is a contributor to the inflammatory responses that ensue after tissue injury, infection, or illness. NOS produces nitric oxide, which combines with superoxide anion (O2−.) to produce the potent oxidant peroxynitrite (Förstermann and Sessa, 2012). This compound has the potential to induce oxidative damage (Lee et al., 2003). The findings of this research demonstrate that the gene that encodes the NOS2 enzyme was downregulated in the fourth group (50 mg oregano) under HS. Islet cell death occurs in pancreatic cells during diabetes. Nevertheless, NOS inhibitors can safeguard islet cells from IL-1 b-induced harm and avert the decline in insulin production (Messmer et al., 1994). Evidence suggests that the radical scavenging capacity of oregano essential oil is likely owing to the synergistic action of its main ingredients (Gavaric et al., 2015). This may explain the down-regulation of NOS2 in the broiler fed with 50 mg oregano extract under HS.

Oxidative stress arises from exposure to elevated temperatures. The three main antioxidant systems that are affected by oxidative stress are glutathione peroxidase (GPX), catalase (CAT), and superoxide dismutase (SOD). SOD transforms superoxide, a free radical, into hydrogen peroxide (H2O2), a non-radical (Velayutham, 2013). Genes encoding the CAT enzyme can transform this H2O2 into water (H2O) (Al-Abrash et al., 2000). The highly detrimental and reactive hydroxyl radical (OH-) can be produced from H2O2 in the presence of ferrous and cuprous ions (Halliwell, 2001). By using glutathione peroxidase (GPx) and glutathione (GSH), an oxyl radical might be transformed into H2O (Ng et al., 2007). The GPX enzymes then convert GSH to glutathione disulfide (GSSG). Glutathione reductase (GR) may regenerate GSH from GSSG in the presence of its cofactor, NADPH+H+, enabling multiple uses of the same molecule for the removal of ROS. It has been documented that those broilers subjected to heat stress for six hours at 36°C exhibit increased SOD gene mRNA expression (Kikusato et al., 2015). Increased SOD expression during the early exposure phase points to its protective function via O2− reduction mediated by hydrogen peroxide. In a similar vein, heat stress leads to an upregulation of hepatic CAT expression (Roushdy et al., 2018). Along with SOD, CAT is a component of the system of antioxidants that helps to control the overabundance of ROS that are produced in response to heat stress. Plant-based products are recognized to have potent antioxidant properties and secondary metabolic compounds (Crozier et al., 2009). In chickens exposed to heat, incorporating plant-derived essential oils boosted the expression of the SOD gene (Akbarian et al., 2015). In the current investigation, mRNA expression of antioxidants was downregulated in all treatments in comparison to the control. This can be explained by the fact that chicks treated with extracted plants have higher antioxidant capacities, which regulate SOD, CAT, and GSH-Px.

The biochemical changes observed in the plasma of broiler chickens can be attributed to the physiological effects of feed additives, serving as indicators of the birds' overall health condition. The current investigation demonstrated that the administration of 50mg of oregano extract as a dietary supplement significantly increased total protein levels in plasma when compared to the unsupplemented group. Alagawany et al. (2021) reported comparable results, adding that including lemongrass essential oils in the diet increased total protein levels. Elbaz et al. (2022) obtained comparable results.

The increase in feed efficiency and BWG in the O1 group may become clear by studying the changes in the tight junction proteins in the intestine. Tight junction proteins are essential for maintaining the integrity of the gut barrier, regulating the passage of ions and solutes while blocking harmful microorganisms, antigens, and toxins (Groschwitz and Hogan, 2009). The findings of this study suggest that broilers supplemented with 50mg oregano exhibited upregulation in the expression of tight junction genes such as claudin 1, occludin, and zonula occludens 1,2, thereby enhancing barrier function. the upregulation of tight junctions in the intestinal was also shown in Eimeria challenged broilers (Zhang et al., 2023), fish (Xin et al., 2022) fed with oregano oil.

