Skip to main content
Microorganisms logoLink to Microorganisms
. 2024 Aug 16;12(8):1693. doi: 10.3390/microorganisms12081693

Advancing Bacillus licheniformis as a Superior Expression Platform through Promoter Engineering

Fengxu Xiao 1,2,3,4, Yupeng Zhang 1,2,3,4, Lihuan Zhang 1,2,3, Siyu Li 1,2,3, Wei Chen 4, Guiyang Shi 1,2,3, Youran Li 1,2,3,*
Editor: Laurent Dufossé
PMCID: PMC11356801  PMID: 39203534

Abstract

Bacillus licheniformis is recognised as an exceptional expression platform in biomanufacturing due to its ability to produce high-value products. Consequently, metabolic engineering of B. licheniformis is increasingly pursued to enhance its utility as a biomanufacturing vehicle. Effective B. licheniformis cell factories require promoters that enable regulated expression of target genes. This review discusses recent advancements in the characterisation, synthesis, and engineering of B. licheniformis promoters. We highlight the application of constitutive promoters, quorum sensing promoters, and inducible promoters in protein and chemical synthesis. Additionally, we summarise efforts to expand the promoter toolbox through hybrid promoter engineering, transcription factor-based inducible promoter engineering, and ribosome binding site (RBS) engineering.

Keywords: Bacillus licheniformis, promoter, promoter engineering

1. Introduction

Generally recognised as safe (GRAS), B. licheniformis is a Gram-positive bacterium that produces endospores, a trait within the Bacillus genus [1]. Natural habitats for B. licheniformis include (1) soil; (2) the ocean; (3) bird feathers; and (4) plants [2,3,4]. In natural settings, B. licheniformis can stimulate plant growth and enhance crop tolerance to diseases by activating the jasmonic acid/ethylene signalling pathway [5,6,7]. Additionally, B. licheniformis synthesises various secondary metabolites that function as insect hormones, such as ethylene glycol and 2,3-butanediol, which promote insect mating and enrich environmental carbon compounds [8]. Research on B. licheniformis began in 1945, but gained significant momentum only when its advantages in amylase production and biosafety were recognised [1].

Recently, B. licheniformis has become popular as a cell factory for producing high-value enzymes like amylase, arginase, and amylosucrase [9,10,11], as well as high-value chemicals, such as acetoin and 2,3-butanediol [12,13] (Figure 1). It can grow on low-cost carbon substrates like sucrose, maltose, and starch [14,15,16]. A recent study demonstrated that engineered B. licheniformis could utilise marine algae biomass rich in sulphated polysaccharides from green algae as a growth substrate [17]. This underscores B. licheniformis’s unique advantages in using diverse carbon substrates. Moreover, it can thrive at high temperatures [18,19]. During fermentation, B. licheniformis produces antimicrobial substances like bacteriocins, reducing susceptibility to bacterial infections [20]. These attributes have led to its widespread use in modern fermentation industries.

Figure 1.

Figure 1

The application of B. licheniformis.

The rapid advancement of synthetic biology technologies and genomic sequence analysis has accelerated metabolic engineering in B. licheniformis. In synthetic biology, promoters are crucial for regulating carbon flow allocation and target gene expression. Selecting appropriate promoters is the first step in expanding B. licheniformis’s applications. Natural promoters generally fall into three categories: constitutive promoters, inducible promoters, and quorum sensing (QS) promoters (Figure 2). Constitutive promoters maintain steady expression levels regardless of external stimuli; inducible promoters are activated by specific inducers; quorum sensing promoters adjust expression based on bacterial density. Xylose-inducible promoters have been utilised in B. licheniformis’s CRISPR gene editing methods [21]. Typically less than 200 bp long, B. licheniformis’s promoters consist of an upstream regulation region and a core promoter region. The core region contains crucial sites for RNA polymerase recognition and binding, while the upstream regulation region includes specific transcription factor recognition sites. The diversity of artificial reprogramming promoters has increased due to mechanistic analyses of key transcription factors (DegU, AbrB, CcpA, and GlnR) involved in B. licheniformis’s life activities [22,23,24,25]. Customisable artificial promoters can be created by identifying these transcription factor recognition sites and incorporating them into constitutive promoters. Typically, these synthetic promoters exhibit higher thresholds and novel inducibility.

