Sall4 regulates downstream patterning genes during limb regeneration

Abstract

Many salamanders can completely regenerate a fully functional limb. Limb regeneration is a carefully coordinated process involving several defined stages. One key event during the regeneration process is the patterning of the blastema to inform cells of what they must differentiate into. Although it is known that many genes involved in the initial development of the limb are re-used during regeneration, the exact molecular circuitry involved in this process is not fully understood. Several large-scale transcriptional profiling studies of axolotl limb regeneration have identified many transcription factors that are up-regulated after limb amputation. Sall4 is a transcription factor that has been identified to play essential roles in maintaining cells in an undifferentiated state during development and also plays a unique role in limb development. Inactivation of Sall4 during limb bud development results in defects in anterior-posterior patterning of the limb. Sall4 has been found to be up-regulated during limb regeneration in both Xenopus and salamanders, but to date it function has been untested. We confirmed that Sall4 is up-regulated during limb regeneration in the axolotl using qRT-PCR and identified that it is present in the skin cells and also in cells within the blastema. Using CRISPR technology we microinjected gRNAs specific for Sall4 complexed with cas9 protein into the blastema to specifically knockout Sall4 in blastema cells only. This resulted in limb regenerate defects, including missing digits, fusion of digit elements, and defects in the radius and ulna. This suggests that during regeneration Sall4 may play a similar role in regulating the specification of anterior-proximal skeletal elements.

Introduction

Limb regeneration is a phenomenon that has fascinated scientists for centuries (1–19). This intriguing field of study delves into the intricate processes by which living organisms, ranging from amphibians to certain invertebrates, can regrow lost or damaged limbs with astonishing precision. Limb regeneration involves a complex interplay of cellular events, signaling pathways, and timing to orchestrate the recreation of the complex limb structure, which includes bones, muscles, nerves, and skin (1–19).

To date, work from many scientists has begun to unravel the molecular and cellular mechanisms underlying the ability to regenerate a complex functional limb. It is now well-documented that many genes involved in the initial specification and patterning of the limb bud are re-expressed during limb regeneration. Many signaling pathways involved in the anterior-posterior specification on the limb axis and those that pattern the dorsal-ventral axis of the hand have been identified. The well-studied Hox genes are essential for limb development and are re-expressed during limb regeneration, as are many well-known signaling factors like Fgf genes and Shh; both are crucial for limb development and regeneration (10, 20–26).

Sall4 and Gli3 have also emerged as crucial players in regulating limb development (27–31). Sall4, a zinc finger transcription factor, plays a pivotal role in maintaining the undifferentiated state of limb progenitor cells (27). It exerts influence during early limb bud formation, ensuring the proper balance between self-renewal and differentiation as cells become distinct limb structures. On the other hand, Gli3, a member of the Hedgehog signaling pathway, is instrumental in regulating the patterning and growth of limbs (27, 32–40). Gli3 acts as a molecular switch, transducing signals that guide limb cells to assume specific fates and positions within the developing limb bud. Gli3 acts to restrict Shh expression to the posterior region of the limb bud, opposing Fgf8 in the anterior region (41–46). Expression domains in the limb bud must be calibrated correctly to ensure the correct patterning of the future digits is achieved (27, 33, 38, 42, 44, 46–56). Together, Sall4 and Gli3 form integral components of the intricate molecular network that directs limb development, ensuring the precise formation of correctly patterned limb.

Another well-studied gene family in limb development and regeneration are the Wnt genes. During limb development, Wnt signaling pathways play a pivotal role in establishing the limb bud’s anterior-posterior and proximal-distal axes, guiding the differentiation and patterning of cells (57–67). Wnt proteins act as morphogens, influencing cell fate determination, proliferation, and the formation of key structures within the developing limb. Wnt genes, key players in developmental signaling pathways, contribute significantly to the spatial and temporal coordination of limb bud growth and patterning. They guide the differentiation of limb progenitor cells along the anterior-posterior and proximal-distal axes, ensuring the proper arrangement of skeletal elements and tissues. During limb regeneration, Wnt signaling also takes center stage. Studies in regenerative models, such as salamanders and axolotls, have highlighted the reactivation of Wnt pathways as a key factor in the initiation and maintenance of the regenerative response. Wnt signaling promotes the formation of a blastema, a pool of undifferentiated cells capable of giving rise to the diverse tissues required for limb regeneration (8, 67–73).