CONCLUSIONS

The data indicate that oregano extract, functioning as an antioxidant, aims to mitigate the effects of free radicals induced by heat stress by downregulating oxidant enzymes such as hepatic NOX4 and NOS2. Furthermore, it improves gut health by enhancing jejunal protease and amylase activities, as well as promoting villus morphology, characterized by increased villi height and decreased crypt depth in the jejunum, along with a higher ratio of villi height to crypt depth. Additionally, it improves the functionality of proteins responsible for tight junctions in intestinal cells. This combined effect may assist birds in maintaining an efficient process of nutrient digestion and absorption during periods of heat stress.

DISCLOSURES

The authors declare no conflicts of interest

Acknowledgments

This article relies on research funded by the National Research Centre, Egypt (Grant #13050403).

Contributor Information

Mahmoud Madkour, Email: mahmoud.madkour9@gmail.com.

Ahmed A. Elolimy, Email: elolimy@uaeu.ac.ae.

REFERENCES

  1. Abdel-Fattah S.A., Madkour M., Hemida M.A., Shourrap M. Growth performance, histological and physiological responses of heat-stressed broilers in response to short periods of incubation during egg storage and thermal conditioning. Sci. Rep. 2024;14:94. doi: 10.1038/s41598-023-50295-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Abd El-Hack M.E., Abdelnour S.A., Taha A.E., Khafaga A.F., Arif M., Ayasan T., Swelum A.A., Abukhalil M.H., Alkahtani S., Aleya L., Abdel-Daim M.M. Herbs as thermoregulatory agents in poultry: an overview. Sci. Total. Env. 2020;703 doi: 10.1016/j.scitotenv.2019.134399. [DOI] [PubMed] [Google Scholar]
  3. Abdel-Moneim A.E., Shehata A.M., Mohamed N.G., Elbaz A.M., Ibrahim N.S. Synergistic effect of Spirulina platensis and selenium nanoparticles on growth performance, serum metabolites, immune responses, and antioxidant capacity of heat-stressed broiler chickens. Biol. Trace Elem. Res. 2022;200:768–779. doi: 10.1007/s12011-021-02662-w. [DOI] [PubMed] [Google Scholar]
  4. Akbarian A., Golian A., Kermanshahi H., De Smet S., Michiels J. Antioxidant enzyme activities, plasma hormone levels and serum metabolites of finishing broiler chickens reared under high ambient temperature and fed lemon and orange peel extracts and Curcuma xanthorrhiza essential oil. J. Anim. Physiol. Anim. Nur. 2015;99:150–162. doi: 10.1111/jpn.12188. [DOI] [PubMed] [Google Scholar]
  5. Al-Abrash A.A., Al-Quobaili F.A., Al-Akhras G.N. Catalase evaluation in different human diseases associated with oxidative stress. Saudi Med J. 2000;21:826–830. [PubMed] [Google Scholar]
  6. Alagawany M., Farag M., Abd El-Hack M.E., Patra A. Heat stress: effects on productive and reproductive performance of quail. World's Poult. Sci. J. 2017;73:747–756. [Google Scholar]
  7. Alagawany M., El-Saadony M.T., Elnesr S.S., Farahat M., Attia G., Madkour M., Reda F.M. Use of lemongrass essential oil as a feed additive in quail's nutrition: its effect on growth, carcass, blood biochemistry, antioxidant and immunological indices, digestive enzymes and intestinal microbiota. Poult. Sci. 2021;100 doi: 10.1016/j.psj.2021.101172. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Alagawany M., Elnesr S.S., Farag M.R., El-Naggar K., Madkour M. Nutrigenomics and nutrigenetics in poultry nutrition: an updated review. World's Poult. Sci. J. 2022;78:377–396. [Google Scholar]
