REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Rabbit Polyclonal LAMP1 antibody	Abcam	Cat ab24170; RRID: AB_775978_775978
Rabbit Polyclonal CLIMP63 antibody	Proteintech	Cat 16686-1-AP; RRID: AB_2276275
Mouse Monoclonal antibody HA.11	BioLegend	Cat 901501; RRID: AB_2565006
Rat Monoclonal antibody LAMP1 Antibody 1D4B	Santa Cruz Biotechnology	Cat sc-19992; RRID: AB_2134495
Rabbit Polyclonal REEP5 antibody	Proteintech	Cat14643-1-AP;AB_2178440
Rabbit Polyclonal CALNEXIN antibody	Enzo Life Sciences	Cat ADI-SPA-860-D; RRID: AB_2038898
Mouse Monoclonal antibody Flag-M2	Sigma-Aldrich	Cat F1804; RRID: AB_262044
Mouse TFEB Monoclonal Antibody	MyBioSource	Cat MBS120432; RRID: AB_2271743
Rabbit Polyclonal TFE3 antibody	Sigma-Aldrich	Cat HPA023881; RRID: AB_1857931
Rabbit Polyclonal TFE3 antibody	Cell Signaling	Cat #14779; RRID: AB_2687582
Rabbit Monoclonal mTOR (7C10) Antibody	Cell Signaling	Cat #2983; RRID: AB_2105622
Rabbit Monoclonal phospho-p70 S6 Kinase (Thr389) (108D2) Antibody	Cell Signaling	Cat #9234S; RRID: AB_2269803
Rabbit Polyclonal p70 S6 Kinase Antibody	Cell Signaling	Cat #9202S; RRID:AB_331676
Rabbit Monoclonal phospho-ULK1 (Ser757) (D7O6U) Antibody	Cell Signaling	Cat #14202; RRID: AB_2665508
Rabbit Monoclonal ULK1 (D9D7) Antibody	Cell Signaling	Cat #6439; RRID:AB_11178933
Mouse Monoclonal monomeric Keima-Red Antibody	MBL Life Science	Cat M126-3M; RRID: AB_10210643
Rabbit Polyclonal FAM134B Antibody	Sigma-Aldrich	Cat HPA012077; RRID: AB_2668621
Rabbit Polyclonal FAM134C Antibody	Sigma-Aldrich	Cat HPA016492; RRID: AB_1853027
Mouse Monoclonal anti-beta-Actin Antibody (AC-15)	Novus Biologicals	Cat NB600-501; RRID: AB_10077656
Rabbit Polyclonal FILAMIN A Antibody	Cell Signaling	Cat #4762; RRID: AB_2106408
Mouse Monoclonal Vinculin A Antibody	Sigma-Aldrich	Cat V9264; RRID: AB_10603627
Rabbit Polyclonal SESTRIN2 Antibody	Proteintech	Cat 10795-1-AP; RRID: AB_2185489
Rabbit Polyclonal phosho-TFEB S142 Antibody	EMD Millipore	Cat ABE1971; RRID: AB_2928101
Rabbit Monoclonal Phospho-TFEB (Ser211) (E9S8N) antibody	Cell Signaling	Cat #37681; RRID: AB_2799117
Rabbit Polyclonal Histone-H3 Antibody	EMD Millipore	Cat 07-690; RRID:AB_417398
Rabbit Polyclonal GFP Antibody	Novus Biologicals	Cat NB600-308; RRID: AB_10003058
Mouse Monoclonal mCHERRY(1C51) Antibody	Novus Biologicals	Cat NBP1-96752; RRID: AB_11034849
Rabbit Polyclonal Alpha-1-antitrypsin Antibody	Dako	Cat A0012; RRID: AB_2335672
Mouse monoclonal alpha-1-antitrypsin 2C1 antibody	Hycult	Cat HM2289
Bacterial and virus strains
Lentiviral vector pCW57-CMV-ssRFP-GFP-KDEL	Addgene	#128257
Retroviral vector PCMVneo-mKeima-RAMP4	Di Lorenzo et al.25	https://doi.org/10.1126/sciadv.abo1215
pLJC5-Tmem192-3xHA	Addgene	#102930
pHAGE mKeima-LDHB	Gift from Stefano Santaguida. IEO, Milan, Italy	This study
pHAGE mKeima-COX8	Addgene	#131626
Chemicals, peptides, and recombinant proteins