Together, Wnt genes and Sall4 form a synergistic partnership, directing the molecular cues that govern limb development. Work in mice has shown that Sall4 acts upstream of Wnt/ß-catenin signaling, and Sall4 promotion of Wnt signaling acts to maintain neuroectodermal progenitors in an undifferentiated state during axis formation (27, 30, 74). Several papers have shown that Sall4 and Wnt genes are up-regulated during axolotl limb regeneration (31, 74–78), and inhibition of Wnt signaling leads to defects in the size of the regenerated limb (72). To determine the role of Sall4 in limb regeneration, we have knocked out Sall4 and determined that it is necessary for the faithful patterning of the limb regenerate.

Materials and Methods

Animal Handling and Limb amputations

All axolotls used in these experiments were obtained and bred at the University of Minnesota or the Marine Biological Laboratory in accordance with IACUAC regulations. Prior to all in vivo experiments, animals (5–8cm) were anesthetized in 0.01% p-amino benzocaine (Sigma). Limb amputations were performed using a number 10 scalpel; the limb was amputated halfway between the elbow and the wrist. After amputation, animals were housed individually in cups and monitored for the duration of the experiments.

CRISPR and Morpholino Injections

Guides were designed against the axolotl Sall4 gene using open source design tool website ChopChop: https://chopchop.cbu.uib.no/ (79–81). Initially, 4 guides were tested, and then one was selected for use in all further experiments, which gave the best INDEL. To determine which guide to use, genomic DNA was extracted from individual embryos using a ThermoFisher Purelink Genomic DNA extraction kit. The samples were sent for sequencing and analysis was carried out using the TIDE program. The guides were synthesized by IDT. Prior to injection the guide was complexed with cas9 protein according to previous publications (82). The complex was injected into the mature limb prior to amputation, the limb was injected from the hand along the length of the lower limb using a World Precision Instruments pressure injector; after injection and electroporation of the limb, the limb was amputated in the mid-radius/ulna region. Animals 5–8cm in length are used in these experiments, at this stage the animals contain cartilage in the limbs, they do not yet have ossified bones as the limbs and animals’ overall are still growing. At three days post-amputation, when a blastema was visible, the complex was injected into the blastema and electroporated. To confirm an INDEL was generated the blastema was harvested 5 days post amputation, genomic DNA was extracted using a ThermoFisher Purelink Genomic DNA extraction kit and sent for sequencing. The guide used in these experiments generated a 20bp deletion in the Sall4 gene (Fig.S2).

For morpholino experiments, the control and AxSall4 morpholinos were designed and synthesized by Gene Tools, LLC. The negative control morpholino was designed to target a beta-globin that causes beta-thalassemia; this oligo has been well documented to cause little to no changes in phenotype of any known test system, including the axolotl. Prior to injection, both control and Sall4 morpholinos were diluted to 1mMol in PBS and Fast Green. Morpholinos were injected into the mature limb prior to amputation using a World Precision Instruments pressure injector. Similar to our CRISPR experiments, immediately following injection animals were electroporated using an ECM 830 electroporation system, with 5-pulses of 50V, each for 50ms. Further, regenerating limb blastemas were injected and electroporated every 2–3 days with either the control or Sall4 morpholino.

Alcian Blue Stainings

Limbs were fixed overnight in 4% paraformaldehyde, then washed 3 × 10 mins in phosphate buffered saline (PBS). The samples were then dehydrated through a graded series of alcohol washes (25%, 50%, 75%, 100% EtOH) for 20 mins at each step. Samples were then placed in an Alcian blue solution made up of EtOH and acetic acid (60:40). Staining was carried out at room temperature for 2 days and when staining was complete, samples were washed in EtOH/acetic acid mix for 1hr at RT. Samples were then gradually rehydrated in 90%, 70%, 50%, and 25% ETOH/PBS. Samples were imaged on a Zeiss Stereo Discovery.V8 dissecting scope.