  9. Alagawany M., El-Saadony M.T., El-Rayes T.K., Madkour M., Loschi A.R., Di Cerbo A., Reda F.M. Evaluation of dried tomato pomace as a non-conventional feed: Its effect on growth, nutrients digestibility, digestive enzyme, blood chemistry and intestinal microbiota of growing quails. Food Energy Security. 2022;11:e373. [Google Scholar]
  10. Attia Y., Al-Harthi M., El-Kelawy M. Utilisation of essential oils as a natural growth promoter for broiler chickens. Ital. J. Anim. Sci. 2019;18:1005–1012. [Google Scholar]
  11. Bancroft J.D., Gamble M. Churchill Livingstone, Elsevier; China: 2008. Theory and Practice of Histological Techniques. 6th Edition. [Google Scholar]
  12. Behnamifar A., Rahimi S., Torshizi M.A.K., Zade Z.M. Effect of chamomile, wild mint and oregano herbal extracts on quality and quantity of eggs, hatchability, and some other parameters in laying Japanese quails. J. Appl. Res. Med. Aro. Ma. 2018;7:173–180. 2018. [Google Scholar]
  13. Bianchi E., Cohen R.L., Dai A., Thor A.T., Shuman M.A., Smith H.S. Immunohistochemical localization of the plasminogen activator inhibitor-1 in breast cancer. Int. J. Cancer. 1995;60:597–603. doi: 10.1002/ijc.2910600505. [DOI] [PubMed] [Google Scholar]
  14. Botsoglou N.A., Christaki E., Florou-Paneri P., Giannenas I., Papageorgiou G., Spais A.B. The effect of a mixture of herbal essential oils or α-tocopheryl acetate on performance parameters and oxidation of body lipid in broilers. South African J Ani.Sci. 2004;34:52–61. [Google Scholar]
  15. Boyen F., Haesebrouck F., Vanparys A., Volf J., Mahu M., Van I.F., Rychlik I., Dewulf J., Ducatelle R., Pasmans F. Coated fatty acids alter virulence properties of Salmonella Typhimurium and decrease intestinal colonization of pigs. Vet Microbiol. 2008;132:319–327. doi: 10.1016/j.vetmic.2008.05.008. [DOI] [PubMed] [Google Scholar]
  16. Capozzi M.E., Hammer S.S., Mccollum G.W., Penn J.S. Epoxygenated fatty acids inhibit retinal vascular inflammation. Sci. Rep. 2016;6:39211. doi: 10.1038/srep39211. 2016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Chodkowska K.A., Iwinski H., Wodz K., Nowak T., Rozanski H. In Vitro Assessment of Antimicrobial Activity of Phytobiotics Composition towards of Avian Pathogenic Escherichia coli (APEC) and Other E. coli Strains Isolated from Broiler Chickens. Antibiotics. 2022;11:1818. doi: 10.3390/antibiotics11121818. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Crozier A., Jaganath I.B., Clifford M.N. Dietary phenolics: chemistry, bioavailability and effects on health. Nat. Prod. Rep. 2009;26:1001–1043. doi: 10.1039/b802662a. [DOI] [PubMed] [Google Scholar]
  19. Cuppett S.L., Hall C.A., 3rd Antioxidant activity of the Labiatae. Adv. Food Nutr. Res. 1998;42:245–271. doi: 10.1016/s1043-4526(08)60097-2. [DOI] [PubMed] [Google Scholar]
  20. Dhavale R.P., Parit S.B., Sahoo S.C., Kollu P., Patil P.S., Patil P.B., Chougale A.D. α-amylase immobilized on magnetic nanoparticles: reusable robust nano-biocatalyst for starch hydrolysis. Mater. Res. Express, 2018;5 [Google Scholar]
  21. Dumas B.T., Watson W.A., Biggs H.G. Albumin standards and the measurement of serum albumin with bromcresol green. Clinica chimica acta; international journal of clinical chemistry. 1997;258:21–30. doi: 10.1016/s0009-8981(96)06447-9. [DOI] [PubMed] [Google Scholar]
  22. Duncan D.B. Multiple range and multiple F tests. Biometrics. 1955;11:1–41. [Google Scholar]
