Skip to main content
BMC Genomics logoLink to BMC Genomics
. 2024 Aug 28;25:808. doi: 10.1186/s12864-024-10736-x

Whole genome sequence and characterisation of Streptococcus suis 3112, isolated from snakeskin gourami, Trichopodus pectoralis

Pakorn Aiewsakun 1,2,, Wuthiwat Ruangchai 2, Bharkbhoom Jaemsai 1,2, Thavin Bodharamik 2, Watcharachai Meemetta 3, Saengchan Senapin 3,4
PMCID: PMC11351508  PMID: 39198749

Abstract

Background

Streptococcus suis (S. suis) is an important swine and human pathogen. A recent study reported the first isolate of S. suis capable of infecting fish, designated as S. suis strain 3112. The bacterium was isolated from snakeskin gourami (Trichopodus pectoralis), an economically important fish species native to Southeast Asia, and it was previously shown that it can infect and cause lethal streptococcosis in the fish.

Results

In this study, we present the complete genome of S. suis 3112. Molecular sequence analysis revealed that it belongs to serotype 6, sequence type 2340. Phylogenetic analysis showed that the bacterium clustered with healthy-pig S. suis isolates, suggestive of an ultimate swine (as opposed to human) origin of the bacterium. Two fluoroquinolone resistance genes are present in the bacterial genome, namely patA and patB. Our results showed that both genes are expressed in our bacterium, and the bacterium is resistant to norfloxacin, but is still sensitive to other fluoroquinolones, including ciprofloxacin, enrofloxacin, and sparfloxacin. Additionally, the bacterium is sensitive to β-lactams, tetracyclines, sulphonamides, and an aminoglycoside.

Conclusions

This study reports and describes the complete genome of S. suis 3112, the first isolate of S. suis known to infect fish, and provides further insights into the bacterial isolate, particularly regarding its drug resistance profile. These results will facilitate further investigations of the comparative genomics and pathogenic characteristics of S. suis, as well as the development of control strategies against this newly-identified fish pathogen.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12864-024-10736-x.

Keywords: Streptococcus suis, Whole genome, Cross-species transmission, Fish pathogen

Background

Streptococcus suis (S. suis) is an important Gram-positive swine and human bacterial pathogen [13]. In pigs, S. suis infections can cause septicaemia, arthritis, and pneumonia, leading to acute death, particularly in piglets, resulting in significant economic losses for the pork industry in the past [3, 4]. In humans, S. suis infections usually occur in individuals with occupational exposure to swine, such as farmers, veterinarians, and meat processing workers. Common symptoms of human infections include meningitis, sepsis, septic arthritis, endocarditis, toxic shock syndrome, endophthalmitis, and hearing loss [5].

In addition to its main hosts pigs and humans, S. suis has been reported to infect birds [6, 7] and various other mammals, including ruminants, cats, dogs, deer, horses, and rabbits [8, 9]. Recently, a study reported the first documented case of S. suis causing lethal streptococcosis in snakeskin gourami (Trichopodus pectoralis), named S. suis strain 3112, thereby expanding the potential host range of this bacterium [10]. Experimental infections revealed that the infection fatality rates of the bacterium ranged from 50 to 92.5% in snakeskin gourami, depending on the infection dose and fish size [10]. Infected fish displayed several clinical symptoms, including skin haemorrhage, exophthalmos (eye protrusion), and erratic swimming, closely resembling naturally diseased fish [10]. Snakeskin gourami is an economically important fish species native to Southeast Asia. Although further study is required to fully assess the socioeconomic impact of this bacterium on fish aquaculture, previous findings suggested that it should be closely monitored as a potential emerging fish pathogen.

In this study, we conducted whole genome sequencing and characterisation of S. suis 3112. Our analysis revealed that this bacterium belongs to serotype 6, sequence type (ST) 2340. Furthermore, our results suggest that S. suis 3112 likely emerged through cross-species transmission ultimately from pigs to fish. We showed that the bacterium’s genome harbours and expresses fluoroquinolone resistance genes, namely patA and patB, and it is resistant to norfloxacin, but is still sensitive to other fluoroquinolones, including ciprofloxacin, enrofloxacin, and sparfloxacin, as well as β-lactams, tetracyclines, sulphonamides, and an aminoglycoside. These results further our knowledge and understanding of this newly-identified fish pathogen.

Results and discussion

S. suis 3112 whole genome

The genome of S. suis 3112 was sequenced using both the 2nd generation (Illumina) and 3rd generation (Oxford nanopore) sequencing technologies (Table 1). A total of 2,586,035 paired-end short reads (SRR24927969: 713,395,771 bases), and 61,261 long reads (SRR24941354: 227,332,593 bases) were obtained after read cleaning. From these clean reads, the entire bacterial genome was successfully assembled into a single circular chromosome, and no plasmids were found (Table 2, and Fig. 1). The chromosome assembly has a length of 2,075,993 bases, and has an average short-read and long-read assembly depth of 365.11× and 67.79×, respectively. 95% of the chromosome positions have at least 253× short-read and 47× long-read assembly depths, supporting that most of the chromosomal regions were well-assembled. The chromosome has a GC content of 41.35%, and contains a total of 2,001 genomic features, including 1,861 coding genes, 72 RNA genes (4 5 S rRNA genes, 4 16 S rRNA genes, 4 23 S rRNA gene, 56 tRNA genes, and 4 ncRNA genes), and 68 pseudogenes. VFanalyzer [11] detected 39 virulence factors involved in 5 distinct biological functions (Supplementary Table 1), and mobileOG-db [12] detected 159 mobile genetic elements (Supplementary Table 2) scattering across the genome, divided into 5 classes (39 elements mediating replication/recombination/repair; 70 elements mediating sequence integration/excision; 26 elements mediating interorganism genetic material transfer; 16 elements mediating bacteria stability/transfer/defence, and 8 phage-like elements). Two drug resistance genes, patA and patB, were also detected in the genome by using Resistance Gene Identifier with the Comprehensive Antibiotic Resistance Database (CARD RGI) [13], known to confer resistance to fluoroquinolone antibiotics [1416].

Table 1.

Summary statistics of raw sequencing data

Name Sequencing platform Sequencing layout Number of spots Number of bases Avg. length (bases) SD. length (bases) GC content (%)
For. Rev. For. Rev.
Short-read sequencing
SRR24927969

ILLUMINA

(NovaSeq 6000)

PAIRED 3,836,892 888.7 M 125 106 43.1 49.8 42.5
Long-read sequencing
SRR24941354

OXFORD NANOPORE

(MinION)

SINGLE 61,262 232.6 M 3797 3442.8 41.9

Table 2.

Assembly and annotation summary statistics

Assembly statistics
GenBank accession number CP097577.2
Assembly program Unicycler V.0.4.8
Genome size 2.1 Mb
Total ungapped length 2.1 Mb
Number of chromosomes 1
Number of scaffolds 1
Scaffold N50 2.1 Mb
Scaffold L50 1
Number of contigs 1
Contig N50 2.1 Mb
Contig L50 1
GC percent 41
Genome coverage Short-read: 365.11×; long-read: 67.79×
Assembly level Complete Genome
Annotation information
Annotation program NCBI Prokaryotic Genome Annotation Pipeline (PGAP) v.6.1
Genes 2,001
Protein-coding 1,861

Fig. 1.