Quantitative Reverse Transcriptase Polymerase Chain Reaction

Blastemas were collected from control and Sall4 CRISPR-injected animals, and blastemas from six animals were pooled for RNA extraction. Total RNA was isolated using Trizol (Invitrogen) according to the manufacturer’s instructions. Subsequent cDNA was synthesized from 1μg of DNaseI (NEB) treated RNA using the iScript cDNA Synthesis Kit (BioRad). The following qRt-PCR primers were used:

Gene	Forward Primer (5’−3’)	Reverse Primer (5’−3’)
18S	CGGCTTAATTTGACTCAACACG	TTAGCATGCCAGAGTCTCGTTC
Sall4	AATCCCTCGCAAGCCC	CCAGCTATGAGGGGAACATT
Gli3	GCATGAGCATCTTGCAACTCAGC	TGGTGTGTGATGGGACATTAGCCT
Shh	GTAACCCTGGAGCATGGAGT	TCGGACTCTGCTGGCAAATA
Fgf8	TTTGTCCTCTGCATGCAAGC	GTCTCGGCTCCTTTAATGCG
Fgf10	AAACTGAAGGAGCGGATGGA	TCGATCTGCATGGGAAGGAA
Hand2	CGCACGCAGAGCATCAA	TCCATGAGGTAGGCGATGTA
Alx4	GGGTAACCTCTTTGGCACTG	TTAAGTGCCCTGTCATGTGG
Meis1	CCATCTACGGACACCCCCT	GGAAGAACACACGTCCCCG
Meis2	AGTGGAGGGCACGCTTCT	GCTTCTTGTCTTTGTCCGGGT
Hoxa13	TCTGGAAGTCCTCTCTGCCG	TCAGCTGGACCTTGGTGTACG

Western Blotting

Limb blastema’s were harvested at 3 days post amputation (dpa) and immediately flash frozen on liquid nitrogen. Tissues were homogenized using a handheld dounce homogenizer in lysis buffer, then centrifuged for 30 minutes at 4°C. Total protein concentrations were determined using the Pierce BCA protein assay, and 20 μg of total protein was run on a NuPAGE 4–12% Bis-Tris Gel for 35 minutes at 200V. After transfer onto Invitrolon PVDF membrane, blots were blocked in 3% nonfat milk powder/0.1% Tween-20/PBS for 1 hour. Membranes were next incubated in a SALL4 primary antibody (1:1000; 8459S Cell Signaling) overnight at 4°C with gentle shaking. The next day, blots were washed in PBS/0.1% Tween-20 and incubated in stabilized peroxidase conjugated goat anti-rabbit antibody (1:10,000) for 1 hour at room temperature. Finally, membranes were incubated in Supersignal West Pico PLUS Chemiluminescent Substrate for 5 minutes. Membranes were immediately imaged using an Amersham Imager 600 (General Electric).

Immunofluorescence

Limbs were harvested and immediately fixed overnight at 4°C in 4% paraformaldehyde. The next day, tissues were decalcified in 10% EDTA (pH 7.4) overnight at room temperature. Limb tissues were next rinsed in PBS and washed for 10 minutes in 15% sucrose. After incubation in 30% sucrose at 4°C overnight, samples were embedded in O.C.T. (Tissue-Tek) and cryosectioned on a Leica Cryomicrotome 1850. For immunostaining procedures, sections were incubated in PBS at 70°C for 20min, then permeabilized for 3×10min in PBS/0.1% Triton-X.