  23. Elbaz A.M., Ashmawy E.S., Salama A.A., Abdel-Moneim A.E., Badri F.B., Thabet H.A. Effects of garlic and lemon essential oils on performance, digestibility, plasma metabolite, and intestinal health in broilers under environmental heat stress. BMC veterinary research. 2022;18:430. doi: 10.1186/s12917-022-03530-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. El-Wardany I., Shourrap M.I., Madkour M., Abd El-Azeem N.A. Effect of Age at mating and silver nanoparticles administration on progeny productive performance and some blood constituents in Japanese quail. Int. J. Chem Tech Res. 2016;9:21–34. [Google Scholar]
  25. Ewert D.L., Barger B.O., Eidson C.S. Local antibody response in chickens: analysis of antibody synthesis to Newcastle disease virus by solid-phase radioimmunoassay and immunofluorescence with class-specific antibody for chicken immunoglobulins. Infect. Immun. 1979;24:269–275. doi: 10.1128/iai.24.1.269-275.1979. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Förstermann U., Sessa W.C. Nitric oxide synthases: regulation and function. Eur. Heart. J. 2012;33:829–837. doi: 10.1093/eurheartj/ehr304. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Gavaric N., Mozina S.S., Kladar N., Bozin B. Chemical profile, antioxidant and antibacterial activity of thyme and oregano essential oils, thymol and carvacrol and their possible synergism. J. Essent. Oil Bear. Plants. 2015;18:1013–1021. [Google Scholar]
  28. Groschwitz K.R., Hogan S.P. Intestinal barrier function: molecular regulation and disease pathogenesis. J. Allergy Clin. Immunol. 2009;124:3–22. doi: 10.1016/j.jaci.2009.05.038. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Gul M., Yilmaz E., Yildirim B.A., Sezmis G., Kaya A., Timurkaan S., Onel S.E., Tekce E. Effects of oregano essential oil (Origanum syriacum L.) on performance, egg quality, intestinal morphology and oxidative stress in laying hens. Eur. Poultry. Sci. 2019;83 doi: 10.1399/eps.2019.290. [DOI] [Google Scholar]
  30. Halliwell, B. 2001. Free radicals and other reactive species in disease. Pages 1–7 in Nature Encyclopedia of Life Sciences. Nature Publishing Group, London.
  31. Hashem N.M., Abdelnaby E.A., Madkour M., El-Sherbiny H.R. Melatonin administration during the first half of pregnancy improves physiological response and reproductive performance of rabbits under heat stress conditions. Reprod. Fertility Devel. 2024;36 doi: 10.1071/RD23139. [DOI] [PubMed] [Google Scholar]
  32. Helal F., El-Badawi A., El-Naggar S., Shourrap M., Aboelazab O., Abu Hafsa S. Probiotics role of Saccharomyces cerevisiae and Bacillus subtilis in improving the health status of rabbits’ gastrointestinal tract. Bull Natl. Res. Cent. 2021;45:66. [Google Scholar]
  33. Hemida M.A., Abdel-Fattah S.A., Madkour M., Aboelenin M.M., Ahmed S.Y.A., Shourrap M. Hepatic heat shock proteins, antioxidant-related genes, and immunocompetence of heat-stressed broilers in response to short periods of incubation during egg storage and thermal conditioning. J. Therm. Biol. 2023;116 doi: 10.1016/j.jtherbio.2023.103640. [DOI] [PubMed] [Google Scholar]
  34. Henry R.J. Clinical Chemistry. 2nd Eds. Harper and Row; 1974. inetic determination of serum creatinine; p. 525. (principles and technics). [Google Scholar]
  35. Hernandez F., Madrid J., Garcia V., Orengo J., Megias M.D. Influence of two plant extracts on broilers performance, digestibility, and digestive organ size. Poult. Sci. 2004;83:169–174. doi: 10.1093/ps/83.2.169. [DOI] [PubMed] [Google Scholar]