Figure 2.

Figure 2

Promoter in B.licheniformis.

In 2023, the strategy of using B. licheniformis as a cell factory to produce high-value chemicals was published [26]. However, there is a lack of comprehensive understanding regarding the characteristics and engineering strategies of B. licheniformis promoters, particularly concerning their applications in chemical biosynthesis or protein synthesis. This review aims to provide an overview of the advancements made in the study of B. licheniformis promoters. We demonstrate the application of constitutive promoters, quorum sensing promoters, and inducible promoters in protein or chemical synthesis. Additionally, we propose promoter engineering strategies to expand the promoter library of B. licheniformis, including (1) hybrid promoter engineering, (2) inducible promoter engineering based on transcription factors, and (3) ribosome binding site (RBS) engineering.

2. Constitutive Promoters

2.1. Endogenous Strong Constitutive Promoters

There are two methods for obtaining B. licheniformis’s endogenous strong constitutive promoters: (1) mining from strong metabolic pathways and (2) mining from transcriptome data. The two main strong metabolic processes are the 2,3-butanediol/acetoin synthesis pathway and the bacitracin synthesis pathway.

2.1.1. PbacA Derived from Bacitracin Synthase Operon

B. licheniformis secretes bacteriocins, which inhibit the growth of Gram-negative bacteria [27]. The bacT and bacABC components of the B. licheniformis peptide synthase operon were initially described in 1997 [28]. The bacT gene encodes thioesterase, while the bacABC operon encodes non-ribosomal peptide synthase (NRPS). The promoter PbacA, responsible for the transcription of the bacABC operon, is a strong endogenous promoter in B. licheniformis. Overexpressing ilvBHC, the leuABCD operon, ilvD, the leucyl-tRNA synthase gene leuS, and the pulcherriminic acid synthase cluster yvmC-cypX through the promoter PbacA, and knocking out the gene bkdAB, achieved pulcherriminic acid yields of 507.4 mg/L, which were 337.8% higher than those of the starting strain [29]. Zhan et al. substituted the PbacA promoter for the PglpFK promoter in the B. licheniformis glycerol operon, leading to an 18.8% rise in glycerol consumption over the wild strain [30]. Shi et al. substituted the native promoter of the bkd operon with PbacA, which increased the production of short-chain fatty acids (SBCFAs) to 4.68 g/L, a 1.98-fold increase. The modified strain produced 8.37 g/L of SBCFAs in a 5 L fermentation tank, yielding 0.20 g/L/h [31].

2.1.2. PalsSD Derived from alsSD Operon

The two primary overflow metabolites of B. licheniformis are 2,3-butanediol and acetoin [32]. The PalsSD promoter regulates the alsSD operon, a crucial operon that catalyses the transcriptional conversion of pyruvate to acetoin. Wu et al. selected the top 10 promoters with the largest upregulation fold for study based on transcriptome data. They used green fluorescence as the reporter gene to show that PalsSD had significantly higher activity than the other nine promoters [20].

2.2. Heterologous Strong Constitutive Promoters

2.2.1. P43

The P43 promoter derived from Bacillus subtilis is widely used in B. licheniformis. Cai et al. assembled the P43 promoter, the aprE signal peptide, and nattokinase to create an expression cassette for nattokinase. Furthermore, 35.60 FU ml−1 of nattokinase activity was obtained by overexpressing the signal peptidase SipV [33]. In ccpA-deficient strains, Zhang et al. overexpressed the ccpA gene via the P43 promoter, enabling recombinant B. licheniformis to utilise glucose and xylose simultaneously [34]. Li et al. used the P43 promoter to overexpress the Cas9n protein in order to create a CRISPR/Cas9n gene editing system. The method can achieve 100% editing efficiency for a single gene, 11.6% editing efficiency for two genes, and 79.0% editing efficiency for a large fragment gene (42.7 KB) [29].