Samples were blocked in blocking buffer (2% bovine serum albumin/2% goat serum/0.1% Triton-X in PBS) for 1 hour at room temperature, then incubated in a SALL4 antibody (1:250, 8459S Cell Signaling) overnight at 4°C. The next day, sections were briefly washed in PBS/0.1% Tween-20, incubated in a secondary antibody (Alexa Fluor 568, Invitrogen) for 2 hours, and counterstained using DAPI. Sections were finally imaged on a Leica DMI 6000 B epifluorescent microscope.

Fluorescent In situ Hybridization

All RNAscope^® in situ hybridization procedures were performed according to the manufacturer’s instructions (Advanced Cell Diagnostics). In brief, cryosections were incubated in PBS for 10 minutes to remove the OCT, and then baked at 60°C for 30 minutes. The slides were next post-fixed in 4% paraformaldehyde for 15 minutes at 4°C, and then dehydrated in a graded series of ethanol dilutions before being incubated in absolute ethanol for 5 minutes. After briefly air-drying the slides for 5 minutes, sections were next treated with hydrogen peroxide to quench endogenous peroxidase activity for 10 minutes at room temperature. Next, samples were briefly washed in deionized water, then incubated in target retrieval buffer at 90°C for 5 minutes. Following target retrieval, the slides were rinsed in deionized water for 15 seconds and treated with absolute ethanol for 3 minutes. Slides were next permeabilized in protease III for 30 minutes before hybridization with RNAscope^® probes at 40°C for 2 hours. Following hybridization, sections were placed in 5x SSC overnight. The next day, sections were incubated in Amp1 and Amp2 at 40°C for 30 minutes each, followed by Amp3 for 15 minutes. Next, slides were treated with HRP-C1 to detect Fgf10, followed by a 30-minute incubation in OpaI-690 fluorescent dye. After treatment with HRP blocking buffer, samples were next incubated in HRP-C2 to detect Wnt5a, followed by a 30-minute incubation in OpaI-570 dye. After an additional treatment with HRP blocking buffer, slides were counterstained with DAPI and imaged using a Zeiss 780 Confocal Microscope.

Statistical Analyses

All results are presented as mean +/− s.d. unless otherwise stated. Analyses were performed using GraphPad Prism v10.1.1. Means were compared using an Ordinary one-way ANOVA with a Tukey posthoc test for multiple comparisons. Differences between treatment groups were considered significant by a p-value of ≤0.05 (p-values of *≤0.05, **≤0.01, ***≤0.001, ****≤0.0001).

Results

Sall4 is re-expressed during limb regeneration

Sall4 is a transcription factor that plays a well-documented role in maintaining cells in an undifferentiated state during early embryogenesis. More recent work has also shown that Sall4 plays a crucial role in regulating expression boundaries in the limb bud during development to ensure correct patterning of the limb digits (27, 30, 83). Several studies in limb regeneration have found that Sall4 is up-regulated during the process of axolotl limb regeneration, however its functional role is unknown. Here, using qRT-PCR we confirmed that Sall4 is indeed upregulated by 3 days post injury, and that Sall4 remains elevated in the blastema cells (Fig.1A). We additionally used a SALL4 antibody to determine its localization within regenerating limbs. We first confirmed the specificity of the SALL4 antibody on axolotl limb tissue using western blotting, demonstrating a single band at the predicted SALL4 molecular weight of ~80 kDa (Fig.S1A). Using immunohistochemistry, we found that SALL4 was expressed at low levels in the cartilage and skin of uninjured limb tissues (Fig.S1B–D). In regenerating limb tissues, SALL4 protein was expressed in most cells of the blastema but was largely excluded from the wound epithelium (Fig. 1B). Interestingly, while SALL4 expression was absent from the wound epithelium, it was present in the surrounding cells of the dermal and epidermal layers. Additionally, all cells in the blastema appeared to upregulate SALL4, including cells in the zone adjacent to the injury site, especially cartilage cells.

Figure 1: Sall4 is upregulated after limb amputation.

