KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
|
| ||
| Antibodies | ||
| aCD11c PE | BioLegend | RRID: AB_313776 Clone:N418 |
| aCD11c PE/Cy7 | BioLegend | RRID: AB_493569 Clone:N418 |
| aCD3 AF647 | BioLegend | RRID: AB_389323 Clone:17A2 |
| aCD3e biotin | BioLegend | RRID: AB_312668 Clone:145–2C11 |
| aCD4 AF647 | BioLegend | RRID: AB_493372 Clone:RM4–5 |
| aCD40 PE/cy7 | BioLegend | RRID: AB_10933422 Clone:3/23 |
| aCD45 AF647 | BioLegend | RRID: AB_493534 Clone:30-F11 |
| aCD45 AF700 | BioLegend | RRID: AB_493714 Clone:30-F11 |
| aCD45.1 AF647 | BioLegend | RRID: AB_492864 Clone:A20 |
| aCD64 APC | BioLegend | RRID: AB_11219205 Clone:X54–5/7.1 |
| aCD8 AF594 | BioLegend | RRID: AB_2563237 Clone:53–6.7 |
| aCD8 Pe/Cy7 | BioLegend | RRID: AB_312760 Clone:53–6.7 |
| aCD86 PE | BioLegend | RRID: AB_313150 Clone: GL-1 |
| aGr1 APC | BioLegend | RRID: AB_313376 Clone:RB6–8C5 |
| aH2Kd AF647 | BioLegend | RRID: AB_493063 Clone:AF6–88.5 |
| aH2Kd APC | BioLegend | RRID: AB_10640118 Clone:SF1–1.1 |
| aHIF-1α XP® Rabbit mAb | Cell signaling | RRID: AB_2799095 Clone:D1S7W |
| aHuman CD3 | Agilent | RRID: AB_2631163 Clone:F7.2.38 |
| aHuman E-Cadherin | CST | RRID: AB_2291471 Clone:24E10 |
| aHuman Ki67 | Biocare | RRID: AB_2721189 Clone:SP6 |
| aHuman p27K | BD | RRID: AB_397636 Clone:57/Kip1/p27 |
| aIFNAR1 biotin | BioLegend | RRID: AB_1134250 Clone:MAR1–5A3 |
| aKi67 mAb | Cell Signaling | RRID: AB_2620142 Clone:D3B5 |
| aMHCII APC | BioLegend | RRID: AB_313328 Clone:M5/114.15.2 |
| aMHCII PB | BioLegend | RRID: AB_493528 Clone:M5/114.15.2 |
| aPD1 PerCP/Cy5.5 | BioLegend | RRID: AB_10550092 Clone:29F.1A12 |
| aTCRb biotin | BioLegend | RRID: AB_313426 Clone: H57–597 |
| aTIM3 APC | BioLegend | RRID: AB_2562997 Clone:B8.2C12 |
| Donkey anti-rabbit IgG AF647 | BioLegend | RRID: AB_2563202 Clone:Poly4064 |
| Goat anti-mouse AF555 | Invitrogen | RRID: AB_2535849 |
| IRDye 800CW Goat anti-Rabbit | LI-COR | RRID: AB_2651127 |
| Rat IgG1, κ Isotype Ctrl | BioLegend | RRID: AB_11150772 Clone: RTK2071 |
| Rat IgG2a, κ Isotype Ctrl | BioLegend | RRID: AB_11147167 Clone: RTK2758 |
| Rat IgG2b, κ Isotype Ctrl | BioLegend | RRID: AB_11149687 Clone: RTK4530 |
| Mouse IgG1, κ Isotype Ctrl | BioLegend | RRID: AB_11148942 Clone: MG1–45 |
| American Hamster IgG Isotype Ctrl | BioLegend | RRID: AB_11203529 Clone: HTK888 |
| Rabbit IgG Isotype Ctrl | Thermofisher scientific | RRID: AB_243593 |
| Anti-mouse CD16/32 | BioLegend | RRID: AB_2561482 Clone: 93 |
| CD45-BX007—Alexa Fluor™ 750-RX007 | Akoya Biosciences | Cat#4450002, Clone: 30-F11 |
| MHCII-BX014-Atto 550-RX014 | Akoya Biosciences | Cat#4250003, Clone: M5/114.15.2 |
| CD3-BX021—Cy5-RX021 | Akoya Biosciences | Cat#4350014, Clone: 17A2 |
| CD11c-BX030-Cy5-RX030 | Akoya Biosciences | Cat#4350013, Clone: N418 |
| Anti-p27 KIP 1 | Abcam | RRID: AB_2811037, Clone: Y236 |
| Anti-GFP | Abcam | RRID: AB_305643 |
| Anti-mouse CD90.1 (Thy-1.1) | BioLegend | RRID: AB_314013 Clone: OX-7 |
| Anti-mouse F4/80 | BD Biosciences | RRID: AB_2739222 Clone: T45–2342 |
| Anti-mouse CD366 (Tim-3) | Biolegend | RRID: AB_1626128 Clone: B8.2C12 |
|
| ||
| Bacterial and virus strains | ||
|
| ||