Fig. 1

Overview of S. suis 3112 whole genome (A), and drug resistance genes, mobile genetic elements, and virulence factors identified in the bacterial genome (B)

S. suis 3112 serotyping and its cps locus

S. suis was originally classified into 35 serotypes based on the antigenicity of the bacterial capsular polysaccharide (CPS), namely serotype 1 to 34 and 1/2 [1720]. Some of these serotypes have later been proposed to be re-classified as a new bacterial species [21], and additional CPS serotypes have also been proposed [2225]. However, many diagnostic laboratories still use the original 35-serotype scheme for S. suis identification, and among these, serotype 2 is recognised as the most common cause of infections in piglets worldwide and a major agent of zoonotic infections [26].

The synthesis of CPS involves a group of genes in the cps locus. The previous study reporting S. suis 3112 demonstrated that the bacterium does not belong to serotype 2 based on a cps2 gene-specific polymerase chain reaction (PCR) test [10]. To serotype this bacterium, we performed a search against our bacterial genome using sequences of 33 serotype-specific PCR-primer pairs [27] with BLASTn [28]. We found that the only pair showing detectable similarity was the cps6I primer-pair sequences specific to serotype 6, showing 100% identity. Consistent results were obtained by PCR, using the glutamate dehydrogenase (gdh) gene as a positive S. suis-specific control (Fig. 2A, and Supplementary Fig. 1). Sequences of the cps6I and gdh genes in the assembled genome were validated by Sanger sequencing (Supplementary Figs. 2 and 3). The cps locus in the genome of S. suis 3112 (Fig. 1, position: 1,243,318–1,271,969) was then located by querying our genome with the cps locus of the reference S. suis serotype 6 strain 2524 (GenBank accession number: AB737818) using BLASTn [28]. A comparative analysis revealed some structural differences between the two (Fig. 2B). For instance, we found that S. suis 3112 has a 399-bp insertion in the middle of the cps6U gene as compared to the reference strain 2524, and while the reference strain 2524 has a transposase gene of the family IS3 at the 3’ end of the cps locus, our bacterium lacks this element, but has the MarR (pseudo)gene instead. Nevertheless, the overall similarity of their cps loci still remains high. Taken together, these results suggest that our bacterium S. suis 3112 belongs to serotype 6.

Fig. 2.

Fig. 2

S. suis 3112 serotyping and its cps locus. A) PCR tests specific for S. suis serotype 6 (cps6 gene; 705 bp) and serotype 2 (cps2 gene; 577 bp). The S. suis serotype 2 strain P1/7 (S. suis P1/7) was included as an experimental control. PCR amplification of the S. suis glutamate dehydrogenase (gdh) gene (689 bp) was performed as a positive control. The results suggest that S. suis 3112 belongs to serotype 6, and not serotype 2. Lane M, GeneRuler 1 kb DNA Ladder (Thermo Scientific), NTC, no template control. Supplementary Fig. 1 shows a direct print-out of the gel image from the machine. B) Comparison of the cps loci between the reference S. suis serotype 6 strain 2524 (top) and S. suis strain 3112 (bottom). Genes are colour-coded based on the functions of their protein products

S. suis 3112 belongs to ST 2340

Besides serotyping, another approach widely used to characterise a bacterial isolate at the subspecies level is multi-locus sequence typing (MLSTing). Under this approach, a bacterial species is divided into distinct groups called STs based on allelic profiles of several specific housekeeping genes. Currently, S. suis is classified into 2,705 STs using allelic profiles of aroA, cpn60, dpr, gki, mutS, recA, and thrA housekeeping genes (PubMLST, Jolley et al. [29]; access date: 29/02/2024), originally developed by King et al. [30]. Compared with serotyping, MLSTing provides a higher resolution classification scheme, enabling more detailed classification and characterisation of bacterial isolates. For instance, while both ST1 and ST7 belong to serotype 2, it has been reported that the former is globally distributed, while the latter is predominantly found only in China [1], providing important insights into the epidemiological distribution of the bacteria with higher resolution.

To determine the ST of S. suis 3112, its assembled genome was analysed using the online database PubMLST [29]. Our analysis revealed that S. suis 3112 belongs to ST 2340, and the alleles of the genes aroA, cpn60, dpr, gki, mutS, recA, and thrA of S. suis 3112 were determined as 490, 646, 30, 559, 546, 394, and, 428, respectively. The sequences of these genes validated by Sanger sequencing (Supplementary Figs. 410), thereby confirming the typing result.

Phylogenetic analysis of S. Suis 3112

Phylogenetic analysis was performed to determine a probable origin of S. suis 3112. 90 whole genome sequences of S. suis compiled by Dong et al. [31] were randomly selected, and used as contextualising genomes, comprising 30 genomes of human isolates, 30 genomes of diseased-pig isolates, and 30 genomes of healthy-pig isolates (Supplementary Table 3), as well as the genome of the serotype-6 reference strain 2524 isolated from a diseased pig. All publicly available whole genome sequences of S. suis samples obtained from non-pig/non-human animals on the NCBI Assembly database were also included in this analysis, including the genomes of 1 cattle isolate, 1 river otter isolate, 1 lamb isolate, 1 cat isolate, and 4 red junglefowl isolates (Supplementary Table 3). The analysis was conducted using an alignment of variant sites sampled across the entire genome, excluding sites with > 25% missing bases, constructed by using S. suis 3112 as the reference genome anchor. By comparing to S. suis 3112, 16 samples were found to have an overall S. suis 3112 coverage < 75%, and thus were excluded from further analysis (Supplementary Table 3). The remaining contextualising genomes were 29 human samples, 29 diseased-pig samples, 22 healthy-pig samples, 1 cat sample, 1 otter sample, and 1 red junglefowl sample. While this contextualising dataset might not cover the entire diversity of S. suis, it should be sufficient for determining a probable origin of S. suis 3112 as it contained some of the most similar genomes to that of our bacterium already. Significant evidence for recombination (p-value < 0.00001) was detected in the alignment (Supplementary Data 1) using the PHI test [32]. Thus, we opted for phylogenetic network analysis as the method of choice for this study.

Dong et al. [31] classified S. suis into 9 sub-populations based on the similarity among their single nucleotide polymorphisms using a Bayesian analysis of population structure (BAPS), named BAPS1 to 9. According to this classification scheme, we found that S. suis 3112 fell within the diversity of BAPS6 members (Fig. 3), predominantly consisting of healthy-pig bacterial isolates, as well as the two cat and red junglefowl isolates. This phylogenetic pattern suggests an ultimate swine (as opposed to human) origin of S. suis 3112. This finding aligns with the information that the bacterial isolate was obtained from a fish farm where the fish rearing water was likely contaminated with pig excrements, corroborating the hypothesis.

Fig. 3.

Fig. 3

Phylogenetic network analysis, whole genome comparison, and cps locus comparison of S. suis 3112 with closely related isolates. A) Phylogenetic network analysis included 29 human samples (red), 28 diseased-pig samples (yellow), 22 healthy-pig samples (green), 1 otter sample (purple), 1 cat sample (orange), and 1 red junglefowl sample (dark navy) as contextualising genomes (Supplementary Table 3). The serotype-6 reference strain, S. suis 2524 (indicated with a larger font size), was also included in this analysis. Our bacterial isolate S. suis 3112 is highlighted in blue (host = Snakeskin gourami). The network was estimated from an alignment of variant sites sampled from the entire bacterial genome constructed by using our S. suis 3112 sample as the reference anchor genome, excluding sites with > 25% missing bases (Supplementary Data 1). The Neighbour-net method implemented in SplitsTree4 [33] was used to reconstruct the network, and the GTR + F + Γ nucleotide substitution model was used to best approximate the best-fit nucleotide substitution model, TVM + F + ASC + R6, identified under the Bayesian information criterion by ModelFinder [34] implemented in IQ-TREE2 [35] (see Methods). Bacterial groups identified by the Bayesian analysis of population structure (BAPS) by Dong et al. [31] are indicated. The scale bar represents 0.1 substitutions per site. See Supplementary Data 2 for the raw NEXUS network file. B) Whole genome comparison of S. suis 3112 against BAPS6 samples. C) Whole genome comparison of S. suis 3112 and 2524. In both analyses, S. suis 3112 was used as the reference, and colours of the genomes indicate the bacterial hosts (see key in A). D) Comparison of the cps loci of S. suis 3112 (1st row), S. suis 2524 (2nd row), and BAPS6 samples (3rd to 13th rows). The cps locus of S. suis 3112 served as the anchor reference in the pairwise sequence similarity detection (e-value threshold = 0.1). Genes are colour-coded based on the functions of their protein products. Colours of the genomes indicate the bacterial hosts (see key in A)