Bafilomycin A1	Sigma-Aldrich	B1793
Torin 1	Cell Signaling	#14379
L-Leucine	Sigma-Aldrich	L8000
Fluphenazine dihydrochloride	MCE (MedChemExpress)	HY-A0081
Tetrandrine	MCE (MedChemExpress)	HY-13764
ISRIB	Sigma-Aldrich	SML0843
4u8C	Sigma-Aldrich	SML0949
PF-429242	Sigma-Aldrich	SML0667
Puromycin	Sigma-Aldrich	P9620-10ML
Doxycycline	Sigma-Aldrich	D9891-5G
Neomyin (G418)	Sigma-Aldrich	A1720
Blasticidine	Sigma-Aldrich	15205-100MG
Critical commercial assays
In-Fusion00E2 HD Cloning Kit	Takara Bio	#638920
BP Clonase Reaction Kit; LR Clonase Reaction Kit	Invitrogen	#11789020; #11791020
Lipofectamine00E4 3000 Transfection Reagent	Thermo Fisher Scientific	Cat#3000015
Lipofectamine00E4 and Plus Reagent	Thermo Fisher Scientific	Cat#15338030
Lipofectamine00E4 RNAiMax Reagent	Thermo Fisher Scientific	Cat#13778030
BCA Protein Assay	Thermo Fisher Scientific	Cat#23225
Deposited data
Transcriptome profile of RCS WT and TFEB/3 DKO cells transfected with mutant COL2A1 R789C compared to control	Tables S1, S2, and S3	GEO: GSE239527
Transcriptome profile of HeLa COL1A2 G610C transfected cells compared to control cells	Table S4	GEO: GSE239525
Genes differentially expressed genes commonly regulated in the two datasets (Superseries GSE239528 includes the two datasets)	Table S5	GEO: GSE239528
FDA-approved drugs identified as FAM134B transcriptional inducers	Table S6	Gene2drug.tigem.it
Uncropped western blot data	Mendeley Data, V1	[https://doi.org/10.17632/gg7cnt2fyd.1]
Experimental models: Cell lines
RCS: Swarm chondrosarcoma chondrocyte line	Cinque et al.23	TIGEM, Pozzuoli, Italy
RCS FAM134B KO and TFEB/TFE3 DKO	Cinque et al.23	TIGEM, Pozzuoli, Italy
U2OS shFAM134B and ATG7 KO cell lines	Khaminets et al.13	N/A
Wild-type U2OS TRex cells	Stephen Blacklow from Brigham and Women’s Hospital and Harvard Medical School,USA	N/A
Wild-type and TFEB/TFE3 DKO MEFs	Martina et al.53	N/A
HeLa stably expressing GFP-TFEB	Settembre et al.38	N/A
KICSTOR KO HEK293T	gift from David Sabatini. IOCB Prague, Czech Republic	N/A
Wild-type and SESN2 KO HEK293T	gift from Roberto Zoncu. Department of Molecular and Cellular Biology, University of California at Berkeley, USA	N/A
Experimental models: Organisms/strains
Primary osteoblasts extracted from wild type and Amish mice	From Antonella Forlino. Department of Molecular Medicine, University of Pavia, Italy	This study
Punch biopsies of the skin of FKBP14-kEDS patients	From Cecilia Giunta. Biobank of the Division of Metabolism at the Children’s Hospital, Zurich, Switzerland.	This study
Primary hepatocytes isolated from the liver of 6-week-old PiZ mice	From Pasquale Piccolo. TIGEM, Pozzuoli, Italy	This study
Oligonucleotides
siGENOME SMARTpool SiRNAs, Dharmacon Thermo Scientific, SiRNA 4Duplexes, LP_151890, G-CUSTOM-866712).	Dharmacon Thermo Scientific	This study
siRNA ON-TARGET plus human ATF4	Dharmacon Thermo Scientific	L-005125-00-0005