A) Quantitative RT-PCR analysis reveals that Sall4 is significantly up-regulated during limb regeneration compared to the uninjured, mature limb. Peak levels of Sall4 transcript are found at 7 days post-amputation (dpa), and by 10 dpa, Sall4 levels begin to return to homeostatic levels (**p≤0.01, ***p≤0.001, ****p≤0.0001). B) SALL4 immunostaining after limb amputation demonstrates that SALL4 is expressed in cells of the regeneration blastema, but is absent from the wound epithelium. Scale bars: 500 μm.

Knock-out of Sall4 causes defects in limb regeneration

To explore the functional role of Sall4 in the regenerating limb we initially knocked down Sall4 levels in the blastema cells by direct injection of a morpholino against Sall4, which we have previously validated and used to test the function of Sall4 in axolotl skin during regeneration (84). We first performed immunohistochemistry on control and Sall4 morpholino-injected limb tissues to further confirm the specificity of the morpholino. We discovered that SALL4 protein expression was dramatically reduced in Sall4 morpholino-treated limbs in comparison to controls, specifically within the cartilage and blastema cells (Fig.S2A,B). Importantly, depletion of Sall4 directly in the blastema cells led to defects in the patterning of cells in the hand when compared to the control (Fig.S2C–F). Sall4 morpholino injected animals also showed defects in the number of digits (n= 5/17, Fig.S2E), patterning of the metacarpals (11/17), and in the pattern of cartilage differentiation in the regenerated radius and ulna (n= 10/17, Fig.S2F). The defects we observed in morpholino-injected animals are not observed in all animals, only around 50% of animals injected with the morpholino showed a morphological phenotype at 40 days post amputation. This is possibly due to the short half-life of the morpholino, or a result of diluting the morpholino as the cells in the blastema divide.

To further confirm this phenotype we designed several CRISPR guides against Sall4 and injected them into embryos and harvested the genomic DNA after 5 days. Sequencing confirmed that one of the guides created a 20bp deletion in Sall4 (Fig.S3A,B), and we used this guide for all further studies. The guide was injected into mature cells of the limb prior to electroporation and then the limb was amputated through the mid-radius and ulna region. At three days post injury when a blastema was visible we re-injected the Sall4 CRISPR guide. We further validated the Sall4 CRISPR knock-out using immunohistochemistry on limb tissue at 7 days post amputation (dpa). We found that SALL4 protein expression was reduced in Sall4 CRISPR-injected animals compared to controls, specifically within the regeneration blastema (Fig.S3C,D). After confirming the efficiency of the Sall4 CRISPR knock-out, we fixed regenerating limb tissues at 40dpa from control and Sall4 CRISPR animals for phenotypic analysis. Using the CRISPR knock-out of Sall4 during limb regeneration, similar results were found to the morpholino phenotype, but with much higher penetrance. Ninety-eight percent of the animals injected with the Sall4 CRISPR had defects in patterning of the limb, whilst control injected animals had no morphological phenotypes (n= 0/25). Sall4 knock-out animals were missing digits (n= 11/15) and metacarpals (n= 13/15), had fused metacarpals, and also had thickened bulges in the radius and ulna (n= 11/15, Fig.2C). Moreover, the CRISPR animals all displayed numerous patterning defects (Fig.2D).

Figure 2: Knock-out of Sall4 in blastema cells causes defects in regeneration.

(A-C) At 40 days post amputation (dpa), blastemas injected with a CRISPR guide against Sall4 (B, C; n=26) fail to correctly pattern the regenerated limb compared to control injected animals (A, n=25). Animals with reduced Sall4 expression resulted in multiple defects in the regenerate, which included bulges in the radius and ulna (B, pink arrow) and failure to reach the correct number of metacarpals and/or digits (C, grey arrow). Scale bar: 1mm. D) Graph displays the number of Sall4 CRISPR animals with limb abnormalities compared to control animals.