Further examination of the network revealed extensive reticulation branches connecting S. suis 3112 and other BAPS6 members, suggesting potential both deep and recent genetic exchanges among them. Interestingly, although S. suis 3112 and BAPS6 isolates exhibited high detectable similarity across their entire genomes (Fig. 3B; range of average nucleotide identities (ANIs): 95.45–96.06%; Supplementary Table 4), their cps loci showed very little nucleotide-level similarity among them (Fig. 3D). Out of the 11 contextualising BAPS6 isolates in our dataset, we were able to serotype 6 of them by querying their assembled genomes against serotype-specific PCR-primer sequences proposed by Liu et al. [27] and Kerdsin et al. [36] using BLASTn [28]. We found that, indeed, none of them belonged to serotype 6, but instead were found to belong to at least 3 distinct serotypes (serotypes 5: isolate 2464; serotype 15: isolates 138, and 2089; serotype 31: isolates 61, 1069, and LS5U; unidentifiable: isolates 794, 1100, CPD21, SS/UPM/MY/F001, and SSHP-C; Supplementary Table 5). On the other hand, while the cps loci of S. suis 3112 and 2524 were highly similar (Fig. 2, and 3D), they did not cluster together on the phylogenetic network (although a high degree of genome-wide similarity comparable to those against BAPS6 isolates could still be observed, Fig. 3C; ANI: 95.40%, Supplementary Table 4). Altogether, these findings support the notion of extensive horizontal gene transfer, involving the cps locus. Indeed, cps gene recombination has been reported in some S. suis serotypes, and is recognised as a mechanism generating diversity of cps loci in S. suis [37]. A high recombination rate has been suggested to promote host generalism and expansion of the host range in bacteria [38]. The observation that S. suis 3112, which must have undergone a (series of) inter-species transmission(s) in the past, belongs to a group of S. suis with a pronounced level of recombination as well as containing two other non-pig/non-human samples is therefore a noteworthy one. However, the exact role of recombination in this process (if any) remains unclear, and further investigation is required to shed more light on the specific mechanisms underlying these genetic exchanges and host jump.

Antimicrobial drug susceptibility testing

The resistance of S. suis to antimicrobial drugs is a global issue, most commonly against tetracyclines and macrolides, but also to aminoglycosides, fluoroquinolones, amphenicols, and glycopeptides [39, 40]. Our analysis identified two potential drug resistance genes in the genome of S. suis 3112 (Fig. 1, right), namely patA (position: 1,913,151–1,914,857), and patB (position: 1,911,366–1,913,150). These genes encode ATP-binding cassette efflux pumps, PatA and PatB, which are known to confer resistance to fluoroquinolone antibiotics, particularly norfloxacin, followed by ciprofloxacin, gemifloxacin, levofloxacin, and moxifloxacin [1416]. The average short-read assembly depth for patA and patB was 468× and 456×, respectively, strongly supporting their presence within the bacterial genome, and the gene sequences could be validated by Sanger sequencing (Supplementary Figs. 11 and 12). Reverse transcription (RT)-PCR analysis revealed the expression of these two genes in our bacterium (Fig. 4, and Supplementary Fig. 13).

Fig. 4.

Fig. 4

Expression of patA and patB transcripts in S. suis 3112. The presence of patA and patB transcripts in S. suis 3112 RNA was evaluated using RT-PCR (top). No amplicons were obtained from PCR reactions without reverse transcription (below), confirming the absence of DNA contamination in the RT-PCR reactions. S. suis 3112 DNA was used as an amplification control. M, DNA marker; NTC, no template control. Supplementary Fig. 13 shows a direct print-out of the gel image from the machine

Antimicrobial susceptibility testing was conducted on S. suis 3112 against five classes of drugs, including β-lactam (AML: amoxicillin, and PEN: penicillin), tetracycline (OT: oxytetracycline, and TET: tetracycline), fluoroquinolone (ENR: enrofloxacin, CIP: ciprofloxacin, NX: norfloxacin, and SPX: sparfloxacin), sulphonamide (SX: sulphamethoxazole, and TR: trimethoprim), and aminoglycoside (GEN: gentamicin) (Table 3; Fig. 5). Staphylococcus aureus 1020 was used as an experimental control (Supplementary Fig. 14, and Supplementary Table6). These drugs are permitted, and are commonly used in aquaculture (AML, OT, ENR, and TR), pig farming (AML, PEN, OT, TET, ENR, and GEN), and the treatment of human diseases (AML, PEN, TET, CIP, NX, SX, TR, and GEN) [4143].

Table 3.

Antimicrobial susceptibility testing results for S. Suis 3112

Antimicrobial class Antimicrobial agent Amount of the drug in the disk Inhibition zone diameter (mm)* Observed inhibition zone diameter (mm) Susceptibility*
S I R
β-lactam Amoxicillin (AML) 25 µg  26 19–25  18 36.03 ± 1.42 S
Penicillin (PEN) 10 Units  28 22–27  21 37.53 ± 1.45 S
Tetracycline Oxytetracycline (OT) 30 µg  29 19–28  18 34.30 ± 0.70 S
Tetracyclin (TET) 30 µg  23 19–22  18 30.00 ± 0.61 S
Fluoroquinolone Enrofloxacin (ENR) 5 µg  23 17–22  16 34.76 ± 0.64 S
Sparfloxacin (SPX) 5 µg  19 16–18  15 25.90 ± 0.10 S
Ciprofloxacin (CIP) 10 µg ≥ 21 16–20  15 22.83 ± 0.31 S
Norfloxacin (NX) 10 µg ≥ 17 13–16  12 10.83 ± 0.55 R
Sulfonamides Sulphamethoxazole (SX) 25 µg  25 21–24  20 30.10 ± 0.30 S
Trimethoprim (TR) 5 µg  16 11–15  10 27.93 ± 0.42 S
Aminoglycoside Gentamicin (GEN) 10 µg  16 13–15  12 21.76 ± 0.40 S

*S: Sensitive; I: Intermediate; R: Resistant

Disk diffusion assays were conducted to evaluate the susceptibility of S. suis 3112 to eleven antimicrobial drugs from five distinct classes. The experiment was performed in triplicate, and the mean diameters of the inhibition zones (mm) are reported with standard deviations. Zone diameter interpretive standard chart is provided in the table. Images from one replicate of the disk diffusion assays are shown in Fig. 5. Staphylococcus aureus 1020 was used as an experimental control (Supplementary Fig. 14, and Supplementary Table 6)

Fig. 5.

