Skip to main content
Poultry Science logoLink to Poultry Science
. 2024 Jul 10;103(10):104079. doi: 10.1016/j.psj.2024.104079

Isolation of Bacillus licheniformis and its protective effect on liver oxidative stress and apoptosis induced by aflatoxin B1

Wenwen Dong *,1, Mingchao Liu †,1, Bei Liu *,, Yaqing Xiao *,, Xia Liu *,, Menghao Yang *,, Xiaoyuan Yuan *, Yuxia Zhang *, Guiming Li *, Kai Meng *,2
PMCID: PMC11345652  PMID: 39098297

Abstract

Aflatoxin B1 (AFB1) is one of the most toxic mycotoxins. The use of probiotics is an effective approach to reduce aflatoxins content in foods. To find efficient bacterial species that can eliminate or detoxify AFB1, a bacterial strain S51 capable of degrading AFB1 was isolated from chicken intestine and soil samples by using a culture medium containing coumarin as the sole carbon source. Based on the results of 16S rRNA gene sequence analysis, this isolate (strain S51) was identified as Bacillus licheniformis strain QT338. Further characterization of strain S51 showed that it could degrade AFB1 by 61.3% after incubation at 30°C for 72 h. Additional studies demonstrated that S51 promoted good growth performance of the treated chickens, showed no hemolytic activity, carried few drug resistance genes, and exhibited a certain level of tolerance to acid and bile salts. Furthermore, to verify whether strain S51 exerts a protective effect on AFB1-induced liver injury in chickens and to elucidate the underlying mechanism, a chicken toxicity model was induced with AFB1 (100 μg/kg BW) and treated with S51(1×109CFU/mL) for 12 d. The results showed that S51 decreased the level of alanine transaminase, aspartate transaminase, and total bilirubin (P < 0.05); increased glutathione activity and total antioxidant capacityin the liver induced by AFB1, and decreased malondialdehyde production (P < 0.05). S51 also up-regulated the mRNA expression level of the antioxidant proteins HO-1 and Nrf2 and down-regulated the expression of the oxidation-related factor Keap1 in the Nrf2/Keap1 signaling pathway (P <0.05). S51 inhibited hepatocyte apoptosis induced by AFB1 and decreased the mRNA expression levels of the apoptosis-related genes Bax, caspase-3, caspase-9, and Cyt-C (P < 0.05). These results indicate that S51 regulates apoptosis and alleviates AFB1-induced oxidative stress in chicken liver by controlling the Nrf2/Keap1 signaling pathway.

Key words: aflatoxin B1, Bacillus licheniformis, liver oxidative stress, apoptosis

INTRODUCTION

Aflatoxin B1 (AFB1) is a secondary fungal metabolite ubiquitously found in moldy food and feed. As the most toxic aflatoxin subtypes in feed, AFB1 severely affects livestock and poultry health and causes huge economic losses (Rushing and Selim, 2019). AFB1 is classified as a Group-1 carcinogen by the International Agency for Research on Cancer because of its extremely high carcinogenicity and lack of safe dose (Huang et al., 2017). Many animals are susceptible to AFB1 toxicity, and poultry birds in particular are the most sensitive group. In poultry farming, AFB1 can cause severe organ damage, reduce production performance and feed utilization, induce immune suppression, enhance disease susceptibility, increase morbidity and mortality rates, and affect meat quality (Xu et al., 2014). Because AFB1 can induce various harmful effects on poultry husbandry, it is necessary to develop effective detoxification strategies to increase AFB1 degradation and alleviate AFB1-induced oxidative stress and cellular apoptosis in chickens.

Liver is an important detoxification center of the body and also the target organ of AFB1 metabolism and transformation. It plays a key role in defense against damage caused by external toxins. AFB1 induced oxidative stress is an important cause of liver injury (Li et al., 2021a). High levels of AFB1 can also cause fat deposition in the lever and hepatocyte apoptosis (Liu et al., 2020). The gastrointestinal tract, as an organ directly exposed to AFB1, is also susceptible to damage of its mucosal barrier function and impairment of intestinal immunity following AFB1 exposure. Previous studies have shown that probiotics can effectively degrade the active ingredient of AFB1 by acting through the hepato-enteric axis; this reduces liver damage caused by AFB1 (Wang, 2022). The portal vein facilitates the association between the gut and liver, thereby enabling transportation of substances produced by the gut microbiota to the liver. Bile secretion and antibody production in the liver also exert protective effects on the intestine. This association is characterized by a high degree of complexity and dynamics. It involves a cascade of biochemical and immunological events related to intestinal barrier permeability, cytokine release, and production of lipid metabolites (Hsu et al., 2023).

Microbial degradation is recognized as an attractive method because of its high specificity, efficiency, and environmental friendliness (Mishra and Das, 2003; Wu et al., 2009). Many species of microorganisms such as bacteria, molds, and yeasts can mitigate AFB1 toxicity though metabolic conversion or adsorption capacity. Among these microorganisms, bacteria are more useful to mitigate AFB1 toxicity because of their ability to eliminate more toxins without producing pigments in a shorter time period (Laciaková et al., 2008). Previous studies have revealed that bacteria can affect the expression of AFB1 and its related genes through enzymes and volatile organic compounds, thereby reducing the toxic damage induced by AFB1 to the animal body (Rodrigues et al., 2021.). Compared to other detoxification methods, the use of bacteria for detoxification has the advantages of zero pollution, high specificity, mildness, safety, environmental protection and probiotics effects. Notably, Bacillus has been widely used due to its high tolerance to various environmental stresses (Zhu et al., 2017). (Siahmoshteh et al., 2018) found that proteases produced by Bacillus amylolytica and Bacillus subtilis can affect fungal growth and aflatoxins production by altering the permeability of aflatoxin-producing cells and destroying cell organelles. A previous study confirmed that B. subtilis improves the liver function of broilers after AFB1-induced damage; moreover, it exerts various beneficial effects on the growth performance of chicks, provides heat resistance, and enhances the immune response (Wang et al., 2022). Other studies have also documented the detoxification of AFB1 by bacterial species such as B. subtilis and Bacillus licheniformis (Afsharmanesh et al., 2018; Rao et al., 2016). However, it remains unclear whether Bacilluscan exert a protective effect on AFB1-induced liver injury and the mechanism underlying this protective effect. In the present study, AFB1-degrading bacteria were first isolated from chicken intestines, and the screened strains were then introduced into an AFB1-induced chicken liver injury model to determine the intervention effect of AFB1-degrading strains and their molecular mechanisms. This study lays the foundation for using AFB1-degrading Bacillus species as a potential agent or feed additive to prevent and treat AFB1-induced liver injury in poultry.

MATERIALS AND METHODS

Sample Source

Thirty-three cecum samples were collected from healthy chickens of different age groups from a market in Jinan City, and 10 soil samples were collected from Huashan Lake. The weight of each sample was adjusted to 5g.

Isolation and Identification of Bacillus

The collected cecum and soil samples were placed in 50 mL LB liquid medium for enrichment and cultured for 24 h, The enriched bacterial solution was then diluted with sterile water to yield a dilution gradient of 10−4, 10−5, and 10−6. Subsequently, the diluted bacterial solution was cultured in MYP agar medium (MM8061, Coolaber, Beijing, China) at 37℃ for 24 h, and a single colony was selected for purification. Morphological characteristics of the purified bacterial isolates were observed, and the suspected Bacillus strains were selected for further culturing in a primary screening medium containing coumarin (S19187, Yuanye, Shanghai, China). The bacterial isolate showing adequate growth on the coumarin-containing primary screening medium was selected, mixed with 60% glycerol in a 1:1 ratio, and frozen at -80℃.