  36. Honda B.T.B., Calefi A.S., Costola-de-Souza C., Quinteiro W.M., Fonseca J.G.D., de Paula V.F., Palermo-Neto J. Effects of heat stress on peripheral T and B lymphocyte profiles and IgG and IgM serum levels in broiler chickens vaccinated for Newcastle disease virus. Poult. Sci. 2015;94:2375–2381. doi: 10.3382/ps/pev192. [DOI] [PubMed] [Google Scholar]
  37. Jamroz D., Wertelecki T., Houszka M., Kamel C. Influence of diet type on the inclusion of plant origin active substances on morphological and histochemical characteristics of the stomach and jejunum walls in chicken. J. Anim. Physiol. Anim. Nutr. 2006;90:255–268. doi: 10.1111/j.1439-0396.2005.00603.x. [DOI] [PubMed] [Google Scholar]
  38. Jang I.S., Ko Y.H., Kang S.Y., Lee C.Y. Effect of a commercial essential oil on growth performance, digestive enzyme activity and intestinal microflora population in broiler chickens. Anim. Feed. Sci. Techno. 2007;134:304–315. [Google Scholar]
  39. Jiang J.X., Török N.J. NADPH oxidases in chronic liver diseases. Adv Hepatol. 2014;2014 doi: 10.1155/2014/742931. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Khattak F., Ronchi A., Castelli P., Sparks N. Effects of natural blend of essential oil on growth performance, blood biochemistry, cecal morphology, and carcass quality of broiler chickens. Poult. Sci. 2014;93:132–137. doi: 10.3382/ps.2013-03387. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Khonyoung D., Yamauchi K.E. Improved growth performance due to hypertrophied intestinal absorptive epithelial cells by heat killed Lactobacillus sakei HS-1 in broiler chickens. J. Anim. Sci. 2019;97:2066–2075. doi: 10.1093/jas/skz075. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Kikusato M., Yoshida H., Furukawa K., Toyomizu M. Effect of heat stress-induced production of mitochondrial reactive oxygen species on NADPH oxidase and heme oxygenase-1 mRNA levels in avian muscle cells. J. Therm. Biol. 2015;52:8–13. doi: 10.1016/j.jtherbio.2015.04.005. [DOI] [PubMed] [Google Scholar]
  43. Kulisic T., Radonic A., Katalinic V., Milos M. Use of different methods for testing antioxidative activity of oregano essential oil. Food Chem. 2004;85:633–640. [Google Scholar]
  44. Lambert R.J.W., Skandamis P.N., Coote P.J., Nychas G.I.E. A study of the minimum inhibitory concentration and mode of action of oregano essential oil, thymol and carvacrol. J. Appl. Microbiol. 2001;91:453–462. doi: 10.1046/j.1365-2672.2001.01428.x. [DOI] [PubMed] [Google Scholar]
  45. Lee J.H., Yang E.S., Park J.W. Inactivation of NADP+-dependent isocitrate dehydrogenase by peroxynitrite. Implications for cytotoxicity and alcohol-induced liver injury. J. Biol. Chem. 2003;278:51360–51371. doi: 10.1074/jbc.M302332200. [DOI] [PubMed] [Google Scholar]
  46. Madkour M., Aboelenin M.M., Younis E., Mohamed M.A., Hassan H., Alagawany M., Shourrap M. Hepatic acute-phase response, antioxidant biomarkers and DNA fragmentation of two rabbit breeds subjected to acute heat stress. Ital. J. Anim. Sci. 2020;19:1568–1576. [Google Scholar]
  47. Madkour M., Aboelenin M.M., Shakweer W.M., Alfarraj S., Alharbi S.A., Abdel-Fattah S.A., Alagawany M. Early life thermal stress modulates hepatic expression of thermotolerance related genes and physiological responses in two rabbit breeds. Ital. J. Anim. Sci. 2021;20:736–748. [Google Scholar]