2.2.2. PShuttle-09

PShuttle-09, developed in B. subtilis, is a potent promoter that is eight times more potent than the P43 promoter [35]. Additionally, PShuttle-09 is frequently employed in B. licheniformis as a fundamental promoter for TF-TF binding site research [24].

3. Inducible Promoters

Inducible promoters can intensify expression in response to specific effectors such as light, osmotic pressure, pH, carbohydrates, amino acids, antibiotics, etc. Inducible promoters are preferable to constitutive promoters in two scenarios: (1) biosensor development and optimisation and (2) toxic protein induction expression, such as Cas12a.

3.1. Sugar-Inducible Promoters

3.1.1. Xylose-Inducible Promoter

The xylose operon consists of a bidirectional promoter PxylAB, and three structural genes: xylA, xylB, and xylR. In the presence of xylR deletion, xylAB becomes constitutively expressed. The XylR protein of B. licheniformis forms a complex with xylose, thereby reducing the affinity of the XylR protein to its target xylO [36] (Figure 3A,B). According to Li et al., glucose reduced xylose operon transcription by over 168 times and did not significantly correlate with glucose substrate concentration [37]. Furthermore, at high temperatures (25–42 °C), the transcription of xylose operons steadily rises [37]. Therefore, the promoter is induced by xylose but inhibited by glucose. One commonly utilised promoter in B. licheniformis is the xylose-inducible promoter. Below is an overview of recent real-world applications of this promoter in B. licheniformis.

Figure 3.

Figure 3

Promoter strategies in B. licheniformis. (A) Natural inducible promoter (B) Transcription factor-inducible promoter engineering (C) Hybird promoter engineering (D) UP element engineering.

Li et al. created a Pxyl-regulated Cas9 protein expression cassette to develop a xylose-induced CRISPR/Cas9 gene editing system. The plasmid conversion rate can be increased from 0.1 cfu/μg to 2.42 cfu/μg DNA by xylose-induced regulation of Cas9 expression, compared to constitutive Cas9 protein expression. Following transformation, the gene editing efficiency with amyL (encoding maltoamylase) as the target gene can reach 70.9% with the addition of 0.5% xylose. The editing efficiency can be further increased to 97% by lowering the temperature to 20 °C [21].

It was discovered that the xylose promoter from B. subtilis had the greatest induction impact when expressing the TreS enzyme using xylose promoters from three different sources (B. subtilis, B. licheniformis, and Bacillus megaterium). The optimal growth conditions for the engineered strain, which carries a xylose promoter-controlled treS expression cassette from B. subtilis, are to add 1% xylose, 0.4% soybean flour, and 4% maltodextrin after 10 h of culture. The induction period should be 12 h, and the maximum enzyme activity should be 24.7 U/mL [38].

When glucose, fructose, and sucrose are used as carbon sources, the enzyme activity of engineered strains is greatly inhibited because the CcpA protein binds to the cre site (TGAAAGCGATTAAT) located near the −10 region in the xylose promoter. By mutating the CG at the cre site to AT, the enzyme activity of the engineered strain increased by 12 times under glucose conditions. Using the xylose promoter mutant as an expression element to induce the production of maltose amylase, the highest detectable amylase activity at 37 °C was 715.4 U/mL [9].

The xylose-inducible promoter (Pxyl) was substituted for the lichenysin biosynthetic operon promoter in the mutant B. licheniformis WX02-Pxyllch [39]. It was discovered that adding 50 mM xylose had the best induction effect and that the yield of lichenysin extract exceeded 40 mg/L when xylose was added at varied doses (0 mM–100 mM).

3.1.2. Acetoin/2,3-Butanediol-Inducible Promoter

The promoter Paco, derived from the B. licheniformis acetoin operon (acoABCL, acuABC), was described by Thanh et al. [40]. Acetoin and 2,3-butanediol were found to stimulate two promoters, but glucose significantly inhibited them. Acetoin and 2,3-butanediol are examples of overflow metabolites that B. licheniformis produces when it uses glucose and other substrates. Consequently, the acetoin and 2,3-butanediol generated when glucose is reduced can reactivate the promoter. TGAAAACGCTTAAT has been identified as the cre site in Paco and is a critical location for the glucose-mediated CCR impact. In Bacillus, AcoR has been shown to be a key transcription factor regulating Paco. The deletion of the acoR gene prevents Bacillus from utilizing acetoin [41].