16S rRNA Gene Sequence Analysis

A DNA extraction kit was used to extract genomic DNA of the isolated strains, and the extracted bacterial DNA was amplified with a bacterial universal primer (27F/1492R). The PCR reaction conditions were as follows: 95℃ for 5 min; 25 cycles of 95℃ for 45 s, 60℃ for 45 s, and 72℃ for 90 s; final extension at 72℃ for 10 min. The PCR products were sent to Bgi Genomics Co., Ltd (Shenzhen, China) for sequencing, and the sequencing results were entered into the NCBI nucleic acid database for sequence comparison.

Rescreening of AFB1-degrading Strains

Single colonies were selected, inoculated in 5 mL LB liquid medium, and cultured at 37℃ with shaking at 180 rpm for 24 h. The cultured bacterial solution was then inoculated in 50 mL LB liquid medium at 5% proportion for fermentation at 37℃ with shaking at 160 rpm for 48 h. After the culturing process, 980 μL of the fermentation solution was mixed with 20 μL of AFB1 standard (5 μg/mL), and the final concentration of AFB1 was 100 ng/mL. This mixture was incubated at 37℃ with shaking at 150 rpm for 72 h in the dark. After incubation, the mixture was centrifuged at low temperature at 4000 rpm for 5 min, the supernatant was removed, and the AFB1 ELISA kit (SEKSM-0004-96T, Solarbio, Beijing, China) was used to determine AFB1 content in the bacterial supernatant. This process was repeated 3 times for each strain. For the blank control, 20 μL of AFB1 standard was added to LB medium without inoculation of the bacterial solution. AFB1 standard (≥99.8% purity, A832707; Macklin, Shanghai, China) was dissolved in DMSO to achieve a stock solution of 5 mg/mL concentration and stored at -20°C.

Bacterial Growth Curve Measurement

The bacterial isolates were inoculated in LB liquid medium at 5% proportion and cultured at 37℃ for 72 h under 180 rpm shaking condition. The absorbance value of the bacterial solution was detected by an enzyme-labeled instrument (ELX808, Biotek) every 12 h. The growth curve of the bacterial isolates was plotted with culture time and absorbance values as horizontal and vertical coordinates, respectively.

Identification of Candidate Isolates

Hemolysis Test. The safety test is the key method to evaluate whether the bacterial isolate can be used in animals. Bacterial hemolysis test is a prerequisite for the screening of strains, and strains with a positive result in the hemolysis test are is considered to pose a threat to the health of the host (Huang et al., 2021). Single colonies were selected, inoculated in 5 mL LB liquid medium, and cultured overnight at 37℃ with shaking at 170 rpm. The overnight bacterial culture was inoculated on blood agar plates, and the plates were incubated inverted at 37℃ for 24 h. After 24 h, the presence of a hemolytic ring around the bacterial colonies was observed.

Drug Sensitivity Test. The sensitivity of probiotics to antibiotics is also an important indicator to evaluate the safety of the bacterial strain. The fewer the number of resistance genes a strain carries, the less is the risk it will transfer to host animals. First, a Bacillus colony was selected from the LB plate, inoculated into LB liquid medium, and incubated overnight at 37℃; the culture density of the bacterial suspension was then adjusted to the McFarland standard turbidity of 0.5 by using sterile distilled water. Next, a sterile cotton swab was dipped into the bacterial suspension and uniformly spread on an MH agar plate, and the plate was then incubated at room temperature for 5 min. Antibiotic disks were placed on the bacterial solution-coated agar surface, and the plate was again incubated at 37℃ for 24 h. The antibacterial inhibition zone diameter was measured with vernier calipers, and the results were determined according to the NCCLS guidelines.

Preparation of Bacterial Suspension for Tolerance Test. Single colonies were selected and inoculated into LB liquid medium. The medium was then incubated at 37℃ for overnight culture at 180 rpm.

Bile Salt Tolerance Test. The ability of probiotics to tolerate acids and bile salts in the gastrointestinal tract directly affects their survival probability in animals. The pH value of the gastrointestinal tract of animals is 1.5∼4. After entering the body, probiotics first stay in the stomach for 3 h. After digestion by stomach acid, probiotics then enter the small intestine, where the bile salt in the small intestine forms a highly permeable environment that changes the permeability of the outer cell membrane, thus inducing a bactericidal effect. The ability to survive in the harsh environment of the stomach and small intestine is a critical property required by probiotics to achieve their desired effect. For this test, 107CFU/mL of the bacterial isolate was inoculated into sterile LB liquid medium with 0.1%, 0.2%, and 0.3% bile salt and incubated at 37℃ for 3 h. Next, 100 μL of the bacterial solution was taken, diluted to 10−3 and 10−4, and incubated at 37℃ for 24 h to determine the viable bacteria count.Survival rate (%) = No. of viable bacteria after 3 h/ No. of viable bacteria after 0 h×100.

Acid Resistance Test. For this test, 107CFU/mL of the bacterial isolate was inoculated into sterile LB liquid medium with pH 1, 2, 3, and 4, and the medium was then incubated at 37℃ for 3 h. Next, 100 μL of the bacterial solution was taken, diluted to 10−3 and 10−4, and incubated at 37℃ for 24 h to determine the viable bacteria count.

Animal Grouping and Diet Details

A total of 500, 1-day-old male commercial Arbor Acres (AA) broilers were selected from a farm in Jinan City. After 7 d of routine feeding, chicks with a similar body weight were randomly assigned to 4 treatment groups as follows: control group, AFB1 group, AFB1+S51 group, and S51 group, with 5 replicates in each group and 25 chickens in each replicate. The feeding dose was according to the pre-experimental AFB1 poisoning model. The control group was administered 0.5mL normal saline +0.5mL of 2% DMSO in normal saline, the AFB1 group was fed with 100 μg/kg BW AFB1+0.5mL normal saline, and the AFB1+S51 group was fed with 100 μg/kg BW AFB1+0.5mL bacterial solution with the density of 1×109 cells/mL. The S51 group was intragastrically administered 0.5 mL of the bacterial solution with the density of 1×109 cells/mL. AFB1 was dissolved in 2%DMSO. During this experiment, all the chickens were allowed free access to food and water. Room temperature was set to 34°C±2°C for the first wk and gradually reduced to 23°C±2°C. The daily light gradually decreased with the age until 18 h. The weight and feed intake of chickens were recorded every 2 d. Serum and liver of chickens were collected at the beginning of the experiment on d 2, 6, 10, and 12.

Sample Collection

On the 2nd, 6th, 10th, and 12th day, 3 chickens were randomly selected from each group, weighed, and euthanized, and blood samples were collected from their heart. The serum was separated and stored at -80°C until further analysis. After blood collection, the chickens were dissected, and whole liver tissues were isolated immediately and washed in PBS (pH =7.2). The liver was cut into small pieces for histological observation. Residual liver tissues were stored at -80°C for further analysis and RNA extraction. The fasting body weight of broilers was measured every 2 d after the experiment, and the growth performance was measured before feeding. The average body weight (AW) was calculated as total body weight/number of chickens tested. The liver was immediately surgically removed and weighed, and the liver coefficient index was calculated. Liver index (g/kg) = immune organ weight/ body weight.

Serum Concentration Determinations

The serum concentrations of alanine transaminase (ALT), aspartate transaminase (AST), bilirubin (TBIL), malondialdehyde (MDA), and glutathione (GSH) and the total antioxidant capacity (T-AOC) were determined using commercially available ELISA kits (Jiancheng, Nanjing, China).

Histological Analysis

For histological analysis, the liver samples were fixed with 4% paraformaldehyde. The samples were then embedded in paraffin, cut into 5-µm-thick sections, and stained with hematoxylin and eosin (H&E) as described previously (Gao et al., 2018).