Loss of Sall4 leads to defects in re-expression of key patterning genes

To gain a more comprehensive understanding of the function of Sall4 in limb regeneration, we looked at expression levels of genes involved in limb patterning and in the Sall4 signalling pathway in CRISPR and control animals. The outgrowth of the limb blastema is driven by the re-expression of Fgf genes and up-regulation of Shh in the posterior blastema cells (70–72, 85–92), and is essential for the correct patterning of the regenerated limb. By qRT-PCR, we determined that Fgf8 and Fgf10 are significantly up-regulated after Sall4 knockout in comparison to control limb blastema’s. Work in mouse limb development has suggested an interaction between Sall4 and Gli3 upstream of Shh signalling (27), while knockout of Gli3 results in defects in the proximal limb but no effect on the hand in mice (47). We also examined the levels of Gli3 and Shh in the Sall4 knockout limb blastemas, and we found the levels of Gli3 and Shh were much higher than in control blastemas. We also quantified the expression levels of other known drivers of limb regeneration and patterning and found that Meis1 & 2, Hand2, and Alx4 were all highly up-regulated in Sall4 knockouts in comparison to control regenerating limbs. We also quantified the expression of the distally expressed Hox gene, Hoxa13, and found that these levels were not changed compared to control limb blastema, suggesting that the positional identity of the blastema cells was not changed. To determine if the expression domains of some of the patterning genes were changed, we carried out fluorescent in situ hybridization for Wnt5a and Fgf10. In control regenerating blastema, Wnt5a is restricted to a small zone of distally located blastema cells adjacent to the wound epithelium. In Sall4 knock-out animal, we observed an expansion of the Wnt5a expression domain; it now extended more proximal in the blastema (Fig.3). We also investigated the expression of Fgf10 in the CRISPR animals, in control animals it is expressed in an overlapping domain to Wnt5a, in a small group of cells in the distal blastema (Fig.3C), however in the Sall4 knock-out animals the expression domain in significantly increased and we observed Fgf10 to now be expressed in most cells in the blastema (Fig.3D), in a larger domain than we see Wnt5a expressed in but there is still overlap in their increased expression domains (Fig.3 C,D). Taken together, these data suggest that Sall4 acts upstream of Wnt signaling to control the expression levels of downstream target patterning genes.

Figure 3: Sall4 inhibition results in the up-regulation of key genes involved in patterning the limb during regeneration.

(A, B) qPCR demonstrates that after knocking out Sall4 during limb regeneration, many genes associated with limb patterning are significantly up-regulated in comparison to controls. dpa = days post amputation, *p≤0.05, **p≤0.01, ***p≤0.001, ****p≤0.0001. C) After Sall4 inhibition, in situ hybridization demonstrates that the localization of Wnt5a and Fgf10 dramatically increases in the blastema immediately adjacent to the wound epithelium. Vertical white line indicates the original plane of amputation. Scale bars: 500 μm.

Discussion

SALL4 encodes multiple Cys2His2 zinc finger (C2H2-ZF) domain-containing transcription factors that activate or repress gene transcription depending on the cell type. In mammals, expression of SALL4 has been primarily detected in embryonic stem cells (ESCs), where it acts as a core controller regulating cell “stemness” in early development. SALL4 is required for ESC pluripotency, and it is an essential component of the ‘stemness’ regulatory circuit involving OCT4, SOX2, NANOG and other factors that maintain ESC self-renewal and pluripotency (93–100). SALL4 is also expressed in extraembryonic endoderm cells, where it participates in cell fate decisions by simultaneously activating key pluripotency maintaining factors and silencing endoderm lineage-associated factors such as GATA6, GATA4, and SOX17 (93–100). At later developmental stages, heterozygous disruption of the Sall4 allele leads to multi-organ malformations including limb and heart defects (27, 101). Work in Xenopus embryos identified a novel role for Sall4 in repressing Pou5f3 family members to enable neural patterning and differentiation during early development (102, 103).