3.1.3. Mannitol-Inducible Promoter

A mannitol-induced expression system was created by Xiao et al. using the B. licheniformis mannitol operon, which consists of the structural gene mtlAFDR and two promoters, PmtlA and PmtlR [42]. Mannitol can activate both PmtlA and PmtlR, with PmtlA exhibiting greater induction activity. PmtlA can also be induced by sorbitol, mannose, and arabinose, in addition to mannitol. Sorbitol is the best inducer when employing this promoter to express maltose amylase because it has the greatest induction effect. Two key TF-binding sites can be found in PmtlA: cre (TGTAAGCGTTTTTAA) and MtlR box (TTGTCA-cacggctcc-TGCCAA). The CcpA protein binds to the PmtlA cre site in the presence of glucose, blocking the promoter’s activity. It is possible to significantly reduce the CCR effect of glucose on PmtlA by changing the CG in the cre site to AT.

Recently, mannitol has received widespread attention as a marine carbon source [43]. Mannitol is the main carbon source for third-generation renewable biomass—seaweed biomass hydrolysate [44]. The development of mannitol induction systems is a way to apply third-generation renewable biomass to synthetic biology.

3.1.4. Trehalose-Inducible Promoter

The three structural genes treA, treP, and treR, as well as the promoter PtreA, comprise the B. licheniformis trehalose operon. The CcpA and TreR proteins control the activity of PtreA. TreR box (TTGTATATACAA; ATGTATATACAA) and cre (TGAAAGCGCTATAA) are essential components in PtreAs response to transcription factors. Trehalose induces PtreA, while glucose, fructose, sucrose, and mannose inhibit it. The CCR impact mediated by glucose is lessened when the ccpA gene is absent [45].

3.1.5. Rhamnose-Inducible Promoter

Sugars can act as carbon suppliers and inducers for cells. As a result, using quick-acting carbon sources as inducers for induction expression systems—such as glucose and fructose—is challenging. B. licheniformis cells need 36 h to deplete 20 g/L of rhamnose, whereas they only need 9 h to do the same with glucose [46]. The promoter Prha, derived from the B. licheniformis rhamnose operon, was described by Xue et al. Rhamnose induces Prha, but glucose, mannitol, xylose, and sorbitol do not. The activity of the promoter is positively associated with increased concentration when rhamnose is added at a concentration of 0–20 g/L. This promoter increases the strain’s recombination efficiency by 105 times by controlling the expression of the Bacillus bacteriophage recombinant enzyme RecT. Future developments will see further expansion of rhamnose promoters in B. licheniformis.

3.1.6. Mannose-Inducible Promoter

Zhang et al. used B. licheniformis’s endogenous mannose promoter Pman to create a mannose-induced CRISPRi system. The system’s efficacy was confirmed by an 84% downregulation of transcription upon the addition of mannose, as measured by urease, the reporter protein. Downregulating the overflow metabolites 2,3-butanediol and acetic acid by 38% and 26%, respectively, was achieved by controlling the transcription level of the global transcription factor CodY, which encodes the gene codY, by 10%–75% [47].

3.1.7. Lactose-Inducible Promoter

The lactose-inducible promoter Plac is derived from the lactose operon of B. licheniformis and is a bidirectional promoter [48]. This promoter is located between the lacR gene and lacDCAB in the genome. The lactose minimal inducing unit was identified as a 38 bp palindrome sequence Box1. CcpA, LacR, and TnrA proteins can all bind to Box1, thereby regulating the activity of Plac.