  48. Madkour M., Salman F.M., El-Wardany I., Abdel-Fattah S.A., Alagawany M., Hashem N.M., Abdelnour S.A., El-Kholy M.S., Dhama K. Mitigating the detrimental effects of heat stress in poultry through thermal conditioning and nutritional manipulation. J. Thermal Biol. 2022;103 doi: 10.1016/j.jtherbio.2021.103169. [DOI] [PubMed] [Google Scholar]
  49. Madkour M., Alaqaly A.M., Soliman S.S., Ali S.I., Aboelazab O. Growth performance, blood biochemistry, and mRNA expression of hepatic heat shock proteins of heat-stressed broilers in response to rosemary and oregano extracts. J. Therm. Biol. 2024;119 doi: 10.1016/j.jtherbio.2024.103791. [DOI] [PubMed] [Google Scholar]
  50. Marai I.F.M., El-Darawany A.A., Fadiel A., Abdel-Hafez M.A.M. Physiological traits as affected by heat stress in sheep—a review. Small Rumin. Res. 2007;71:1–12. [Google Scholar]
  51. Marai I.F.M., Ayytat M.S., Abd el-Monem U.M. Growth performance and reproductive trans at first parity of New Zealand White female rabbits as affected by heat stress and its alleviation under Egyptian conditions. Trop. Anim. Health. and Prod. 2001;33:451–462. doi: 10.1023/a:1012772311177. [DOI] [PubMed] [Google Scholar]
  52. Martinez-Tome M., Jimenez A.M., Ruggieri S., Frega N., Strabbioli R., Murcia M.A. Antioxidant properties of mediterranean spices compared with common food additives. J. Food. Protect. 2001;64:1412–1419. doi: 10.4315/0362-028x-64.9.1412. [DOI] [PubMed] [Google Scholar]
  53. Mathlouthi N., Bouzaienne T., Oueslati I., Recoquillay F., Hamdi M., Urdaci M., Bergaoui R. Use of rosemary, oregano, and a commercial blend of essential oils in broiler chickens: in vitro antimicrobial activities and effects on growth performance. J. Anim. Sci. 2012;90:813–823. doi: 10.2527/jas.2010-3646. [DOI] [PubMed] [Google Scholar]
  54. Messmer U.K., Brune B. Modulation of inducible nitric oxide synthase in RINm5F cells. Cell Signal. 1994;6:17–24. doi: 10.1016/0898-6568(94)90057-4. [DOI] [PubMed] [Google Scholar]
  55. Metzler-Zebeli B.U., Magowan E., Hollmann M., Ball M.E.E., Molnar A., Witter K., Ertl R., Hawken R.J., Lawlor P.G., O'Connell N.E., Aschenbach J., Zebeli Q. Differences in intestinal size, structure, and function contributing to feed efficiency in broiler chickens reared at geographically distant locations. Poult. Sci. 2018;97:578–591. doi: 10.3382/ps/pex332. [DOI] [PubMed] [Google Scholar]
  56. Mohammadi Z., Ghazanfari S., Moradi M.A. Effect of supplementing clove essential oil to the diet on microflora population, intestinal morphology, blood parameters and performance of broilers. Eur. Poultry. Sci. 2014;78:51–59. [Google Scholar]
  57. Nasri R., Younes I., Lassoued I., Ghorbel S., Ghorbel-Bellaaj O., Nasri M. Digestive alkaline proteases from Zosterisessor ophiocephalus, Raja clavata, and Scorpaena scrofa: characteristics and application in chitin extraction. Journal of amino acids. 2011;913616:9. doi: 10.4061/2011/913616. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Nasrin M., Khan M.Z.I., Siddiqi M.N.H., Masum M.A. Mobilization of immunoglobulin (Ig)-containing plasma cells in Harderian gland, cecal tonsil and trachea of broilers vaccinated with Newcastle Disease Vaccine. Tissue and Cell. 2013;45:191–197. doi: 10.1016/j.tice.2012.12.001. [DOI] [PubMed] [Google Scholar]
  59. National Research Council (NRC) The National Academies Press; Washington, DC: 1994. Nutrient Requirements of Poultry: Ninth Revised Edition. [Google Scholar]