Fig. 5

One replicate of disk diffusion assays assessing the susceptibility of S. suis 3112 to eleven antimicrobial drugs from five distinct classes. The tested drugs included β-lactams (AML: amoxicillin, and PEN: penicillin), tetracyclines (OT: oxytetracycline, and TET: tetracycline), fluoroquinolones (ENR: enrofloxacin, SPX: sparfloxacin, CIP: ciprofloxacin, and NX: norfloxacin), sulphonamides (SX: sulphamethoxazole, and TR: trimethoprim), and an aminoglycoside (GEN: gentamicin). The results show that S. suis 3112 is resistant to NX, but susceptible to all other drugs tested. See Table 3 for detailed antimicrobial susceptibility testing results. Staphylococcus aureus 1020 was used as an experimental control (Supplementary Fig. 14, and Supplementary Table 6)

The results demonstrate that S. suis 3112 is resistant only to norfloxacin, but still susceptible to all other drugs tested, including the other three fluoroquinolones (ciprofloxacin, enrofloxacin, and sparfloxacin). Indeed, it has been observed that resistance mediated by PatA/PatB does not affect all fluoroquinolones equally, with the most hydrophobic molecules being the least affected ones [14]. Enrofloxacin and sparfloxacin are relatively more hydrophobic compared to, for example, ciprofloxacin and ofloxacin [44, 45], which have been classified as molecules of intermediate lipophilicity, while norfloxacin is a hydrophilic derivative [46], explaining our observations.

Conclusions

This study presents a whole genome analysis of S. suis 3112, a novel strain of S. suis recently identified as the causative agent of lethal streptococcosis in snakeskin gourami, an economically important fish species in Southeast Asia [10]. Our analysis indicated that S. suis 3112 belongs to serotype 6, and ST 2340. Results from phylogenetic analysis suggest that the bacterium belongs to a group of bacteria with a considerably high level of recombination containing two other non-pig/non-human isolates, and likely originated from cross-transmission ultimately from pigs (as opposed to humans) to fish. Within its genome, we identified two drug resistance genes, namely patA and patB, which are known to confer resistance to fluoroquinolone antibiotics. We confirmed the expression of these genes in our bacterium, and found that S. suis 3112 is resistant to norfloxacin, while still remains sensitive to the other three fluoroquinolones tested, including ciprofloxacin, enrofloxacin, and sparfloxacin, as well as four other classes of antimicrobial drugs, including β-lactam, tetracycline, sulphonamide, and aminoglycoside.

In summary, our results improve our understanding of this newly identified strain of S. suis in fish, and the presence of drug resistance genes underscores the need for continuous vigilance of this bacterium. Further research on its epidemiology, evolution, host-interactions, and adaptability, is warranted to better understand the mechanisms of cross-species transmission, and to assess its prevalence, distribution, and potential impacts on fish populations and farming. Discovery of additional samples through these studies will aid in establishing effective disease treatment and management strategies against this new fish pathogen.

Materials and methods

S. suis 3112 DNA extraction

DNA extraction of S. suis 3112 was performed using a modified Gram-positive bacteria extraction protocol described by Salvà-Serra et al. [47]. A culture of S. suis 3112 was prepared by inoculating a single bacterial colony into 5 mL of tryptic soy broth (TSB, Difco, BBL) medium. The culture was incubated by shaking at 250 rpm overnight at 30 °C. After centrifugation at 5,000× g for 5 min at 4 °C, the pellet was resuspended in 300 µL of EDTA-saline (0.01 M EDTA and 0.15 M NaCl), 50 µL of 110 mg/mL lysozyme, and 10 µL of 20 mg/mL RNase A. The mixture was incubated at 37 °C for 2 h. Next, the mixture was mixed with lysis buffer (160 µL of 20% SDS, 20 µL of 5 mg/mL proteinase K) and incubated at 65 °C for 30 min. After incubation, the mixture was added to 0.5 volume of 5 M NaCl, vortexed for a few seconds, and then subjected to 1 volume of phenol: chloroform: isoamyl alcohol (25:24:1) followed by centrifugation at 10,000× g for 15 min. The upper phase was transferred to a new tube, and this step was repeated twice, with the second time using chloroform: isoamyl alcohol (24:1). DNA was precipitated from the upper phase using 0.1 volume of 3 M sodium acetate (pH 5.2), and 2 volumes of cold absolute ethanol, and then incubated overnight at -20 °C. The DNA pellet was washed with cold 70% ethanol, dried, and dissolved in DNase-free water. The quality and quantity of DNA were measured using the Qubit Fluorometer, and the DNA samples were stored at -20 °C.

2nd generation sequencing

Genomic DNA of S. suis 3112 was sent to Novogene through Ward Medic Ltd. Part, Thailand for sequencing. Briefly, the extracted genomic DNA of S. suis 3112 was randomly sheared into short fragments. The obtained fragments were then end-repaired, A-tailed, and further ligated with Illumina adapters. The fragments with adapters were subsequently amplified by using PCR, size selected, and purified before being subjected to Illumina sequencing.

3rd generation sequencing

Sequencing library preparation was carried out using the Nanopore Genomic Sequencing Kit SQK-LSK109 and native barcoding expansion 1–12 (EXP-NBD104) protocols from Oxford Nanopore Technologies. The NEBNext FFPE DNA Repair and NEBNext Ultra II End Repair/dA Tailing kit (New England Biolabs, Ipswich, USA) were used to prepare 1 µg of sheared S. suis 3112 genomic DNA (1 µg DNA in 48 µL of nuclease-free water, 3.5 µL of NEBNext FFPE DNA Repair buffer, 3.5 µL of Ultra II End-Prep reaction buffer, 3 µL of Ultra II End-Prep Enzyme Mix, and 2 µL of NEBNext FFPE DNA repair Mix, in a total volume of 60 µL). The reaction mixture was incubated at 20 °C for 5 min and heat-inactivated at 65 °C for 5 min. The DNA was purified using a 1:1 volume of Agencourt AMPure XP beads (A63880, Beckman Coulter) according to the manufacturer’s instructions and eluted in 25 µL of nuclease-free water.

To ligate native barcode adapters to the shared DNA, 22.5 µL of 500 ng of end-prepared DNA were mixed with 2.5 µL of Native Barcode, and 25 µL of Blunt/TA Ligase Master Mix in a total volume of 50 µL. The mixture was incubated at room temperature for 10 min, purified using a 1:1 volume of AMPure XP beads, and then eluted in 26 µL of nuclease-free water. 350 ng of the barcoded DNA sample were then mixed with 350 ng of another barcoded DNA sample (from another study), to prepare a total of 700 ng in 65 µL of pooled barcoded DNA sample.

The sequencing adaptors were then ligated to the pooled barcoded DNA sample by adding 5 µL of Adapter Mix II (AMII), 20 µL of NEBNext Quick Ligation reaction buffer (5×), and 10 µL of Quick T4 DNA Ligation (New England Biolabs, Ipswich, USA) to the barcoded DNA sample. The mixture was incubated at room temperature for 10 min. The DNA library was further purified using AMPure XP beads in a 1:1 ratio of beads to sample volume, and eluted in 15 µL of nuclease-free water. DNA concentrations at each step were measured using the Qubit Fluorometer.

To sequence the bacterial genome, a total DNA sequencing library of 12 µL was mixed with 37.5 µL of the sequencing buffer and 25 µL of loading beads (SQK-MAP006, ONT), and immediately loaded onto a SpotON Flow cell R9.4.1 on a MinION MK1B controlled by MinKNOW version 21.02.1 for sequencing. Data acquisition and base-calling were performed using Guppy v4.3.4 + ecb28058b with the Basecall_Barcoding workflow.

De novo whole genome assembly

The quality of the short reads was assessed using FastQC [48], and Trimmomatic [49] was employed to clean the reads with the setting “SLIDINGWINDOW:4:30 MINLEN:70”. For the long reads, PoreChop [50] was used to check and remove remaining sequencing adapters, and CANU’s [51] corrected function was applied to correct the reads. De novo genome assembly was performed using Unicycler V.0.4.8 [52] on the clean long reads with the “bold” mode and an estimated genome assembly size of 2.1 Mbp.