The slides were observed with an optical microscope (Nikon, Japan) under 50× magnification. The images were collected by Image-Pro Plus 5.2. software, and all the parameters were consistent throughout the process.

TUNEL Staining

Apoptosis was detected by TUNEL staining of the paraffin-embedded sections. The sections were routinely dewaxed, repaired with proteinase K, and washed with PBS. Subsequently, the sections were incubated with the fluorescent TUNEL assay solution. DAPI solution (G1012, Servicebio,) was then added to stain the nuclei, and the sections were mounted with antifade coverslips. Finally, the sections were observed with a fluorescence microscope (Nikon Eclipse, C1, Japan). Three fields of view were randomly selected for each sample for observing hepatocyte apoptosis. The apoptosis rate (%)= No. of apoptotic cells/Total No.×100.

Total RNA Extraction and Quantitative Real-Time Polymerase Chain Reaction

Total RNA was prepared from liver tissues by using TRIzol reagent (Takara, Dalian, China). RNA was reverse transcribed into cDNA by using the PrimeScript RT Reagent Kit with a gDNA eraser (Takara) in accordance with the manufacturer's instructions. The synthesized cDNA was used for quantitative real-time polymerase chain reaction (qRT-PCR, Quant Studio™5, Thermo Fisher Scientific, Carlsbad, CA) with SYBR®Green PCR Master Mix. PCR was performed on a StepOnePlus Real-Time PCR System. The conditions were as follows: 95°C for 30 s, 40 cycles of 95°C for 10 s, 60°C for 30 s. The relative expression levels of the genes were calculated using the 2−∆∆Ct approach. All synthesized primer sequences are summarized in Table 1. β-Actin was used as an internal standard for data analysis and normalization.

Table 1.

Sequences of the primers used for quantitative real-time PCR.

Gene Forward primer (5ʹ–3ʹ) Reverse primer (5ʹ–3ʹ)
Bax GTGATGGCATGGGACATAGCTC TGGCGTAGACCTTGCGGATAA
Bcl-2 GATGACCGAGTACCTGAACC CAGGAGAAATCGAACAAAGGC
Cyt-C TTGGCATCTTCCACCATAAGTCTTC GCACCACAACACCCAGAACTG
Caspase-9 ATTCCTTTCCAGGCTCCATC CACTCACCTTGTCCCTCCAG
Caspase-3 GGCTCCTGGTTTATTCAGTCTC ATTCTGCCACTCTGCGATTT
Nrf-2 GAGCCCATGGCCTTTCCTAT CACAGAGGCCCTGACTCAAA
Keap-1 CAGCAGCGTGGAGAGGTATGAG CGGCGTACAGCAGTCGGTTC
HO-1 AGCTTCGCACAAGGAGTGTT GGAGAGGTGGTCAGCATGTC
β-actin GCCAACAGAGAGAAGATGACAC GTAACACCATCACCAGAGTCCA

Bax:BCL2 associated X;Bcl-2:BCL2 Apoptosis Regulator; Cyt-C: Canadian Youth Talent Competition;Nrf-2:NFE2 Like BZIP Transcription Factor 2;Keap-1:Kelch Like ECH Associated Protein 1;HO-1: Heme Oxygenase-1.

Statistical Analysis

All experiments were repeated at least 3 times to ensure accuracy and reproducibility. Statistical analyses were performed using SPSS Statistics software (version 26.0; SPSS Inc., Chicago, IL). The data were expressed as mean ± SD, and inter-group mean values were compared using 1-way analysis. SPSS 19.0 (SPSS Inc., Chicago, IL) was used for statistical analysis. P < 0.05 was considered statistically significant, and P < 0.01 was considered to have greater statistical significance.

RESULTS

Isolation and Identification of AFB1-Degrading Bacteria

Seventy-three bacterial strains were isolated using MYP medium. Morphologically, the selected bacterial colonies were white and slightly tall; they had a rough surface and were folded. Individual colonies were round and 3 to 4 mm in diameter (Figure 1A). The cells were gram-positive, rod-shaped with thick and round ends (Figure 1B). Twenty-seven strains were preliminarily determined to belong to Bacillus. The hemolysis experiment showed that 5 strains, namely T1-1, D23-2, N2-6-2, D23-2, and Z5-1, exhibited hemolytic activity (Figure 1C). The chemical structure of coumarin was similar to AFB1. After primary screening with coumarin as the carbon source and secondary screening with 5 µg/mL AFB1 in LB medium, 4 strains showed AFB1-degrading activity after 72 h of incubation (Figure 1D). Among these 4 strains, the strain S51 isolated from chicken intestines exhibited the highest degradation ability of 61.03%.

Figure 1.

Figure 1

Characteristics of some Bacillus strains and their efficiency in degrading AFB1. (A) Morphology of strains cultured on MYP medium for 24 h. (B) Gram staining of Bacillus. (C) Hemolytic activity of the strain. (D) Effect of co-culture time on the efficiency of AFB1 degradation (2.5 µg/mL).

Table 2 shows the 16S rRNA sequence analysis results for the screened bacteria. A comparison between the sequenced results and the NCBI database sequences revealed 10 strains of B.licheniformis, 2 strains of B. subtilis, and 3 strains each of Bacillus cereus, Bacillus bellescens, Bacillus pumilus, Bacillus fungoides, Bacillus thuringiensis, and Bacillus pseudomycoides (Table 2). Based on the morphological characteristics, the AFB1 degradation rate in the primary screening analysis, and the results of the hemolytic test and the 16S rRNA gene sequencing analysis, 3 strains, namely S51, S48, and S8-2, were finally selected as candidate bacterial strains for the subsequent tests.

Table 2.

Results of 16srRNA gene sequencing analysis.

Strain number Source Bacterial species Similarity GenBank accession number
D23-2 cecum Bacillus velezensis strain SF334 100.00 CP125289.1
T1-1 soil Bacillus cereusstrain Y3 99.16 MW205818.1
T1-2 soil Bacillus pumilusstrain BPR1 99.93 MF000303.1
T2-1 soil Bacillus mycoidesstrain LZH-X41 99.79 KY049894.1
N2-6-2 soil Bacillus thuringiensisstrain NBAIR_Bt213 99.47 OQ976901.1
N2-2 soil Bacillus subtilis strain NC16 99.72 MH100679.1
Z2-1 soil Bacillus cereus strainATCC14579T.52 99.65 MN543842.1
Z5-1 soil Bacillus pseudomycoides strain AB-CSL9 99.93 MG780243.1
S2-2 cloacal swab Bacillus licheniformis strain NB45 100.00 MT534569.1
S4-2 cloacal swab Bacillus licheniformis strain CICC10181 100.00 AY842871.1
S5-2 cloacal swab Bacillus licheniformis strain YWO1-12 100.00 MT368012.1
S8-2 cloacal swab Bacillus licheniformis strain K3 99.93 KU922431.1
S545 cloacal swab Bacillus subtilis strain DE-7 99.93 MT240918.1
S15 cloacal swab Bacillus cereus strain BC-2 100.00 KF835391.1
S36 cloacal swab Bacillus licheniformis strain R-QL-77-10 100.00 MT078630.1
S40 cloacal swab Bacillus licheniformis strain QT331 99.64 MT043736.1
S41 cloacal swab Bacillus licheniformis strain MPF38 99.86 MT487681.1
S45 cloacal swab Bacillus licheniformis strain QT201 100.00 MT072145.1
S48 cloacal swab Bacillus licheniformis strain NB45 99.86 MT534569.1
S51 cloacal swab Bacillus licheniformis strain QT338 100.00 MT043735.1

Safety Test of AFB1-Degrading Bacteria

The results of the drug susceptibility test showed that strains S51, S48, and S8-2 were sensitive to gentamicin, doxycycline, vancomycin, and ciprofloxacin; resistant to penicillin G, azithromycin, and clindamycin; and moderately sensitive to rifampicin (Table 3). The tolerance of these strains to different pH solutions is shown in Figure 2A. The survival rate of these strains increased with the increase in pH; furthermore, the tolerance of strain S51 to different pH solutions was significantly higher than that of the other 2 strains. The survival rates of strain S51 at pH1 and 4 were 26.06% and 64.12%, respectively. The results of the bile salt tolerance test showed that bile salt inhibited the growth of all 3 Bacillus strains. The survival rates of the strains decreased with the increase in the final concentration of bile salt. The S48 strain showed the lowest tolerance to bile salt, and its survival rates were 32.05% and 22.26% at 0.1% and 0.3% bile salt concentration, respectively. The S51 strain showed the highest tolerance of 51.54% at 0.1% bile salt concentration, while the S8-2 strain showed the highest tolerance of 46.22% at 0.2% bile salt concentration(Figure 2B).The OD630 values of the strains S51, S48, and S8-2 were measured by a UV spectrophotometer every 12 h. The results showed that the 3 strains reached the stable growth stage in 24 h, and the strain S51 showed the fastest growth rate (Figure 2C).