  60. Ng C.F., Schafer F.Q., Buettner G.R., Rodgers V.G. The rate of cellular hydrogen peroxide removal shows dependency on GSH: mathematical insight into in vivo H2O2 and GPx concentrations. Free Radic Res. 2007;41:1201–1211. doi: 10.1080/10715760701625075. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Osman A.M., Tanios N.I. The effect of heat on the intestinal and pancreatic levels of amylase and maltase of laying hens and broilers. Comp. Biochem. Physiol. 1983;75A:563–567. doi: 10.1016/0300-9629(83)90421-8. [DOI] [PubMed] [Google Scholar]
  62. Patil S.S., Rebecca L.J. Isolation and characterization of protease from marine algae. Int. J. Pharm. Sci. Rev. Res. 2014;27:188–190. [Google Scholar]
  63. Patle P.N., Navnage N.P., Barange P.K. Fluorescein diacetate (FDA): measure of total microbial activity and as indicator of soil quality. Int. J. Curr. Microbiol. Appl. Sci. 2018;7:2103–2107. [Google Scholar]
  64. Reynolds J. American Society for Microbiology; Washington, DC: 2005. Serial Dilution Protocols; pp. 1–7. [Google Scholar]
  65. Roushdy E.M., Zaglool A.W., El-Tarabany M.S. Effects of chronic thermal stress on growth performance, carcass traits, antioxidant indices and the expression of HSP70, growth hormone and superoxide dismutase genes in two broiler strains. J. Therm. Biol. 2018;74:337–343. doi: 10.1016/j.jtherbio.2018.04.009. [DOI] [PubMed] [Google Scholar]
  66. Routman K.S., Yoshida L., Frizzas de Lima A.C., Macari M., Pizauro J.M., Jr Intestinal and pancreas enzyme activity of broilers exposed to thermal stress. Braz. J. Poult. Sci. 2003;5:23–27. [Google Scholar]
  67. Ruan D., Fan Q., Fouad A.M., Sun Y., Huang S., Wu A., Lin C., Kuang Z., Zhang C., Jiang S. Effects of dietary oregano essential oil supplementation on growth performance, intestinal antioxidative capacity, immunity, and intestinal microbiota in yellow-feathered chickens. J. Anim. Sci. 2021;99:skab033. doi: 10.1093/jas/skab033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  68. Ruytinx P., Vandormael P., Fraussen J., Pieters Z., Thonissen S., Hellings N., Stinissen P., Callebaut I., Penders J., Vanhove K., Kieffer D., Rummens J.L., Valkenborgh T., Messiaen P., Stessel B., Mesotten D., Somers V. Comprehensive antibody and cytokine profiling in hospitalized covid-19 patients in relation to clinical outcomes in a large belgian cohort. Sci. Rep. 2023;13:19322. doi: 10.1038/s41598-023-46421-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  69. SAS SAS/STAT User's Guide: Statistics, Release 6.08. 1994 [Google Scholar]
  70. Selhorst P., van Ierssel S.H., Michiels J., Mariën J., Bartholomeeusen K., Dirinck E., Vandamme S., Jansens H., Ariën K.K. Symptomatic severe acute respiratory syndrome coronavirus 2 reinfection of ahealthcare worker in a Belgian nosocomial outbreak despite primary neutralizing antibody response. Clin. Infect. Dis. 2021;73:e2985–e2991. doi: 10.1093/cid/ciaa1850. [DOI] [PMC free article] [PubMed] [Google Scholar]
  71. Slaughter S.L., Ellis P.R., Butterworth P.J. An investigation of the action of porcine pancreatic alpha-amylase on native and gelatinised starches. Biochimic et Biophysica Acta; 2001;1525:29–36. doi: 10.1016/s0304-4165(00)00162-8. [DOI] [PubMed] [Google Scholar]