In this study, we generated Sall4 knock-outs during limb regeneration to determine if it is necessary for faithful limb regeneration in the axolotl. Our worked has uncovered a role for Sall4 upstream of classical genes involved in patterning. Knock-out of Sall4 leads to clear patterning defects in the regenerate and to increased expression levels of many genes involved in limb patterning. This data suggests that genes like Fgfs, Wnts, Hand2 and Shh that are spatially restricted during limb development and regeneration may expand their expression domains in Sall4 knock-out blastemas, this we have shown for both Wnt5a and Fgf10 (Fig.3). Interestingly, in all genes we quantified except for HoxA13, knock-out of Sall4 led to increased expression of the genes, suggesting that Sall4 is not necessary for the activation of gene expression but rather is may play a role in regulating levels and timing of expression of downstream genes. Meis genes have been found to play an important role in proximal-distal regulation in limb regeneration. Meis genes are highly expressed in the blastema of a proximally amputated limb and, when overexpressed in the cells of a hand blastema, can change their identity. Meis is also upstream of the other known positional identity genes Prod1 and Tig1. Given that we see a significant increase in the Meis1 levels in Sall4 knock-out blastema, we thought it may be changing the positional identity of these cells, however, we see no changes in HoxA13 expression and no phenotypic evidence that the overall P/D positional information changes in the limb regenerates. It is more likely that changes we found in genes involved in anterior posterior and dorsal/ventral patterning like Hand2, Shh, Gli3 and Fgf genes are what lead to the observed patterning defects. It is also well-known that Sall4 plays an essential role in maintaining cells in an undifferentiated state during early development (96, 98, 99, 104–107). As Sall4 is up-regulated early in blastema formation it is possible that Sall4 plays an essential role in driving cells into a more immature state to form a blastema. Sall4 may be necessary to maintain the undifferentiated state of the blastema, and the knock-out of Sall4 in some blastema cells leads to premature differentiation of the cells and, in combination with changes in expression levels of key patterning genes, results in defectively patterned regenerate.

Supplementary Material

1

Supplementary Figure 1: SALL4 expression in the axolotl limb. (A) Western blotting on axolotl limb tissue demonstrates a single molecular weight band for SALL4 at ~80 kilodaltons (kDa). (B) Structure of the axolotl limb. Red boxes indicate regions of interest for immunostaining. (C) SALL4 is expressed in the cartilage and skin in the digits of the uninjured axolotl limb. Scale bar: 250 μm. (D) In a more central region of the hand, SALL4 is also expressed in the cartilage and skin. Scale bar: 500 μm.

2

Supplementary Figure 2: Sall4 morpholino knock-out results in limb defects during regeneration. (A) Immunohistochemistry of control morpholino (MO)-injected limbs demonstrates SALL4 expression within the regeneration blastema at 7dpa. (B) After injection with a Sall4 morpholino, SALL4 expression is dramatically reduced within the regeneration blastema at 7dpa. (C) Sall4 morpholino-injected animals display a range of defects in the skeletal element, ranging from missing digits to defects in the radius and ulna. (D) Control limb at 40 days post-amputation (dpa). (E-F) After injection with a Sall4 morpholino, defects in the number of regenerated digits (E) and bulging of the radius and ulna (F, pink arrows) are shown at 40dpa. The horizontal yellow line indicates the original plane of amputation. Scale bars in A-B: 500 μm. Scale bars in C-E: 1mm.

3

Supplementary Figure 3: Sall4 CRISPR GUIDE creates a 20bp deletion. (A) Sequence of the CRISPR guide used and the comparison of the sequence of the Sall4 gene from control versus the CRISPR injected embryo, which shows a 20bp deletion. (B) TIDE analysis showing the INDEL spectrum for the Sall4 CRISPR injected animal. (C-D) Immunohistochemistry demonstrates a reduction in SALL4 protein expression in Sall4 CRISPR (D) injected animals compared to controls (C). Scale bars: 500 μm.

Highlights.

1. Sall4 is re-expressed in many cell after injury to the limb

2. Knock-down or knock-out of Sall4 during regeneration results in defects in patterning of the regenerate

3. Knock-down or knock-out of Sall4 results in defects in expression of key fgf and wnt genes during limb regeneration