Table 3.

Results of drug sensitivity tests.

Sensitivity
Drug category Drug name Drug content S48 S51 S8-2
Penicillins Penicillin G 10 U R R R
Oxacillin 1 μg S I I
Aminoglycosides Gentamicin 10 μg S S S
Tetracyclines Tetracycline 30 μg S I I
Doxycycline 30 μg S S S
Macrolides Azithromycin 15 μg R R R
Polypeptides Vancomycin 30 μg S S S
Lincosamides Clindamycin 2 μg R R R
Diaminopyrimidine Trimethoprim 5 μg S S I
Rifomycins Rifampin 5 μg I I I
Amphenicols Chloramphenicol 30 μg S I I
Quinolones Ciprofloxacin 5 μg S S S

R: resistant; I: intermediary; S: sensitive.

Figure 2.

Figure 2

Growth characteristics of Bacillus licheniformis and the effects of different conditions on AFB1 degradation. (A) Effect of pH on AFB1 degradation by B. licheniformis. (B) Effect of bile salt concentration on AFB1 degradation by B. licheniformis. (C) Comparison of the growth curves of different B. licheniformis strains.

In summary, B.licheniensis strain S51 with a high AFB1 degradation rate was finally isolated from the cloacal swab of chickens after primary screening and rescreening. The AFB1 degradation rate of this strain was 61.03%; furthermore, this strain promoted good growth performance of the treated chickens, had no hemolytic activity, carried few drug resistance genes, and exhibited a certain level of tolerance to acid and bile salts. Subsequently, the S51 strain was screened to study the mechanism of alleviating liver oxidative stress and cell apoptosis induced by AFB1.

S51 Alleviates Growth Retardation and Liver Index Reduction in AFB1-Treated Chickens

AFB1 at 100 μg/kg BW dose was administered to chicks through gavage, and the chicks were fed diet containing S51 to assess their growth performance (Table 4). As shown in the table, no significant difference was observed in the initial weight of the chicks selected for the experiment. After 12 d of gavage, chickens in the S51 and control groups showed no significant difference in their body weight. Following continuous gavage of AFB1 for 10 d, the body weight of the AFB1 group chicks was significantly lower than that of the control group chicks (P < 0.05). Furthermore, compared to the AFB1 group chicks, the body weight of the AFB1+S51 group chicks was significantly increased (P < 0.05); however, the difference was not significant when compared with the control group chicks. As shown in Table 4, after 10 d of continuous gavage of AFB1, the feed weight of chicks in the AFB1 group was significantly higher than that in the control group (P < 0.05). Compared to the AFB1 group, chicks in the AFB1+S51 group showed an improvement in the feed-to-gain ratio (P < 0.05), with no significant difference when compared with the control group. Additionally, the control and S51 groups showed no significant differences in the average body weight and feed-to-gain ratio during the entire experimental period (P > 0.05). Organ coefficient is a commonly used index in toxicology. Changes in organ coefficient occur following damage to animal organs. Table 5 shows the results of determination the liver coefficient of chicks in the control and experimental groups. As shown in the table, after the 10th d of continuous gavage of AFB1, the liver coefficient of chicks in the AFB1 group significantly increased (P < 0.05), while the addition of S51 alleviated liver enlargement caused by AFB1.

Table 4.

Growth performance of broilers treated with AFB1 and S51.

Items D Group
Control AFB1 AFB1+ S51 S51
AW(g) 2 208.25 ± 4.52 203.59 ± 5.67 206.01 ± 3.54 208.35 ± 3.32
4 272.42 ± 13.02 258.41 ± 3.97 260.70 ± 5.85 271.06 ± 11.13
6 341.35 ± 14.62 325.68 ± 8.21 335.61 ± 12.84 342.14 ± 10.97
8 418.88 ± 10.95ab 391.44 ± 8.60c 411.58 ± 7.13b 426.72 ± 9.37a
10 543.50 ± 12.94ab 494.14 ± 10.58c 539.69 ± 9.81b 558.19 ± 14.69a
12 630.34 ± 10.31a 562.66 ± 13.12b 618.24 ± 18.05a 640.03 ± 19.36a
F/G 2 1.40 ± 0.05 1.41 ± 0.05 1.41 ± 0.04 1.38 ± 0.07
4 1.31 ± 0.10 1.35 ± 0.09 1.30 ± 0.06 1.31 ± 0.10
6 1.34 ± 0.07 1.39 ± 0.10 1.35 ± 0.09 1.32 ± 0.07
8 1.26 ± 0.07b 1.41 ± 0.12a 1.31 ± 0.06ab 1.29 ± 0.04b
10 1.21 ± 0.06b 1.43 ± 0.12a 1.22 ± 0.03b 1.20 ± 0.06b
12 1.07 ± 0.07c 1.39 ± 0.11a 1.19 ± 0.04b 1.04 ± 0.10c

Different letter superscripts indicate significant differences (P < 0.05). Data are expressed as mean percentage ± SD.

Table 5.

Liver coefficient of broilers in each group.

Group Liver index(%)
2 d 6 d 10 d 12 d
Control 3.61 ± 0.39 3.17 ± 0.18 2.88 ± 0.21ab 2.59 ± 0.15c
AFB1 3.79 ± 0.28 3.27 ± 0.14 3.11 ± 0.11a 3.06 ± 0.12a
AFB1+S51 3.80 ± 0.23 3.11 ± 0.12 2.72 ± 0.15b 2.79 ± 0.10b
S51 3.61 ± 0.15 3.05 ± 0.18 2.82 ± 0.23b 2.69 ± 0.18bc

Different letter superscripts indicate significant differences (P < 0.05). Data are expressed as mean percentage ± SD.

Histopathological Analysis and Serum Biochemistry Results

A histopathological analysis was performed to clarify the protective effects of S51 against AFB1-induced damage in liver tissues. The results (Figure 3A) revealed no liver lesions in the control and S51 groups, with complete liver tissue structure, clear liver lobules, large and round nuclei, and visible liver cell cords. AFB1-treated chickens showed disordered liver lobules, inconspicuous hepatocyte cords, necrosis and rupture of hepatocytes, loss of cellular structures, and some degree of congestion in the portal vein bundles. Compared to the AFB1-treated group, S51 addition to the diet significantly ameliorated and restored AFB1-induced liver injury. These results indicated that S51 could protect the structural integrity of chicken liver and inhibit AFB1-induced liver injury.

Figure 3.

