KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| α-CLK1 (F-12) mouse mAb | Santa Cruz | sc-515897 |
| α-β-Actin (8H10D10) Mouse mAb (HRP Conjugate) | Cell Signaling Technology | 12262S |
| Anti-mouse IgG, HRP-linked Antibody | Cell Signaling Technology | 7076S |
| Drugs | ||
| DMSO | Sigma | D2650-5X5ML |
| Cirtuvivint (SM08502) | MedChem Express | HY-13743 |
| Critical commercial assays | ||
| GenePrint 24 | Promega | B1870 |
| EZ-PCR Mycoplasma Detection Kit | Biological Industries | 20-700-20 |
| Maxwell RSC simplyRNA Cells Kit | Promega | AS1390 |
| SuperScript IV | Invitrogen | 18090010 |
| CellTitre-Glo luminescent cell viability assay | Promega | G7570 |
| Deposited data | ||
| PBTA raw WGS, WXS, Panel, RNA-Seq | dbGAP | phs002517.v2.p2 |
| PBTA harmonized WGS, WXS, Panel, RNA-Seq | OpenPedCan16 | https://github.com/d3b-center/OpenPedCan-workflows |
| PBTA merged summary files and downstream analyses | This project | 10.5281/zenodo.13362856 |
| Morpholino treated KNS42 RNA-seq | This project | GSE273841 |
| Experimental models: Cell lines | ||
| PBTA patient-derived cell lines 7316-1763 and 7316-1769 | Children’s Brain Tumor Network | Children’s Brain Tumor Network |
| KNS-42 human glioma cell line | Accegen | ABC-TC0532 |
| Oligonucleotides | ||
| CLK1 intron 3-exon 4 splice junction targeting morpholino - ACTCTTCTGGAAACGTCAAGTGGGC | Gene Tools, LLC, This Project | |
| CLK1 Ex3-Ex4 (inclusion of Exon4) F- GGACATCGCCAAAGAGACCA |
Integrated DNA Technologies IDT, This Project | |
| CLK1 Ex3-Ex4 (inclusion of Exon4) R- TCCTTCGGTGACTCTTCCCA |
Integrated DNA Technologies IDT, This Project | |
| CLK1 Ex3-Ex5 (inclusion of Exon4) F- ATCGCCAAAGAGACCATGAAAG |
Integrated DNA Technologies IDT, This Project | |
| CLK1 Ex3-Ex5 (inclusion of Exon4) R- GTATCAACAATTTCATCCCATGTGA |
Integrated DNA Technologies IDT, This Project | |
| CLK1 Ex3-Ex5 (inclusion of Exon4) F- CCATGAAAGCCGGTATCAGAAC |
Integrated DNA Technologies IDT, This Project | |
| CLK1 Ex3-Ex5 (inclusion of Exon4) R- ACCTAAAGTATCAACAAIIICATCCCA |
Integrated DNA Technologies IDT, This Project | |
| Software and algorithms | ||
| Replicate Multivariate Analysis of Transcript Splicing (rMATS) | https://github.com/Xinglab/rmats-turbo | rMATS-turbo: an efficient and flexible computational tool for alternative splicing analysis of large-scale RNA-seq data14 |
| ggsashami | https://github.com/guigolab/ggsashimi | ggsashimi: Sashimi plot revised for browser- and annotation-independent splicing visualization44 |
| OpenPedCan analysis repository v2.1.0 (data release v13) | OpenPedCan16 | https://github.com/d3b-center/OpenPedCan-analysis |
| Project repository | This Project | https://github.com/rokitalab/clk1-splicing |