3.1.8. IPTG-Inducible Promoter

An IPTG-inducible expression vector in Bacillus is the pHT01 plasmid. In order to produce isoprene, Gomma et al. employed this vector to overexpress the Kudzu isoprenoid synthase (kIspS) gene in B. licheniformis DSM 13. After 48 h at 37 °C and 0.1 mM IPTG incubation, this resulted in the production of 437.2 μg/L (249 μg/L/OD) isoprene [49].

3.2. Nitrogen-Inducible Promoters

Ammonia-Inducible Promoter

Shen et al. selected six genes (copA, sacA, ald, pdbX, plP, and dfP) that showed the largest transcriptional upregulation in the presence of ammonia based on transcriptome data under ammonia deficiency and ammonia presence. The activities of these six genes’ promoters were examined using amyL as the reporter gene. The findings demonstrated that five promoters had ammonia-induced activity, with the exception of the promoter PdfP. PplP had the highest ammonia induction value, but PsacA had the largest ammonia induction range (0–75%). Adding ammonia has two advantageous effects: (1) it balances the pH of the fermentation broth, and (2) it acts as an inducer to boost the promoter’s activity [50]. Sucrose metabolism is carried out by the SacA enzyme, which is encoded by the sacA gene of B. licheniformis [51]. The promoter’s ammonia-induced activity suggests that the SacA enzyme may be crucial for the conversion of carbon to nitrogen.

3.3. Antibiotic-Inducible Promoter

Tetracycline-Inducible Promoter

He et al. investigated the impact of the dal expression level on maltose amylase by overexpressing the dal gene using three different promoters (P43, Pdal, and Ptet). The amylase activity of the DAL expression system induced by tetracycline was the highest, reaching 155 U/mL, which was 27% higher than the control strain [52].

3.4. Auto-Inducible Phosphate-Controlled Promoter

Promoters originating from the phytase gene (phyL) of B. licheniformis were unearthed and identified by Trung et al. Promoter activity is markedly increased in the presence of a phosphate constraint, allowing foreign genes amyE and xynA to be expressed efficiently [53]. The two PhoP binding motifs found in the promoter, TTTACA and TTTTCA, suggest that the PhoPR two-component system regulates the promoter. Phytase catalyses the breakdown of phytate, releasing a range of lower isomers of myoinositol phosphates [54]. As a result, phytase sodium can also stimulate and control the system, and at a dose of ≤5 mM, the promoter can be significantly induced.

3.5. Environmental-Inducible Promoters

3.5.1. Salt-Inducible Promoter

Under 1.3 M NaCl conditions, B. licheniformis DSM 13T entirely inhibits growth, and it can withstand 1 M NaCl. The findings of the combined transcriptome and Northern blot analyses indicate that the genes proH, proJ, and proAA co-transcribe as osmotic-inducible operons. The promoter Ppro regulates this operon’s transcription. The reporter gene treA was fused with the promoter Ppro, and it was discovered that 0.4 M NaCl could significantly stimulate gene expression. The promoter’s activity and NaCl have a positive correlation in the region of 0–1.0 M NaCl [55]. Furthermore, in B. subtilis, the pro operon is in charge of the metabolism of proline degradation and its reaction to osmotic pressure is connected to proline biosynthesis [56,57]. Proline is also one of the ways that plants survive when they are under salt stress [58]. To encourage its use in synthetic biology, the molecular mechanism regulating this promoter’s osmotic pressure can be examined in the future.

Guo et al. discovered that 6% NaCl activated genes linked to increasing glutamate production when comparing the transcriptome data of B. licheniformis WX-02 under normal and high-salt conditions (NaCl 6%) [59]. Additionally, Binda et al. demonstrated a linear relationship between B. licheniformis’s gamma glutamyl transpeptidase production and the concentration of NaCl [60]. These genes’ expression is regulated by promoters, which may also be salt-inducible promoters.