Figure 3

(A) Effects of Bacillus licheniformis S51 on the liver morphological structure of AFB1-treated chickens (scale bar = 50 µm). Hepatic lobule and cell structure were normal in the control and S51 groups. The AFB1 group showed inflammatory infiltration, intrahepatic hemorrhage, and vacuolar degeneration of hepatocytes. The AFB1+S51 group exhibited recovery of hepatic lobule and cell structure affected by AFB1.(B) Effects of S51 on the serum ALT, AST, and TBIL levels in AFB1-treated chickens. The chickens were assigned to the control group, AFB1 group (100 μg/kg BW feed), AFB1+S51 group (100 μg/kg BW feed +0.5 mL of 1×109 cells/mL S51 bacterial solution), and S51 group (0.5 mL of 1×109 cells/mL S51 bacterial solution).All values are expressed as mean ± SD of 3 independent experiments.

Liver enzymes such as ALT and AST, and TBIL, a yellow pigment found in bile and processed in the liver, are released into the bloodstream, and the serum levels of these proteins are useful markers for detecting the degree of hepatic injury caused by AFB1. As shown in Figure 3B, ALT and AST levels showed no significant differences among all groups in 6 d before the start of the experiment (P > 0.05).The serum total TBIL level in the AFB1 group began to increase significantly on the sixth d of the experiment. Starting from d 10, ALT and ASL levels in the AFB1 group were significantly higher than those in the other groups (P < 0.05). On d 10 of the experiment, compared to the AFB1 group, the AFB1+S51 group showed significantly decreased ALT and AST levels (P < 0.05) and significantly decreased TBIL levels (P < 0.05). With the progression of treatment time, all 3 indices showed a trend of significant decrease (P < 0.05). These results suggest that AFB1-induced liver injury is severe, which is consistent with liver pathological findings, and that treatment with S51 can reduce the toxic effects of AFB1 on liver function.

Effect of S51 on Antioxidant Activities in Chicken Liver Tissues

To assess the antioxidant capacity of S51 in experimental chickens, we measured the levels of MDA, GSH, and T-AOC (Figure 4A). After 2 d, the GSH and T-AOC levels in the AFB1-treated group were significantly lower than those in the control group (P < 0.05). The MDA level in the AFB1-treated group was significantly increased (P < 0.05). Starting from day 6 of the experiment, compared to the AFB1-treated group, S51 supplementation significantly increased the levels of GSH and T-AOC and decreased the MDA level (P < 0.05). Furthermore, compared to the control group, treatment with S51 alone had no significant effects on MDA, GSH, and T-AOC levels. These results indicate that dietary S51 can inhibit oxidative stress in liver tissues.

Figure 4.

Figure 4

Effects of Bacillus licheniformis S51 on AFB1-induced oxidative stress in chicken liver through the regulation of the Nrf2/Keap1 signaling pathway. The levels of MDA, GSH, and T-AOC (A) and the mRNA expression levels of HO-1, Nrf2, and Keap1 (B) were determined. Data are expressed as mean ± SD for n = 25. P < 0.05.

Effect of S51 on Nrf2 and mRNA and Protein Expression Levels of Its Downstream Antioxidant-Related Genes

The Nrf2 signaling pathway protects cells from AFB1-induced oxidative damage and toxic insult in the liver of chickens. AFB1 activates reactive oxygen species (ROS) production in broiler liver, resulting in oxidative stress by affecting the Nrf2 signaling pathway. To further investigate the effect of S51 on the antioxidative mechanism in AFB1-induced chicken livers, we studied the mRNA expression levels of the key factors HO-1, Nrf2, and Keap1 in the Nrf2/Keap1 pathway. Compared to the normal group, the AFB1 group showed a significant decrease in the mRNA expression levels of HO-1 and Nrf2 (P < 0.05) and a significant increase in the mRNA expression levels of Keap1 (P < 0.05) (Figure 4B). Furthermore, compared to the AFB1 group, the AFB1-S51 group showed a significant increase in the mRNA expression levels of HO-1 and Nrf2 (P < 0.05) and a significant decrease in the mRNA expression level of Keap1 (P < 0.05) (Figure 4B). These results revealed that S51 prevented oxidative stress in part because of its effect on the Nrf2/Keap-1 pathway.

S51 Effectively Inhibited AFB1-Induced Hepatic Apoptosis in Chickens

TUNEL assay was performed to determine the protective role of S51 against AFB1-induced apoptosis in liver tissues. As shown in Figure 5, the groups exhibited no significant difference in the liver apoptosis index at 6 d before the test. On d 10, the number of apoptotic cells increased significantly in the AFB1 group as compared to that in the control and S51 groups. After 10 d of continuous treatment with S51, the number of cells with positive staining was effectively reduced. Moreover, the number of apoptotic cells increased with the increase in AFB1 feeding time. Figure 6 shows the mRNA expression levels of the apoptosis-related genes. Compared to the control group, the mRNA expression levels of Bcl-2, caspase-3, caspase-9, and Cyt-C in the AFB1 group were significantly increased (P < 0.05) on the 10th d of treatment. The mRNA expression level of the antiapoptotic gene Bcl-2 was significantly decreased (P < 0.05), while that of Bax was significantly increased in AFB1 cells on the 12th d (P < 0.05). After 10 to 12 d of continuous treatment with S51, compared to the AFB1 group, S51 intervention significantly decreased the mRNA expression levels of caspase-3, caspase-9, Cyt-C, and Bax (P < 0.05) and significantly increased the mRNA expression level of Bcl-2 (P < 0.05). These results indicate that S51 can effectively inhibit the apoptosis of chicken liver tissue cells induced by AFB1.

Figure 5.

Figure 5

Effect of Bacillus licheniformis S51 on the apoptosis of chicken hepatocytes induced by AFB1. Apoptosis of liver tissue cells based on terminal deoxynucleotide transferase (TUNEL) assay at d 2, 6, 10, and 12 was detected by immunofluorescence. DAPI-stained nucleus, blue; TUNEL-stained apoptosis-positive cells, green.

Figure 6.

Figure 6

Determination of the mRNA expression level of the apoptosis-related genes. Real-time fluorescence quantitative PCR was used to detect the mRNA expression levels of Bax, Bcl-2, caspase-3, caspase-9, and Cyt-C. The chickens were assigned to the control group, AFB1 group (100 μg/kg BW feed), AFB1+S51 group (100 μg/kg BW feed +0.5 mL of 1×109cells/mL S51 bacterial solution), and S51 group (0.5 mL of 1×109 cells/mL S51 bacterial solution). Data are expressed as mean ± SD (n = 25). P < 0.05.

DISCUSSION

AFB1 is the most toxic compound of the many secondary metabolites produced by fungi and poses considerable health risks to humans and animals because of its hepatotoxic, immunotoxic, carcinogenic, and teratogenic effects (Benkerroum, 2020; Zhao et al., 2021). Previous studies have shown that AFB1 can be completely degraded and neutralized by microorganisms, and the identification of these beneficial microbial species is a hot topic of research (Prettl et al., 2017; Mahunu et al., 2015). The control of aflatoxin activity by microorganisms mainly involves the inhibition of aflatoxin production, adsorption of aflatoxins, and degradation of aflatoxins (Guan et al., 2021). To date, different microbial strains with high efficiency in aflatoxin degradation have been isolated from various environmental samples, including fungi, bacteria, actinomycetes, and protozoa (Cai et al., 2020). In the present study, 73 strains were screened from chicken intestine and soil samples, and 1 strain (laboratory number S51) showed high efficiency in degrading AFB1. This strain was identified as B. licheniformis based on morphological and biochemical characteristics and phylogenetic tree analysis. The homology between strain S51 and B. licheniformis QT338 was 100%. We also established an in vivo AFB1-treated chicken model to determine the protective effects of S51 on AFB1-induced oxidative damage of chicken liver.