  72. Kusakabe T., Lin W.Y., Cheong J.G., Singh G., Ravishankar A., Yeung S.T., Mesko M., DeCelie M.B., Carriche G., Zhao Z., Rand S., Doron I., Putzel G.G., Worgall S., Cushing M., Westblade L., Inghirami G., Parkhurst C.N., Guo C.J., Schotsaert M., Iliev I.D. Fungal microbiota sustains lasting immune activation of neutrophils and their progenitors in severe COVID-19. Nature immunology. 2023;24:1879–1889. doi: 10.1038/s41590-023-01637-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  73. Velayutham, M.,and Zweier, J. L. 2013. Cardiac ischemia and reperfusion. In: Villamena FA Molecular Basis of Oxidative Stress: Chemistry, Mechanisms, and Disease Pathogenesis. Wiley, pp 311–328.
  74. Wani A.K., Hashem N.M., Akhtar N., Singh R., Madkour M., Prakash A. Understanding microbial networks of farm animals through genomics, metagenomics and other meta-omic approaches for livestock wellness and sustainability–a review. Ann. Anim. Sci. 2022;22:839–853. [Google Scholar]
  75. Wasti S., Sah N., Mishra B. Impact of heat stress on poultry health and performances, and potential mitigation strategies. Animals. 2020;10:1266. doi: 10.3390/ani10081266. [DOI] [PMC free article] [PubMed] [Google Scholar]
  76. Wen C., Wei S., Zong X., Wang Y., Jin M. Microbiota-gut-brain axis and nutritional strategy under heat stress. Animal Nutr. (Zhongguo xu mu shou yi xue hui) 2021;7:1329–1336. doi: 10.1016/j.aninu.2021.09.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  77. Windisch W., Schedle K., Plitzner C., Kroismayr A. Use of phytogenic products as feed additives for swine and poultry. J. Anim. Sci. 2008;86:140–148. doi: 10.2527/jas.2007-0459. [DOI] [PubMed] [Google Scholar]
  78. Wu Y.N., Yan F.F., Hu J.Y., Chen H., Tucker C.M., Green A.R., Cheng H.W. The effect of chronic ammonia exposure on acute-phase proteins, immunoglobulin, and cytokines in laying hens. Poult. Sci. 2017;96:1524–1530. doi: 10.3382/ps/pew454. [DOI] [PubMed] [Google Scholar]
  79. Xin Y., Liu H., Yan X., Huang W., Pan S., Zhou M., Lu B., Tan B., Dong X., Yang Y. Effect of dietary oregano oil on growth performance, disease resistance, intestinal morphology, immunity, and microbiota of hybrid grouper (Epinephelus fuscoguttatus ♀ × Epinephelus lanceolatus ♂). Front. Mar. Sci. 2022;9 [Google Scholar]
  80. Yoshihara T., Shimada K., Fukao K., Sai E., Sato-Okabayashi Y., Matsumori R., Shiozawa T., Alshahi H., Miyazaki T., Tada N., Daida H. Omega 3 polyunsaturated fatty acids suppress the development of aortic aneurysms through the inhibition of macrophage-mediated inflammation. Circ. J. 2015;79:1470–1478. doi: 10.1253/circj.CJ-14-0471. [DOI] [PubMed] [Google Scholar]
  81. Zhang L.Y., Peng Q.Y., Liu Y.R., Ma Q.G., Zhang J.Y., Guo Y.P., Xue Z., Zhao L.H. Effects of oregano essential oil as an antibiotic growth promoter alternative on growth performance, antioxidant status, and intestinal health of broilers. Poult Sci. 2021;100 doi: 10.1016/j.psj.2021.101163. [DOI] [PMC free article] [PubMed] [Google Scholar]
  82. Zhang C., Zhao X.H., Yang L., Chen X.Y., Jiang R.S., Jin S.H., Geng Z.Y. Resveratrol alleviates heat stress-induced impairment of intestinal morphology, microflora, and barrier integrity in broilers. Poult. Sci. 2017;96:4325–4332. doi: 10.3382/ps/pex266. [DOI] [PubMed] [Google Scholar]
  83. Zhang L., Wang X., Huang S., Huang Y., Shi H., Bai X. Effects of dietary essential oil supplementation on growth performance, carcass yield, meat quality, and intestinal tight junctions of broilers with or without Eimeria challenge. Poult. Sci. 2023;102 doi: 10.1016/j.psj.2023.102874. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Poultry Science are provided here courtesy of Elsevier

RESOURCES