Genome annotation

Genome annotation was conducted using Prokaryotic Genome Annotation Pipeline v6.1 [53]. Potential drug resistance genes were identified by using CARD RGI v5.2.1 [13], available from Proksee (https://proksee.ca). Virulence factors, and mobile genetic elements were detected using VFanalyzer [11], and mobileOG-db V1.1.2 [12], respectively.

Serotyping

Serotyping was performed by querying the assembled genome against a set of 33 serotype-specific PCR-primer pair sequences [27] using BLASTn [28]. A detectable similarity to our genome was found only for the pair corresponding to serotype 6. PCR tests were conducted to confirm the result.

In the PCR-based serotyping, two primer pairs specific to serotypes 2 and 6 were used (Table 4). Each 25 µL PCR reaction contained 1x AccuStartTM II GelTrack PCR SuperMix (Catalogue number: Quantabio 95136-100), 200 nM of each of the forward and reverse primers, 200 ng of DNA template, and distilled water to adjust the final volume. The PCR cycling conditions consisted of one initial round of denaturation of DNA templates and primers at 94 °C for 5 min, followed by 35 PCR amplification cycles at 94 °C for 30 s, 58 °C for 30 s, 72 °C for 30 s, with a final extension at 72 °C for 5 min. PCR products were electrophoresed on a 1% (w/v) agarose gel, stained with ethidium bromide, and visualised under UV light. The experiment was also performed using S. suis serotype 2 strain P1/7 for comparison. Amplification of the S. suis glutamate dehydrogenase (gdh) gene [54] was performed as a control. The picture of the gel was captured using the Gel Documentation Systems (Aplegen, USA) machine.

Table 4.

Primers used in this study

Gene Primer name Primer positions (referring to CP097577.2)* Primer sequence (5’–3’) Product size (bp) Reference
cps2J cps2J-F N/A TGATAGTGATTTGTCGGGAGGG 577 [59]
cps2J-2 N/A GAGTATCTAAAGAATGCCTATTG
cps6I cps6I_F 1,263,552–1,263,571 TGGTGTCTTTCTACCTGCAA 705 [27]
cps6I_R 1,262,867–1,262,886 TCACCAAGATACGTGAACCA
gdh JP4 232,449–232,468 GCAGCGTATTCTGTCAAACG 689 [54]
JP5 233,118–233,137 CCATGGACAGATAAAGATGG
aroA aroA_571-F 1,244,938–1,244,957 TTCCATGTGCTTGAGTCGCT 571 This study
aroA_571-R 1,245,489–1,245,508 TCTGGACAAACTGAACGCGA
cpn60 cpn60_513-F 133,994–134,013 CGGTACAACAACTGCCACTG 513
cpn60_513-R 134,487–134,506 AGAGCTTCGCCATCCACATC
dpr dpr_511-F 1,546,812–1,546,835 TGGACCCTTCATCTATTTACAACT 511
dpr_511-R 1,547,303–1,547,322 TCTCCAGCAGAAATTGCGTC
gki gki_598-F 981,875–981,894 CCCAGAACGATGTAGGCAGG 598
gki_598-R 982,453–982,472 TTGGTATGGGGTCTCCAGGT
mutS mutS_573-F 2,003,137–2,003,156 TCCGCAATAGTCGCATACCC 573
mutS_573-R 2,003,690–2,003,709 TCAAGCGGGAAGTAGTGCAG
recA recA_640-F 67,672–67,691 GACTCTGGTGCGGTTGACTT 640
recA_ 40-R 68,292–68,311 CTTCTTCGGTCGCAACCTCT
thrA thrA_586-F 1,645,248–1,645,267 TGCACCTGGAAAACGCAATG 586
thrA_586-R 1,645,814–1,645,833 GATACCAGGATGGGCAGCAA
patA patA-F 1,913,292–1,913,310 CTTCTGAGCAACGATGACC 560
patA-R 1,913,833–1,913,851 ATCCGCATGATACTGAGCC
patB patB-F 1,911,855–1,911,874 ACCGACCTTATCCCGCAAAC 271
patB-R 1,912,105–1,912,125 GCAAAACGCTCCGCTATTTAC

*N/A, not applicable

Characterisation of the capsular polysaccharide (cps) locus

To locate the cps locus, we searched in our genome for a genomic region showing high similarity to the reference cps locus of S. suis serotype 6 strain 2524 (GenBank accession number: AB737818) using BLASTn [28]. The identified locus was compared against the reference locus using Easyfig v2.2.5 [55], and the genes in the reference cps locus of the strain 2524 were reannotated using Prokaryotic Genome Annotation Pipeline v6.1 [53] for the comparison. Additionally, we compared the cps locus of our bacterial isolate with those of several closely related healthy-pig S. suis isolates using the same programme.

Multi-locus sequence typing

The assembled genome sequence was analysed to determine the sequence type of S. suis 3112 using the online database PubMLST [29]. The typing was based on the allelic profile of seven housekeeping genes, including aroA, cpn60, dpr, gki, mutS, recA, and thrA.

Phylogenetic analysis

90 whole genome sequences of S. suis were randomly selected from the list compiled by Dong et al. [31], comprising 30 genomes of human isolates, 30 genomes of diseased-pig isolates, and 30 genomes of healthy-pig isolates. In addition, the genome of the reference serotype 6 S. suis strain 2524 (from a diseased pig), and all publicly available whole genome sequences of S. suis collected from non-pig/non-human animals were downloaded from the NCBI Assembly database (access date: 03/02/2024), including those of 1 cattle isolate, 1 river otter isolate, 1 lamb isolate, 1 cat isolate, and 4 red junglefowl isolates. All of these sequences were then compared to S. suis 3112 to perform variant calling, using snippy-multi implemented in snippy [56]. 16 samples were found to have an overall coverage against the S. suis 3112 genome < 75%, and thus were removed from further analysis. snippy-core in snippy [56] was then used to construct a whole-genome alignment, and the alignment was further processed by snp-sites to generate an alignment containing only variant sites. Finally, clipkit [57] with the ‘gappy mode’ was used to remove positions with > 25% missing bases. The final alignment contained 84 sequences, and 187,731 SNP positions. The PHI test [32] in RDP5 [58] was employed to detect potential recombination within the alignment, and significant evidence was found (p-value < 0.00001). Thus, phylogenetic network analysis was chosen as the method of choice for this study.

Phylogenetic network reconstruction was performed using SpiltsTree4 [33] with the Neighbour-net method. ModelFinder [34] in IQ-TREE2 [35] determined TVM + F + ASC + R6 as the best-fit nucleotide substitution model for our alignment under the Bayesian information criterion (maximum likelihood relative rate estimates: A<-> C, 1.00750; A<-> G, 5.61025; A<-> T, 1.56623; C<-> G, 0.23968; C<-> T, 5.61025; and G<-> T: 1.0000; nucleotide frequency: A, 0.240; C, 0.258; G, 0.266; T, 0.237; and site-wise rate variation distribution (proportion, rate): (0.637, 0.242), (0.227, 1.449), (0.122, 3.468), (0.011, 3.621), (0.001, 9.940), (0.002, 22.013)). In the phylogenetic network reconstruction, we therefore used the GTR + F + Γ(α = 0.9058612) model with the rate parameter values described above to best approximate the best-fit nucleotide substitution model.