siRNA ON-TARGET plus human ATF6	Dharmacon Thermo Scientific	L-009917-00-0005
siRNA ON-TARGET plus human XBP1	Dharmacon Thermo Scientific	L-009552-00-0005
siRNA ON-TARGET plus human SESTRIN 2	Dharmacon Thermo Scientific	L-019134-02-0005
Primers for mutagenesis: COL1A2 G610CΔER – Fw 5′GGAATTCGTAGACATGGTGAGCAAGGGCGAGG 3’.	Eurofins genomics	This study
Primers for mutagenesis: COL2A1 R789CΔER – 5′ GTGAACCGTCAGATCCATGGCCATCATCAAGG 3′;	Eurofins genomics	This study
Primers for generation of U2OS TFEB/3 DKO: sgRNA sequence Fw – 5’ CCCAGAAGCGAGAGCTCAC 3’.	Eurofins genomics	This study
ON-TARGETplus Human ATL3 (25923) siRNA - SMARTpool, 5 nmol. ON-TARGETplus Human SEC62 (7095) siRNA - SMARTpool, 5 nmol. ON-TARGETplus Human TEX264 (51368) siRNA - SMARTpool, 5 nmol. ON-TARGETplus Human RETREG2 (79137) siRNA - SMARTpool, 5 nmol. ON-TARGETplus Human RETREG3 (162427) siRNA - SMARTpool, 5 nmol. ON-TARGETplus Human CCPG1 (9236) siRNA - SMARTpool, 5 nmol. ON-TARGETplus Human RTN3 (10313) siRNA - SMARTpool, 5 nmol.	Dharmacon-Horizon	L-010656-01-0005; L-010218-01-0005; L-010662-01-0005; L-018422-02-0005; L-01845.L-013998; L-013998-00-0005; L-020088-01-0005.
Recombinant DNA
Retroviral vector iTAP MSCV-N-FLAG-HA mKEIMA-FAM134B-PURO	This paper	N/A
Retroviral vector iTAP MSCV-N-FLAG-HA mKEIMA-FAM134C-PURO	This paper	N/A
Lentiviral vector pcW57-ssRFP-GFP- COL1A2 G610C	This paper	N/A
pHAGE ssRFP-GFP- LDHB	This paper	N/A
pcDNA3.1 3XFLAG COL1A2 G610C	This paper	N/A
Software and algorithms
Fiji-ImageJ	Java	https://imagej.nih.gov/ij/
Zen Blue software	ZEISS microscopy sotwere	https://www.zeiss.com/microscopy/en/products/software/zeiss-zen.html
Harmony software (PerkinElmer)	Harmony high-content imaging and analysis software	https://www.revvity.com/it-en/category/cellular-imaging-software
ChemiDoc-lt imaging system (Uvitec sotware)	Uvitec Alliance	https://www.uvitec.co.uk/alliance-q9-advanced/
LightCycler 480 (Roche) software	Roche diagnostics	https://diagnostics.roche.com/global/en/products/instruments/lightcycler-480-ins-445.html
BD FACSAria sotware	DB Bioscience	https://www.bdbiosciences.com/en-ca/products/instruments/flow-cytometers/research-cell-sorters/bd-facsaria-iii
QuantSeq 3′ mRNA sequencing data processing and analysis	NEGEDIA (Next Generation Diagnostic srl)	PMID: 25260700
Data visualization	Biorender	https://app.biorender.com/
Statistics	GraphPad PRISM software	https://www.graphpad.com/features
Other
FLAG-TFEB and GFP-TFEB plasmids	Settembre et al.38 TIGEM, Pozzuoli, Italy	N/A
FAM134B-HA expression plasmid	Khaminets et al.13	N/A
Wild-type and mutant COL1A2 G610C (GFP and mApple-COL1A2 G610C) plasmids	Addgene	#119826; #119827
Wild-type and mutant COL2A1 R789C	Forrester et al.8	N/A
AAT-HA and ATZ-HA plasmids	Gift from Maurizio Molinari. Faculty of Biomedical Sciences, Institute for Research in Biomedicine, Bellinzona, Switzerland	N/A
GFP-SESN2 plasmid	Addgene	#100519