Bacillusis widely used in animal breeding because of its stable morphological structure, good stress resistance, and excellent probiotic effects such as immune regulation and enhancement of body's resistance to diseases (Khalaifa et al., 2020; Balta et al., 2022). Bacillus can secrete a variety of enzymes and proteins and convert AFB1 into low-toxicity or nontoxic compounds through degradation and adsorption to achieve detoxification effects. In the present study, soil, intestinal, and cloacal swab samples of chickens were collected. Following enrichment, MYP medium was used to screen for Bacillus species. By using coumarin as the sole carbon source, a rescreening process was performed (Guan et al., 2008), and 20 bacterial strains that could degrade AFB1 were finally screened. B. licheniformis was identified by 16S rRNA gene sequencing. The bacterial degradation rate of AFB1 is related to AFB1 concentration, reaction time, reaction temperature, and other conditions. Wang Kang isolated B. subtilis from moldy grains; the strain showed AFB1 degradation rates of 70.65% and 61.42% (Wang, 2020). Wang et al. (2018) isolated a B.licheniformis strain from the soil, and the AFB1 degradation rate of this strain was 89.1% in 120 h. Similar to these results, in the present study, we isolated 4 Bacillus strains, namely S51, S48, S8-2, and S45,by measuring the degradation rate of AFB1;these strains showed AFB1 degradation rates of 61.03%, 58.8%, 55.08%, and 52.58%, respectively.

The ability to survive in the harsh environment of the stomach and small intestine is one of the desirable properties for the use of probiotics (Prieto et al., 2014). The pH of the gastrointestinal tract of animals is 1.5∼4. After entering the body, probiotics first stay in the stomach for 3 h and then enter the small intestine following digestion by stomach acid. The high permeability environment formed by the bile salt in the small intestine and the bile salt concentration of 0.03% to 0.30% alter the permeability of the bacterial outer cell membrane and play a bactericidal role. The ability of probiotics to tolerate acids in the stomach and bile salts in the intestine directly affects their survival in animals. In the present study, acid resistance test and bile salt resistance test were performed on the 3 strains of B. licheniformis. The acid resistance test indicated that the strains could tolerate the strong acidic condition at pH 1. All the 3 strains survived and maintained a certain level of activity; moreover, the survival rate of B. licheniformis S51 reached more than 20%, thus indicating that it had strong acid tolerance and could overcome digestion by stomach acid. At pH4, the survival rate of S51 was more than 60%. Bile salt tolerance tests showed that B. licheniformis S51 exhibited the strongest tolerance to bile salt, with a survival rate of more than 50% at 0.1% bile salt concentration. The tolerance of B. licheniformis S51 to acid and bile salt was stronger than that of the other 2 strains; this indicated the potential of S51 as a probiotic additive.

Probiotics may function as biodegradable toxins that can act as an antioxidant by triggering the generation of enzymes, which subsequently boost immunity by enhancing protein metabolization and vitamin and mineral absorption (Koc et al., 2010). Oxidative stress plays a major role in the toxicity induced by AFB1 in broilers. Under normal physiological conditions, a dynamic balance is maintained between the oxidative and antioxidant systems of the body. Following the entry of AFB1 into the body, this balance is impaired, and free radicals are continuously accumulated, thereby inducing oxidative damage (Yang et al., 2012). The serum levels of MDA, GSH, and T-AOC are important biomarkers of the endogenous antioxidant system; these components can remove free radicals, maintain intracellular redox balance, and protect the body from oxidative damage (Damiano et al., 2021). The final lipid oxidation product produced by free radicals is MDA, and the MDA level is an important parameter that reflects the antioxidant capacity of animals (Guo et al., 2021). Mohamed et al. showed that feeding 30 μg/kg aflatoxins to rats increased the MDA level and decreased GSH and antioxidant enzyme levels, thus indicating that aflatoxins caused oxidative stress in animals (Mohamed et al., 2017).In the present study, dietary supplementation of AFB1 significantly increased the MDA level and decreased the SOD level in the liver of broilers, thus indicating that AFB1 treatment can induce oxidative stress in broiler liver; the use of S51 significantly reduced liver oxidative stress induced by AFB1.

An approach to reduce liver stress is to minimize the amount of toxins and inflammatory molecules that enter the liver through the portal vein from the intestines. Probiotics can help protect the liver from unnecessary damage by reducing the number of pathogens that produce toxins and inflammatory molecules. Many types of probiotics can enable reduction of toxin absorption by improving gut barrier function. Additionally, probiotics can promote normal bowel movements by facilitating expulsion of waste and excess hormones from the body rather than by reabsorbing and transporting them to the liver (Hizo et al., 2024). As a key transcription factor, Nrf-2 plays a crucial role in regulating drug metabolic, antioxidant, and detoxification pathways. In the oxidized state, Keap-1 acts as the primary redox sensor to release Nrf-2 from the cytoplasm, which then translocate to the nucleus and binds to nuclear receptors. Nrf-2 regulates the expression of its downstream target gene HO-1, and HO-1 catalyzes the release of free iron to induce the degradation of heme into biliverdin/bilirubin, thereby exerting antioxidant and detoxification effects. Wang found that AFB1 can induce oxidative stress and mitochondria-mediated apoptosis of hepatocytes through the Nrf-2/Keap-1 pathway (Wang et al., 2022b). In the present study, compared to the control group, the mRNA expression level of Keap-1 in the AFB1 group was significantly increased, while those of Nrf-2 and HO-1 were significantly decreased; this finding indicated that AFB1 caused oxidative damage to broiler liver through the Nrf-2/Keap-1 pathway. The mRNA expression level of Keap-1 in the AFB1+S51 group was significantly decreased, while those of Nrf-2 and HO-1 were significantly increased; these results confirmed that the strain S51 can alleviate oxidative stress induced by AFB1 on the broiler liver through the Nrf-2/Keap-1 signaling pathway.

Apoptosis, or programmed cell death, usually occurs during the process of cell development and aging, and it plays a crucial role in controlling cell number and maintaining homeostasis in multicellular organisms. The abnormal regulation of apoptosis is associated with the occurrence of many diseases. In the present study, according to the results of the TUNEL assay, the apoptosis index was significantly higher in the AFB1 group than that in the control group. However, compared to the AFB1 group, the AFB1+S51 group showed a significant decrease in the apoptosis index of liver cells. These results indicated that the B. licheniformis S51 strain alleviated AFB1-induced hepatocyte apoptosis. Mitochondrial apoptosis is regulated by the members of the Bcl-2 protein family, including the antiapoptotic protein Bcl-2 and the pro-apoptotic protein Bax (Kiraz et al., 2016). The entry of mycotoxins into animals changes the permeability of the mitochondrial inner membrane, opens mitochondrial membrane pores, and releases the pro-apoptotic protein Cyt-C from the membrane gap into the cytoplasm; Cyt-C binds to the apoptotic protease activator Apaf-1 and caspase-9, thereby activating caspase-9 and subsequently inducing the activation of caspase-3, which triggers mitochondrial-mediated apoptosis (Elmore, 2007).

Previous studies have confirmed that AFB1 can up-regulate the mRNA expression levels of Bax, caspase-9, and caspase-3 and down-regulate the mRNA expression levels of Bcl-2 to induce cell apoptosis through the mitochondrial apoptosis pathway (Nabi et al., 2022). Another study showed that Bacillus coagulans can regulate the expression of Bax, Bcl-2, and caspase-3 through the antiapoptotic pathway to resist apoptosis of mouse liver cancer cells (Zhao et al., 2023). Previous studies have also shown that Bacillus amylolyticus can alleviate AFB1-induced apoptosis of liver cells by regulating the expression of key factors of the apoptotic pathway, including Bax, Bcl-2, caspase-3, and caspase-9 (Li et al., 2021b). Consistent with the results of this study, AFB1 up-regulated the expression level of Bax mRNA; decreased the expression level of Bcl-2 mRNA; and up-regulated the mRNA expression levels of the apoptosis-related genes Cyt-C, caspase-3, and caspase-9. Following the treatment with B. licheniformis S51, the AFB1+S51 group showed a significant decrease in the mRNA expression level of Bax; a significant increase in the Bcl-2 mRNA expression level; and a significant decrease in the mRNA expression levels of the apoptosis-related genes Cyt-C, caspase-3, and caspase-9. These results indicated that B. licheniformis S51 could reduce AFB1-induced apoptosis of liver cells by regulating the expression of apoptosis-related factors.