Antimicrobial susceptibility tests

A single colony of S. suis 3112 was cultured overnight in 5 mL TSB at 30 °C with shaking at 250 rpm. Then, 1 mL of the overnight culture was harvested, inoculated into 100 mL of prewarmed TSB, and incubated under the same conditions for 6 h. The bacterial cell suspension was adjusted to have an OD600 of 2, corresponding to approximately 2.5 × 108 cfu/mL. Subsequently, the cell suspension was harvested and spread onto Mueller Hinton agar plates (Difco, BBL). Disks containing antimicrobial agents, including amoxicillin (AML, 25 µg), penicillin (PEN, 10 Units), oxytetracycline (OT, 30 µg), tetracycline (TET, 30 µg), enrofloxacin (ENR, 5 µg), sparfloxacin (SPX, 5 µg), ciprofloxacin (CIP, 10 µg), norfloxacin (NX, 10 µg), sulphamethoxazole (SX, 25 µg), trimethoprim (TR, 5 µg), and gentamicin (GEN, 10 µg), were placed on the bacterial agar plate using a disk dispenser (HiMedia). The plates were then incubated at 30 °C for 18 h. The diameter of the inhibition zone of S. suis 3112 was measured and interpreted as susceptible, intermediate, or resistant based on established interpretive criteria for S. suis or other Streptococcus spp. as specified by the Clinical and Laboratory Standards Institute (VET08-ED4 and M100-ED28). The experiment was conducted in triplicate, and Staphylococcus aureus 1020 was used as the control.

Detection of patA and patB expression in S. Suis 3112

Total RNA was extracted from a 5-mL overnight culture of S. suis 3112 using TRIzol Reagent (Invitrogen) following the manufacturer’s instructions. To remove any potential contaminating DNA, the reaction mixture containing 1 µg of the total extracted RNA, 10 units of DNase I, and 1× DNase I reaction buffer (Thermo Fisher Scientific) was incubated at 37 °C for 30 min. The DNA-free RNA was then purified again using TRIzol Reagent. The presence of patA and patB transcripts in S. suis 3112 was examined using reverse transcription (RT)-PCR. The RT-PCR reactions consisted of 200 ng of RNA, 400 nM of each respective pat primer pair (Table 4), 0.5 µL SuperScript™ III RT/Platinum™ Taq Mix (Invitrogen), and 1× reaction buffer. The amplification protocol involved reverse transcription at 50 °C for 10 min, RT inactivation at 94 °C for 2 min, followed by 35 cycles of denaturation at 94 °C for 30 s, annealing at 58 °C for 30 s, extension at 72 °C for 30 s, and a final extension step at 72 °C for 2 min. As a control, DNA from S. suis 3112 obtained from the aforementioned step was also subjected to the RT-PCR analysis. To confirm the absence of DNA contamination, the extracted S. suis 3112 RNA was subjected to PCR reactions as described in the serotyping method mentioned earlier, except that the patA or patB primers were used. The RT-PCR and PCR products were separated by electrophoresis on a 1% (w/v) agarose gel, stained with ethidium bromide, and visualised under UV light. The pictures of the gels were captured using the Gel Documentation Systems (Aplegen, USA) machine.

Validation of gene sequences in the assembled genome using Sanger sequencing

Sanger sequencing was used to validate sequences of the key genes mentioned in the study, including the serotype-6 specific gene cps6, the general S. suis species specific gene gdh, the seven housekeeping genes defining the bacterial ST (aroA, cpn60, dpr, gki, mutS, recA, and thrA), and the two detected drug resistance genes patA, and patB. See Table 4 for the primers used.

The gene fragments were first amplified by PCR. Each 50 µL PCR reaction contained 200 ng of S. suis 3112 DNA, 300 nM of the gene’s forward and reverse primer each, and 1× KOD OneTM PCR Master Mix containing a proofreading DNA polymerase (Toyobo, Japan, Catalog number: KMM-101). A reaction without a DNA template was used as the PCR negative control. The PCR amplification was carried out for 40 cycles of denaturation at 98 °C for 10 s, annealing at 58 °C for 5 s, and extension at 68 °C for 10 s. The amplified PCR products were separated by using a 1% (w/v) agarose gel, stained with ethidium bromide, and visualised under UV light. Expected DNA bands were extracted using the NucleoSpin® Gel and PCR Clean-up (Takara, USA, Catalog number: 740609.50) according to the manufacturer’s instructions. After quantification by Nanodrop spectrophotometry (Thermo Scientific, USA), the purified PCR products were bi-directionally sequenced using Sanger sequencing (Macrogen, South Korea). The obtained sequencing data were inspected in Geneious Prime (Biomatters, USA), and the consensus sequences were compared to our S. suis 3112 genome (CP097577.2). The results showed a 100% identity match for all eleven sequences (Supplementary Table 7), validating the gene sequences within the assembled genome.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Supplementary Material 2 (63.4KB, xlsx)
Supplementary Material 3 (15.3MB, txt)
Supplementary Material 4 (15.4MB, txt)

Acknowledgements

We thank Dr. Suganya Yongkiettrakul, BIOTEC, Thailand for providing the genomic DNA of S. suis serotype 2 strain P1/7.

Author contributions

PA and SS conceptualised, supervised, and secured funding for the study. PA designed the study, performed phylogenetic analysis, data interpretation, and prepared the initial manuscript. WR performed genome annotation, comparative genomics, and MLST analysis. BB performed phylogenetic analysis. TB preformed de novo whole genome assembly. WM conducted whole genome sequencing, serotyping, MLST analysis, antimicrobial susceptibility testing, and quantification of patA and patB gene expression by PCR. PA and SS reviewed and edited the manuscript. All authors read and approved the final manuscript.

Funding

This research project was supported by the BIOTEC Fellow’s Research Grants (P-21-51690 awarded to SS), and by Mahidol University (MU’s Strategic Research Fund): fiscal year 2023 [MU-SRF-WC-02B/66].

Open access funding provided by Mahidol University

Data availability

Short-read and long-read datasets generated during this study were deposited in the National Center for Biotechnology Information (NCBI)’s Sequence Read Archive database under the BioProject PRJNA838757, accession numbers SRR24927969 and SRR24941354, respectively. The complete genome of S. suis 3112 (BioSample: SAMN28462640) has been submitted to the NCBI GenBank database under the accession number CP097577.2. Data generated or analysed during this study are included in this published article and its supplementary information files.

Declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.Goyette-Desjardins G, Auger J-P, Xu J, Segura M, Gottschalk M. Streptococcus suis, an important pig pathogen and emerging zoonotic agent-an update on the worldwide distribution based on serotyping and sequence typing. Emerg Microbes Infect. 2014;3:e45. 10.1038/emi.2014.45 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Wertheim HFL, Nghia HDT, Taylor W, Schultsz C. Streptococcus suis: an emerging human pathogen. Clin Infect Dis. 2009;48:617–25. 10.1086/596763 [DOI] [PubMed] [Google Scholar]
  • 3.Gottschalk M, Segura M. Streptococcosis. Diseases of Swine. John Wiley & Sons, Ltd; 2019. pp. 934–50.
  • 4.Field H, Buntain D, Done J. Studies on pig mortality. I. Streptococcal meningitis and arthritis. Vet Rec. 1954;66:453–5. [Google Scholar]
  • 5.Fong IW. Zoonotic streptococci: a Focus on Streptococcus suis. In: Fong IW, editor. Emerging zoonoses: a Worldwide Perspective. Cham: Springer International Publishing; 2017. pp. 189–210. [Google Scholar]
  • 6.Devriese LA, Haesebrouck F, de Herdt P, Dom P, Ducatelle R, Desmidt M, Messier S, Higgins R. Streptococcus suis infections in birds. Avian Pathol. 1994;23(4):721–4. 10.1080/03079459408419040. [DOI] [PubMed]
  • 7.Nhung NT, Yen NTP, Cuong N, Kiet BT, Hien VB, Campbell J, Thwaites G, Baker S, Geskus R, Ashton P, Carrique-Mas J. Carriage of the zoonotic organism Streptococcus suis in chicken flocks in Vietnam. Zoonoses Public Health. 2020;67(8):843–8. 10.1111/zph.12711. [DOI] [PubMed]
  • 8.Staats JJ, Feder I, Okwumabua O, Chengappa MM. Streptococcus suis: past and present. Vet Res Commun. 1997;21:381–407. 10.1023/A:1005870317757 [DOI] [PubMed] [Google Scholar]
  • 9.Sánchez del Rey V, Fernández-Garayzábal JF, Briones V, Iriso A, Domínguez L, Gottschalk M, et al. Genetic analysis of Streptococcus suis isolates from wild rabbits. Vet Microbiol. 2013;165:483–6. 10.1016/j.vetmic.2013.04.025 [DOI] [PubMed] [Google Scholar]
  • 10.Dinh-Hung N, Dong HT, Taengphu S, Soontara C, Rodkhum C, Senapin S, et al. Streptococcus suis is a lethal pathogen in snakeskin gourami, Trichopodus pectoralis. Aquaculture. 2023;566:739173. 10.1016/j.aquaculture.2022.739173 [DOI] [Google Scholar]
  • 11.Liu B, Zheng D, Jin Q, Chen L, Yang J. VFDB 2019: a comparative pathogenomic platform with an interactive web interface. Nucleic Acids Res. 2019;47:D687–92. 10.1093/nar/gky1080 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Brown CL, Mullet J, Hindi F, Stoll JE, Gupta S, Choi M, et al. mobileOG-db: a manually curated database of protein families mediating the life cycle of bacterial mobile genetic elements. Appl Environ Microbiol. 2022;88:e00991–22. 10.1128/aem.00991-22 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Alcock BP, Raphenya AR, Lau TTY, Tsang KK, Bouchard M, Edalatmand A, et al. CARD 2020: antibiotic resistome surveillance with the comprehensive antibiotic resistance database. Nucleic Acids Res. 2020;48:D517–25. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.El Garch F, Lismond A, Piddock LJV, Courvalin P, Tulkens PM, Van Bambeke F. Fluoroquinolones induce the expression of patA and patB, which encode ABC efflux pumps in Streptococcus pneumoniae. J Antimicrob Chemother. 2010;65:2076–82. 10.1093/jac/dkq287 [DOI] [PubMed] [Google Scholar]
  • 15.Garvey MI, Baylay AJ, Wong RL, Piddock LJV. Overexpression of patA and patB, which encode ABC transporters, is associated with fluoroquinolone resistance in clinical isolates of Streptococcus pneumoniae. Antimicrob Agents Chemother. 2011;55:190–6. 10.1128/AAC.00672-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Boncoeur E, Durmort C, Bernay B, Ebel C, Di Guilmi AM, Croizé J, et al. PatA and PatB form a functional heterodimeric ABC multidrug efflux transporter responsible for the resistance of Streptococcus pneumoniae to fluoroquinolones. Biochemistry. 2012;51:7755–65. 10.1021/bi300762p [DOI] [PubMed] [Google Scholar]
  • 17.Perch B, Pedersen KB, Henrichsen J. Serology of capsulated Streptococci pathogenic for pigs: six new serotypes of Streptococcus suis. J Clin Microbiol. 1983;17:993–6. 10.1128/jcm.17.6.993-996.1983 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Gottschalk M, Higgins R, Jacques M, Mittal KR, Henrichsen J. Description of 14 new capsular types of Streptococcus suis. J Clin Microbiol. 1989;27:2633–6. 10.1128/jcm.27.12.2633-2636.1989 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Gottschalk M, Higgins R, Jacques M, Beaudoin M, Henrichsen J. Characterization of six new capsular types (23 through 28) of Streptococcus suis. J Clin Microbiol. 1991;29:2590–4. 10.1128/jcm.29.11.2590-2594.1991 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Higgins R, Gottschalk M, Boudreau M, Lebrun A, Henrichsen J. Description of six new capsular types (29–34) of Streptococcus suis. J Vet Diagn Invest. 1995;7:405–6. 10.1177/104063879500700322 [DOI] [PubMed] [Google Scholar]
  • 21.Hill JE, Gottschalk M, Brousseau R, Harel J, Hemmingsen SM, Goh SH. Biochemical analysis, cpn60 and 16S rDNA sequence data indicate that Streptococcus suis serotypes 32 and 34, isolated from pigs, are Streptococcus orisratti. Vet Microbiol. 2005;107:63–9. 10.1016/j.vetmic.2005.01.003 [DOI] [PubMed] [Google Scholar]
  • 22.Pan Z, Ma J, Dong W, Song W, Wang K, Lu C, et al. Novel variant serotype of Streptococcus suis isolated from piglets with meningitis. Appl Environ Microbiol. 2015;81:976–85. 10.1128/AEM.02962-14 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Qiu X, Bai X, Lan R, Zheng H, Xu J. Novel capsular polysaccharide loci and new diagnostic tools for high-throughput capsular gene typing in Streptococcus suis. Appl Environ Microbiol. 2016;82:7102–12. 10.1128/AEM.02102-16 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Zheng H, Qiu X, Roy D, Segura M, Du P, Xu J, et al. Genotyping and investigating capsular polysaccharide synthesis gene loci of non-serotypeable Streptococcus suis isolated from diseased pigs in Canada. Vet Res. 2017;48:10. 10.1186/s13567-017-0417-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Huang J, Liu X, Chen H, Chen L, Gao X, Pan Z, et al. Identification of six novel capsular polysaccharide loci (NCL) from Streptococcus suis multidrug resistant non-typeable strains and the pathogenic characteristic of strains carrying new NCLs. Transbound Emerg Dis. 2019;66:995–1003. 10.1111/tbed.13123 [DOI] [PubMed] [Google Scholar]
  • 26.Segura M, Aragon V, Brockmeier SL, Gebhart C, de Greeff A, Kerdsin A, et al. Update on Streptococcus suis research and prevention in the era of antimicrobial restriction: 4th international workshop on S. suis. Pathogens. 2020;9:374. 10.3390/pathogens9050374 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Liu Z, Zheng H, Gottschalk M, Bai X, Lan R, Ji S, et al. Development of multiplex PCR assays for the identification of the 33 serotypes of Streptococcus suis. PLoS ONE. 2013;8:e72070. 10.1371/journal.pone.0072070 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Camacho C, Coulouris G, Avagyan V, Ma N, Papadopoulos J, Bealer K, et al. BLAST+: Architecture and applications. BMC Bioinformatics. 2009;10:421. 10.1186/1471-2105-10-421 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Jolley KA, Bray JE, Maiden MCJ. Open-access bacterial population genomics: BIGSdb software, the PubMLST.org website and their applications. Wellcome Open Res. 2018;3:124. 10.12688/wellcomeopenres.14826.1 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.King SJ, Leigh JA, Heath PJ, Luque I, Tarradas C, Dowson CG, et al. Development of a multilocus sequence typing scheme for the pig pathogen Streptococcus suis: identification of virulent clones and potential capsular serotype exchange. J Clin Microbiol. 2002;40:3671–80. 10.1128/JCM.40.10.3671-3680.2002 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Dong X, Chao Y, Zhou Y, Zhou R, Zhang W, Fischetti VA, et al. The global emergence of a novel Streptococcus suis clade associated with human infections. EMBO Mol Med. 2021;13:e13810. 10.15252/emmm.202013810 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Bruen TC, Philippe H, Bryant D. A simple and robust statistical test for detecting the presence of recombination. Genetics. 2006;172:2665. 10.1534/genetics.105.048975 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Huson DH, Bryant D. Application of phylogenetic networks in evolutionary studies. Mol Biol Evol. 2006;23:254–67. 10.1093/molbev/msj030 [DOI] [PubMed] [Google Scholar]