| One Shot™ Stbl3™ Chemically Competent E. coli | Thermofisher Scientific | cat#C737303 |
|
| ||
| Biological samples | ||
|
| ||
| anonymized TNBC patients | Brigham and Women's Hospital Pathology Core | protocols 11–104 and 93–085 |
|
| ||
| Chemicals, peptides, and recombinant proteins | ||
|
| ||
| Iscove's Modified Dulbecco's Medium (IMDM) | Thermofisher Scientific | Cat#31980030 |
| USDA FBS | Life Technologies | Cat#10437028 |
| Penicillin-Streptomycin | Life technologies | Cat#15140122 |
| Glutamax | Life Technologies | Cat#35050061 |
| Polybrene Transfection Reagent | Thermofisher Scientific | Cat#TR1003G |
| T4 Ligase | NEB | Cat#M0202L |
| BamHI-HF | NEB | Cat## R3136L |
| NheI-HF | NEB | Cat#R3131S |
| CutSmart® Buffer | NEB | Cat#B7204 |
| AgeI-HF | NEB | Cat#R3552S |
| SalI-HF | NEB | Cat#R3138S |
| BsaBI | NEB | Cat#R0537S |
| Q5® High-Fidelity DNA Polymerase | NEB | Cat#M0491S |
| BclI-HF | NEB | Cat#R3160S |
| NotI-HF | NEB | Cat#R3189S |
| Calcium Chloride, Anhydrous (Pellets, 4–20 mesh, for Desiccators), Fisher Chemical™ | Fisher Scientific | Cat#C614–500 |
| UltraPure 0.5 M EDTA, pH 8.0 | Life Technologies | Cat#15575020 |
| Alt-R® S.p. Cas9 Nuclease V3 | IDT | Cat#1081059 |
| Hyaluronidase | StemCell | Cat#07461 |
| Collagenase IV | StemCell | Cat#17104019 |
| DNaseI | Sigma Aldrich | Cat#10104159001 |
| RBC lysis buffer | Biolegend | Cat#420301 |
| BSA | Cell Signaling Technology | Cat#9998S |
| Dapi | Biolegend | Cat#422801 |
| 10X CODEX Buffer | Akoya Biosciences | Cat#7000001 |
| CODEX Assay Reagent | Akoya Biosciences | Cat#7000002 |
| Nuclear Stain | Akoya Biosciences | Cat#7000003 |
| CODEX Storage Buffer | Akoya Biosciences | Cat#232107 |
| BX002-Atto 550-RX002 | Akoya Biosciences | Cat#5450023 |
| BX006-Cy5-RX006 | Akoya Biosciences | Cat#5450027 |
| BX017-Atto 550-RX017 | Akoya Biosciences | Cat#5250001 |
| BX027-Cy5-RX027 | Akoya Biosciences | Cat#5350004 |
| BX042-Cy5-RX042 | Akoya Biosciences | Cat#5350008 |
| 7-AAD | Biolegend | Cat#420404 |
| Trizol LS | Life Technologies | Cat#10296010 |
| Trizol | Life Technologies | Cat#15596018 |
| D(+)-SUCROSE | Fisher Scientific | Cat#AC177140010 |
| PARAFORMALDEHYDE 32% SOL. EM GRADE | VWR | Cat#100496–496 |
| 16% Paraformaldehyde Aqueous Solution, EM Grade | Fisher Scientific | Cat#50–980-487 |
| FB OCT COMPOUND CLEAR 4OZ | Fisher Scientific | Cat#23730571 |
| Normal Mouse Serum | Jackson ImmunoResearch Laboratories | Cat#015–000-120 |
| Avidin/Biotin Blocking System | BioLegend | Cat#927301 |
| ProLong Diamond Antifade Mountant | Life Technologies | Cat#P36961 |
| Doxycycline hyclate | Biogems | Cat#2431450 |
| Poly-L-lysine solution | Sigma Aldrich | Cat# P8920–500ML |
| 2-NBDG | VWR | Cat#76021–666 |
| Recombinant Murine Flt3-Ligand | VWR | Cat#10780–338 |
| Lipopolysaccharides from Escherichia coli O111:B4 γ-irradiated |
Sigma Aldrich | Cat#L4391–1MG |
| Poly I:C | Invitrogen | Cat#tlrl-pic |
| Pierce RIPA Buffer | VWR | Cat#PI89900 |
| NuPAGE Sample Reducing Agent | Life Technologies | Cat#NP0009 |
| Novex 4–20% Tris-Glycine gels | Life Technologies | Cat#P04205BOX |
| Nitrocellulose Sandwiches | Cell Signaling Technology | Cat#12369P2 |
|
| ||
| Critical commercial assays | ||