CONCLUSIONS

B. licheniformis S51isolated and screened from chicken liver and soil samples was found to degrade AFB1. The AFB1 degradation rate of this strain was 61.03%, and it showed good growth performance of the treated chickens, had no hemolytic activity, carried few drug resistance genes, and exhibited resistance to acid and bile salts. Our results also showed that B. licheniformis S51 alleviated AFB1-induced oxidative stress in chicken primary hepatocytes by increasing superoxide dismutase and GSH activity and decreasing ROS and MDA production. The underlying mechanism of this alleviation effect was associated with the activation of the Nrf2/Keap1 signaling pathway and inhibition of hepatocyte apoptosis and autophagy through the regulation of the apoptosis- and autophagy-related genes.

DISCLOSURES

The authors declare that they have no conflict of interest.

ACKNOWLEDGMENTS

This work was supported by the Project of Natural Science Foundation of Shandong Province (ZR2021MC060), the Technology Innovation Project of Shandong Academy of Agricultural Sciences (CXGC2024D11, CXGC2024B07, CXGC2023A22, CXGC2023A10), and the Taishan Industry Experts Program (TSCX202306046).

Ethical approval: All animal experiments were performed in accordance with the Ethical Principles in Animal Research and were approved by the Committee for Ethics in Shandong Academy of Agricultural Science (approval number: SAAS-2022-G32).