  • 34.Kalyaanamoorthy S, Minh BQ, Wong TKF, Von Haeseler A, Jermiin LS. ModelFinder: fast model selection for accurate phylogenetic estimates. Nat Methods. 2017;14:587–9. 10.1038/nmeth.4285 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Minh BQ, Schmidt HA, Chernomor O, Schrempf D, Woodhams MD, von Haeseler A, et al. IQ-TREE 2: New models and efficient methods for phylogenetic inference in the genomic era. Mol Biol Evol. 2020;37:1530–4. 10.1093/molbev/msaa015 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Kerdsin A, Akeda Y, Hatrongjit R, Detchawna U, Sekizaki T, Hamada S, et al. Streptococcus suis serotyping by a new multiplex PCR. J Med Microbiol. 2014;63:824–30. 10.1099/jmm.0.069757-0 [DOI] [PubMed] [Google Scholar]
  • 37.Okura M, Takamatsu D, Maruyama F, Nozawa T, Nakagawa I, Osaki M, et al. Genetic analysis of capsular polysaccharide synthesis gene clusters from all serotypes of Streptococcus suis: potential mechanisms for generation of capsular variation. Appl Environ Microbiol. 2013;79:2796–806. 10.1128/AEM.03742-12 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Bonneaud C, Weinert LA, Kuijper B. Understanding the emergence of bacterial pathogens in novel hosts. Philos Trans R Soc Lond B Biol Sci. 2019;374:20180328. 10.1098/rstb.2018.0328 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Varela NP, Gadbois P, Thibault C, Gottschalk M, Dick P, Wilson J. Antimicrobial resistance and prudent drug use for Streptococcus suis. Anim Health Res Rev. 2013;14:68–77. 10.1017/S1466252313000029 [DOI] [PubMed] [Google Scholar]
  • 40.Dechêne-Tempier M, Marois-Créhan C, Libante V, Jouy E, Leblond-Bourget N, Payot S. Update on the mechanisms of antibiotic resistance and the mobile resistome in the emerging zoonotic pathogen Streptococcus suis. Microorganisms. 2021;9:1765. 10.3390/microorganisms9081765 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Ramathibodi Hospital Poison Center. Toxicology for the public: Introduction to over-the-counter drugs and common medication problems. 2016.
  • 42.Lekagul A, Tangcharoensathien V, Mills A, Rushton J, Yeung S. How antibiotics are used in pig farming: a mixed-methods study of pig farmers, feed mills and veterinarians in Thailand. BMJ Glob Health. 2020;5:e001918. 10.1136/bmjgh-2019-001918 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Thai Department of Fisheries. Regulation on good aquaculture practices certification for aquaculture animal production (GAP) (Version 4), BE 2563. 2020.
  • 44.García I, Pascual A, Guzman MC, Perea EJ. Uptake and intracellular activity of sparfloxacin in human polymorphonuclear leukocytes and tissue culture cells. Antimicrob Agents Chemother. 1992;36:1053–6. 10.1128/AAC.36.5.1053 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Trouchon T, Lefebvre S. A review of enrofloxacin for veterinary use. OJVM. 2016;06:40–58. 10.4236/ojvm.2016.62006 [DOI] [Google Scholar]
  • 46.Takács-Novák K, Józan M, Hermecz I, Szász G. Lipophilicity of antibacterial fluoroquinolones. Int J Pharm. 1992;79:89–96. 10.1016/0378-5173(92)90099-N [DOI] [Google Scholar]
  • 47.Salvà-Serra F, Gomila M, Svensson-Stadler L, Busquets A, Jaén-Luchoro D, Karlsson R, et al. A protocol for extraction and purification of high-quality and quantity bacterial DNA applicable for genome sequencing: a modified version of the Marmur procedure. Protoc Exch. 2018. 10.1038/protex.2018.084. 10.1038/protex.2018.084 [DOI] [Google Scholar]
  • 48.Simon Andrews. FastQC A Quality control tool for high throughput sequence data. Babraham Bioinf. 2018. https://www.bioinformatics.babraham.ac.uk/projects/fastqc/
  • 49.Bolger AM, Lohse M, Usadel B. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics. 2014;30:2114–20. 10.1093/bioinformatics/btu170 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Wick RR, Judd LM, Gorrie CL, Holt KE. Completing bacterial genome assemblies with multiplex MinION sequencing. Microb Genomics. 2017;3:e000132. 10.1099/mgen.0.000132 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Koren S, Walenz BP, Berlin K, Miller JR, Bergman NH, Phillippy AM. Canu: scalable and accurate long-read assembly via adaptive k-mer weighting and repeat separation. Genome Res. 2017;27:722–36. 10.1101/gr.215087.116 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Wick RR, Judd LM, Gorrie CL, Holt KE. Unicycler: resolving bacterial genome assemblies from short and long sequencing reads. PLoS Comput Biol. 2017;13:e1005595. 10.1371/journal.pcbi.1005595 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Tatusova T, Dicuccio M, Badretdin A, Chetvernin V, Nawrocki EP, Zaslavsky L, et al. NCBI prokaryotic genome annotation pipeline. Nucleic Acids Res. 2016;44:6614–24. 10.1093/nar/gkw569 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Okwumabua O, O’Connor M, Shull E. A polymerase chain reaction (PCR) assay specific for Streptococcus suis based on the gene encoding the glutamate dehydrogenase. FEMS Microbiol Lett. 2003;218:79–84. 10.1111/j.1574-6968.2003.tb11501.x [DOI] [PubMed] [Google Scholar]
  • 55.Sullivan MJ, Petty NK, Beatson SA. Easyfig: a genome comparison visualizer. Bioinformatics. 2011;27:1009–10. 10.1093/bioinformatics/btr039 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Seemann T. Snippy - Rapid haploid variant calling and core genome alignment. 2023.
  • 57.Steenwyk JL, Buida TJ, Li Y, Shen X-X, Rokas A. ClipKIT: a multiple sequence alignment trimming software for accurate phylogenomic inference. PLoS Biol. 2020;18:e3001007. 10.1371/journal.pbio.3001007 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Martin DP, Varsani A, Roumagnac P, Botha G, Maslamoney S, Schwab T, et al. RDP5: a computer program for analyzing recombination in, and removing signals of recombination from, nucleotide sequence datasets. Virus Evol. 2021;7:veaa087. 10.1093/ve/veaa087 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Smith HE, Damman M, van der Velde J, Wagenaar F, Wisselink HJ, Stockhofe-Zurwieden N, et al. Identification and characterization of the cps locus of Streptococcus suis serotype 2: the capsule protects against phagocytosis and is an important virulence factor. Infect Immun. 1999;67:1750–6. 10.1128/IAI.67.4.1750-1756.1999 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Material 2 (63.4KB, xlsx)
Supplementary Material 3 (15.3MB, txt)
Supplementary Material 4 (15.4MB, txt)

Data Availability Statement

Short-read and long-read datasets generated during this study were deposited in the National Center for Biotechnology Information (NCBI)’s Sequence Read Archive database under the BioProject PRJNA838757, accession numbers SRR24927969 and SRR24941354, respectively. The complete genome of S. suis 3112 (BioSample: SAMN28462640) has been submitted to the NCBI GenBank database under the accession number CP097577.2. Data generated or analysed during this study are included in this published article and its supplementary information files.


Articles from BMC Genomics are provided here courtesy of BMC

RESOURCES