|
| ||
| QIAprep Spin Miniprep Kit | Qiagen | Cat#27106 |
| EndoFree Plasmid Maxi Kit | Qiagen | Cat#12362 |
| miRNeasy Micro Kit | Qiagen | Cat#217084 |
| SF Cell Line 4D-NucleofectorTM X Kit S | Lonza | Cat#V4XC-2032 |
| EasySep™ Mouse CD8+ T Cell Isolation Kit | StemCell | Cat#19853 |
| QIAquick PCR Purification Kit | Qiagen | Cat#28104 |
| QIAquick Gel Extraction Kit | Qiagen | Cat#28706 |
| Hypoxyprobe-Biotin Kit | Hypoxyrprobe | Cat#HP10–1000kit |
| EdU-Click 647 | BaseClick | Cat#BCK-EdU647 |
| CODEX Staining Kit | Akoya Biosciences | Cat#7000008 |
| CODEX Conjugation Kit | Akoya Biosciences | Cat#7000009 |
|
| ||
| Deposited data | ||
|
| ||
| Sequencing datasets | This paper | Available at NCBI accession # GSE198715 |
|
| ||
| Experimental models: Cell lines | ||
|
| ||
| 4T07 | Dr. Robert Weinberg, MIT | N/A |
| D2A1 | Dr. Robert Weinberg, MIT | N/A |
| EMT6 | ATCC | Cat#CRL-2755™ |
| Hek293:Lenti-X™ 293T Cell Line | Takara | Cat#632180 |
|
| ||
| Experimental models: Organisms/strains | ||
|
| ||
| Mouse: Balb/c :BALB/cJ | The Jackson Laboratory | Strain #:000651 |
| Mouse: NSG: NOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ | The Jackson Laboratory | Strain #:005557 |
| Mouse: Jedi: Ptprca TcrbLn1Bdb TcraLn1Bdb H2d/J | Dr. Brian Brown laboratory, Mount Sinai | N/A |
| Mouse:PD1-/-:B6.Cg-Pdcd1tm1.1Shr/J | The Jackson Laboratory | Strain #:028276 |
| Mouse:B6:C57BL/6J | The Jackson Laboratory | Strain #:000664 |
| Mouse:Kaede:Kaede | Dr. Osami Kanagawa, University of Lyon | N/A |
|
| ||
| Oligonucleotides | ||
|
| ||
| Alt-R® CRISPR-Cas9 tracrRNA | IDT | Cat#1072533 |
| Hifla gRNA: AGTGCACCCTAACAAGCCGG | IDT | Alt-R® CRISPR-Cas9 crRNA |
| Ifnarl gRNA: GCTCGCTGTCGTGGGCGCGG | IDT | Alt-R® CRISPR-Cas9 crRNA |
|
| ||
| Recombinant DNA | ||
|
| ||
| 3rd Generation Lentiviral packaging vectors | Dr. Brian Brown, Mount Sinai | N/A |
| PGK:eGFP Lentiviral vector | Dr. Brian Brown, Mount Sinai | N/A |
| mVenus:p27k reporter | Dr. Toshio Kitamura, University of Tokyo | N/A |
| PGK:mCherry Lentiviral vector | Dr. Brian Brown, Mount Sinai | N/A |
| H2B-mCherry | Addgene | Cat#51007 |
| H2B-tdTomato | Addgene | Cat#58101 |
| rtTA | Addgene | Cat#104543 |
| TetON lentiviral expression vector | Addgene | Cat#131687 |
| Hifla STBL: mHif-1α MYC (P402A/P577A/N813A) | Addgene | Cat#44028 |
|
| ||
| Software and algorithms | ||
|
| ||
| FlowJo 10 | BD | https://www.flowjo.com |
| Prism 9 | GraphPad | https://www.graphpad.com/scientific-software/prism/ |
| FiJi® (v2.0.0-rc-69/1.52i) | ImageJ | https://imagej.net/software/fiji/ |
| Seurat | Satija Lab | https://satijalab.org/seurat/articles/pbmc3k_tutorial.html |
| DESeq2 | Bioconductor | https://bioconductor.org/packages/release/bioc/html/DESeq2.html |
| Akoya CODEX Processor® | Akoya | https://www.akoyabio.com/phenocycler/software/ |
| clusterProfiler | Bioconductor | https://bioconductor.org/packages/release/bioc/html/clusterProfiler.html |
| bigSCale2 | Iacono et al. (2019) | https://github.com/iaconogi/bigSCale2 |
| Benchling | Benchling | ttps://www.benchling.com |
| Biorender | Biorender | https://biorender.com/ |
|
| ||
| Other | ||
|
| ||
| Compresstome® | Precisionary | VF-310–0Z |