REFERENCES

  1. Afsharmanesh H., Alejandro P.G., Houda Z., Masoud A., Diego R. Aflatoxin degradation by Bacillus subtilis UTB1 is based on production of an oxidoreductase involved in bacilysin biosynthesis. Food Control. 2018;94:48–55. [Google Scholar]
  2. Al-Khalaifa H., Al-Nasser A., Al-Surayee T., Al-Kandari S., Mohammed A. Effect of dietary probiotics and prebiotics on the performance of broiler chickens. Poult. Sci. 2020;98:4465–4479. doi: 10.3382/ps/pez282. [DOI] [PubMed] [Google Scholar]
  3. Balta I., Butucel E., Stef L., Pet L., Gratiela G.P., Carmen C., Ozan G.D., David M., Nicolae C. Anti-campylobacter probiotics: Latest mechanistic insights. Foodborne Pathog. Dis. 2022;19:693–703. doi: 10.1089/fpd.2022.0039. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Benkerroum N. Chronic and acute toxicities of aflatoxins: mechanisms of action. Int. J. Env. Res. Pub. He. 2020;17:423. doi: 10.3390/ijerph17020423. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Cai M.Y., Qian Y.Y., Chen N., Ling T.J., Wang J.J., Jiang H., Wang X., Qi K.Z., Zhou Y. Detoxification of aflatoxin B1 by Stenotrophomonas sp. CW117 and characterization the thermophilic degradation process. Environ. Pollut. 2020;261 doi: 10.1016/j.envpol.2020.114178. [DOI] [PubMed] [Google Scholar]
  6. Damiano S., Jarriyawattanachaikul W., Girolami F., Longobardi C., Nebbia C., Andretta E., Lauritano C., Dabbou S., Avantaggiato G., Schiavone A. Curcumin supplementation protects broiler chickens against the renal oxidative stress induced by the dietary exposure to low levels of aflatoxin B1. Front. Vet. Sci. 2021;8 doi: 10.3389/fvets.2021.822227. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Elmore S. Apoptosis: A review of programmed cell death[J] Toxicol. Pathol. 2007;35:495–516. doi: 10.1080/01926230701320337. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Gao X., Xiao Z.H., Liu M., Zhang N.Y., Khalil M.M., Gu C.Q., Qi D.S., Sun L.H. Dietary Silymarin supplementation alleviates zearalenone-induced hepatotoxicity and reproductivetoxicity in Rats. J. Nutr. 2018;148:1209–1216. doi: 10.1093/jn/nxy114. [DOI] [PubMed] [Google Scholar]
  9. Guan S., Ji C., Zhou T., Li J.X., Ma Q.G., Niu T.G. Aflatoxin B1 degradation by Stenotrophomonas maltophilia and other microbes selected using coumarin medium. Int. J. Mol. Sci. 2008;9:1489–1503. doi: 10.3390/ijms9081489. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Guan Y., Chen J., Nepovimova E., Long M., Wu W.D., Kuca K. Aflatoxin detoxification using microorganisms and enzymes. Toxins. 2021;13:46. doi: 10.3390/toxins13010046. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Guo Y., Balasubramanian B., Zhao Z.H., Liu W.C. Marine algal polysaccharides alleviate aflatoxin B1-induced bursa of Fabricius injury by regulating redox and apoptotic signaling pathway in broilers. Poult. Sci. 2021;100:844–857. doi: 10.1016/j.psj.2020.10.050. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Hizo G., Rampelotto H.P.H. The impact of probiotic Bifidobacterium on liver diseases and the microbiota. Life. 2024;14(2):239. doi: 10.3390/life14020239. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Hsu C., Schnabl L.B. The gut–liver axis and gut microbiota in health and liver disease. Nat. Rev. Microbiol. 2023;21:719–733. doi: 10.1038/s41579-023-00904-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Huang M.N., Yu W., Teoh W.W., Ardin M., Jusaku A., Ng A.W.T, Boot A., Abedi A.B., Villar S., Myint S.S., Othman R., Poon S.L., Heguy A., Olivier M., Hollstein M., Tan P., Bin T.T., Sabapathy K., Zavadil J., Rozen S.G. Genome-scale mutational signatures of aflatoxin in cells, mice, and human tumors. Genome Res. 2017;27:1475–1486. doi: 10.1101/gr.220038.116. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Huang, X., F. Ai, Chen. Ji, P. C. Tu, Y. F. Gao, Y. L. Wu, F. J. Yan, and T. Yu. 2021. A rapid screening method of candidate probiotics for inflammatory bowel diseases and the anti-inflammatory effect of the selected strain bacillus smithii XY1[J]. Front. Microbiol. 12:760385. [DOI] [PMC free article] [PubMed]
  16. Kiraz Y., Adan A., Kartal M., Yandim M.K., Baran Y. Major apoptotic mechanisms and genes involved in apoptosis. Tumor Biol. 2016;37:8471–8486. doi: 10.1007/s13277-016-5035-9. [DOI] [PubMed] [Google Scholar]
  17. Koc F., Samli H., Okur A., Ozduven M., Akyurek H., Senkoylu N. Effects of Saccharomyces cerevisiae and/or mannanoligosaccharide on performance, blood parameters and intestinal microbiota of broiler chicks. Bulg. J. Agric. Sci. 2010;16:643–650. [Google Scholar]
  18. Laciaková A., Cicoňová P., Máté D., Laciak V. Aflatoxins and possibilities for their biological detoxification. Med. Weter. 2008;64:276–279. [Google Scholar]
  19. Li S.H., Liu R.M., Wei G.Q., Guo G.F., Yu H.X., Zhang Y.X., Ishfaq M., Fazilani S.A., Zhang X.Y. Curcumin protects against Aflatoxin B1-induced liver injury in broilers via the modulation of long non-coding RNA expression. Ecotox. Environ. Safe. 2021;208 doi: 10.1016/j.ecoenv.2020.111725. [DOI] [PubMed] [Google Scholar]
  20. Li X.T., Lv Z.M., Chen J., Nepovimova E., Kuca K. Bacillus amyloliquefaciens B10 can alleviate liver apoptosis and oxidative stress induced by aflatoxin B1. Food Chem. Toxicol. 2021;151 doi: 10.1016/j.fct.2021.112124. [DOI] [PubMed] [Google Scholar]
  21. Liu X.Q., Mishra S.K., Wang T., Xu Z.X., Zhao X.L., Wang Y., Yin H.D., Fan X.L., Zeng B., Yang M.Y., Yang D., Ni Q.Y., Li Y., Zhang M.W., Zhu Q., Chen F., Li D.Y. AFB1 induced transcriptional regulation related to apoptosis and lipid metabolism in liver of chicken. Toxins. 2020;12:290. doi: 10.3390/toxins12050290. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Mahunu G.K., Zhang H., Yang Q., Li C., Zheng X. Biological control of patulin by antagonistic yeast: A case study and possible model. Crit. Rev. Microbiol. 2015;42:1. doi: 10.3109/1040841X.2015.1009823. [DOI] [PubMed] [Google Scholar]
  23. Mishra H.N., Das C. A review on biological control and metabolism of aflatoxin. Crit. Rev. Food Sci. 2003;43:245–264. doi: 10.1080/10408690390826518. [DOI] [PubMed] [Google Scholar]
  24. Mohamed S.A., Khaled M.E., Tahany A.A.A., Marwa S.K., Sara M.M. Pathological and biochemical evaluation of coumarin and chlorophyllin against aflatoxicosis in rat. Exp. Toxicol. Pathol. 2017;69:285–291. doi: 10.1016/j.etp.2017.01.014. [DOI] [PubMed] [Google Scholar]
  25. Nabi F., Tao W.L., Ye R.L., Li Z.Z., Lu Q., Shang Y.F., Hu Y., Fang J.L., Bhutto Z., Liu J. Penthorum chinense pursh extract alleviates aflatoxin B1-induced liver injury and oxidative stress through mitochondrial pathways in broilers#13. Front. Vet. Sci. 2022;9 doi: 10.3389/fvets.2022.822259. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Prettl Z., Dési E., Lepossa A., Balázs K.D., József K., Endre N. Biological degradation of aflatoxin B 1 by a rhodococcus pyridinivorans strain in by-product of bioethanol—sciencedirect. Anim. Feed Sci. Tech. 2017;224:104–114. [Google Scholar]
  27. Prieto M.L., O'sullivan L.L., Tan S.P., Mcloughlin P., Hughes H., Gutierrez M.A., Lane J., M.Hickey R., Lawlor P.G., Gardiner G.E. In vitro assessment of marine Bacillus for use as livestock probiotics. Mar. drugs. 2014;12:2422–2445. doi: 10.3390/md12052422. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Rao K.R., Vipin A.V., Hariprasad P., Appaiah K.A.A., Venkateswaran G. Biological detoxification of Aflatoxin B1 by Bacillus licheniformis CFR1. Food Control. 2016;71:234–241. [Google Scholar]
  29. Rodrigues A.I., Gudiña J.E., Abrunhosa L., Malheiro A.R., Fernandes R., Teixeira J.A., Rodrigues L.R. Rhamnolipids inhibit aflatoxins production in Aspergillus flavus by causing structural damages in the fungal hyphae and down-regulating the expression of their biosynthetic genes. Int. J. Food Microbiol. 2021;348 doi: 10.1016/j.ijfoodmicro.2021.109207. [DOI] [PubMed] [Google Scholar]
  30. Rushing B.R., Selim M.I. Aflatoxin B1: A review on metabolism, toxicity, occurrence in food, occupational exposure, and detoxification methods. Food Chem. Toxicol. 2019;124:81–100. doi: 10.1016/j.fct.2018.11.047. [DOI] [PubMed] [Google Scholar]
  31. Siahmoshteh F., Hamidi E.Z., Spadaro D., Masoomeh S.G., Mehdi R.A. Unraveling the mode of antifungal action of Bacillus subtilis and Bacillus amyloliquefaciens as potential biocontrol agents against aflatoxigenic Aspergillus parasiticus. Food Control. 2018;89:300–307. [Google Scholar]
  32. Wang J., Ishfaq M., Miao Y.S., Liu Z.Y., Hao M.T., Wang C.Y., Wang J.Q., Chen X.P. Dietary administration of Bacillus subtilis KC1 improves growth performance, immune response, heat stress tolerance, and disease resistance of broiler chickens. Poultry sci. 2022;101 doi: 10.1016/j.psj.2021.101693. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Wang K. Screening of aflatoxin-degrading bacteria and optimization of culture conditions [D] CUST. 2020 [Google Scholar]
  34. Wang Y., Wu J., Wang L., Yang P., Liu Z., Rajput S.A., Hassan M., Qi D. Epigallocatechin gallate and glutathione attenuate aflatoxin B(1)-induced acute liver injury in ducklings via mitochondria-mediated apoptosis and the Nrf2 signalling Pathway[J] Toxins. 2022;14:876. doi: 10.3390/toxins14120876. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Wang Y., Zhang H.Y., Yan H., Yin C.H., Liu Y., Xu Q.Q., Liu X.L., Zhang Z.B. Effective biodegradation of aflatoxin B1 using the Bacillus licheniformis (BL010) Strain. Toxins. 2018;10:497. doi: 10.3390/toxins10120497. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Wu Q.H., A.Jezkova Z.H.Yuan, Pavlikova L., Kuca K. Biological degradation of aflatoxins. Drug Metab. Rev. 2009;41:1–7. doi: 10.1080/03602530802563850. [DOI] [PubMed] [Google Scholar]
  37. Wang T.W. Study on mechanism and intervention of enterohepatic axis injury induced by long-term exposure of mycotoxins AFB1 and ZEN in mice with high fat diet [D] JNU. 2022 [Google Scholar]
  38. Xu Z., Liu Q., Liu X., Yang M. Integrated transcriptome analysis reveals mRNA-miRNA pathway crosstalk in roman laying hens' immune organs induced by AFB1. Toxin. 2014;14:808. doi: 10.3390/toxins14110808. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Yang J., Ba F., Zhang K., Bai S., Peng X., Ding X., Li Y., Zhang J., Zhao L. Effects of feeding corn naturally contaminated with aflatoxin B1 and B2 on hepatic functions of broilers. Poult. Sci. 2012;91:2792–2801. doi: 10.3382/ps.2012-02544. [DOI] [PubMed] [Google Scholar]
  40. Zhao J.P., Wang Z.L., Chen Y.P., Peng D.P., Xianyu Y.L. Horseradish peroxidase-catalyzed formation of polydopamine for ultra-sensitive magnetic relaxation sensing of aflatoxin B1. J. Hazard. Mater. 2021 doi: 10.1016/j.jhazmat.2021.126403. [DOI] [PubMed] [Google Scholar]
  41. Zhao Z.W., Yang Q., Zhou T.T., Liu C.H., Sun M.Q., Cui X.M., Zhang X.W. Anticancer potential of Bacillus coagulans MZY531 on mouse H22 hepatocellular carcinoma cells via anti-proliferation and apoptosis induction. BMC Complement. Med. 2023;23:318. doi: 10.1186/s12906-023-04120-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Zhu Y., Cleaver L., Wang W., Podoll J.D., Walls S., Jolly A., Wang X. Strategies and methodologies for developing microbial detoxification systems to mitigate mycotoxins. Toxins. 2017;9:130. doi: 10.3390/toxins9040130. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Poultry Science are provided here courtesy of Elsevier

RESOURCES