3.5.2. pH-Inducible Promoter

As of right now, B. licheniformis pH-induced promoters have not been clearly reported. ParK et al. discovered that the expression levels of genes associated with the metabolism of fatty acids, malic acid, and branched chain amino acids are pH-related [61] based on transcriptomics and metabolomics. It has been shown by Hornbaek et al. that B. licheniformis enhances acetoin production to neutralize pH in low-pH environments [62]. According to Wang et al., B. licheniformis poly-γ-glutamic acid (γ-PGA) had a maximum production of 36.26 g L−1 under alkaline stress, a 79% increase over the control group. The γ-PGA synthase genes pgsB and pgsC, together with their closely associated regulatory components swrA and degU, showed increases in transcription levels of 18.9, 31.2, 3.0, and 6.3 times, respectively [63]. Furthermore, pH controls how poisonous B. licheniformis DAS-2 is to arsenic [64]. The genes whose promoters are discussed in these papers may join the group of pH-responsive promoters.

3.5.3. Temperature-Inducible Promoter

As of right now, B. licheniformis temperature-induced promoters have not been clearly reported. The metabolomics and proteomics of B. licheniformis at high temperatures will be the basis for many studies on heat-induced promoters in the future [65,66,67]. Lo et al. established that B. licheniformis’s HtPG protein is a heat shock protein and that a high temperature may activate its promoter [68].

4. Quorum Sensing Promoter

The quorum sensing promoter Plan is found in the gene cluster for lanthanide biosynthesis, and the Agr QS system in Staphylococcus aureus and its upstream gene cluster LanCBDA share some similarities. As a result, it is believed that Plan is part of an Agr-like QS system. Between 0 and 24 h, the promoter’s activity is incredibly low, but between 36 and 48 h, it increases dramatically. After 48 h, the Plan promoter’s activity is 75 times higher than that of the P43 promoter when the green fluorescent protein is used as the reporter gene [69].

5. Promoter Engineering in B. licheniformis

The accurate control of gene expression related to biosynthetic pathways through highly intense and modifiable promoters is a prerequisite for creating strains of any host. Few promoters completely fulfil the requirements for gene circuits, making modified promoters essential for synthetic biology. Several promoter techniques have been developed and proposed in B. licheniformis to enhance the adjustability and output threshold. These tactics include (1) hybrid promoter engineering; (2) transcription factor-based induced promoter engineering; and (3) RBS engineering (Figure 3C,D).

5.1. Hybrid Promoter Engineering

The artificial assembly of several possible promoters, or hybrid promoter engineering, primarily takes two forms: (1) combining promoters A and B; (2) combining promoter A with part of promoter A. A+B is often implemented by manually assembling the two promoters. Three artificial hybrid promoters, PylB-P43, PgsiB-P43, and PykzA-P43, were created by hybridising the promoters (PylB, PgsiB, and PykzA) with the P43 promoter. When compared to the P43 promoter, the artificial promoter PykzA-P43 performs optimally, increasing the expression of the green fluorescent protein, the red fluorescent protein, and amylase by 1.72, 3.46, and 1.85 times, respectively [70].

UP elements interact with the alpha subunit of RNA polymerase (RNAP) and are widely distributed in non-coding areas. The action of natural promoters can be increased by mixing them with UP components. The natural strong promoter plan’s UP components have been described. Li et al. created an artificial UP element called UP5-2P based on this UP element. The artificial UP components and promoter can be combined to improve the promoter activity by over eight times [69].

Prokaryotic mRNAs possess a 5′-untranslated region (5′-UTR) that includes the Shine–Dalgarno (SD) sequence and an optional translation enhancer sequence. This region is crucial for both translation initiation and RNA stability [71]. Xiao et al. developed a portable 5′-UTR sequence that forms a hairpin structure immediately upstream of the open reading frame, comprising approximately 30 nucleotides. This 5′-UTR can enhance the production of eGFP by roughly 50-fold by optimising the free energy of folding and shows strong adaptability to other target proteins, including RFP, nattokinase, and keratinase [72].

5.2. Transcription Factor-Inducible Promoter Engineering

Native promoters and regulatory elements are frequently selected for regulating gene expression in B. licheniformis. These regulatory elements, which determine whether transcription is activated or repressed, are often controlled by transcription factors. Artificial promoters with higher performance than native promoters can be created by engineering transcription factor binding sites into constitutive promoters. The primary transcription factor controlling the mannitol operon is the MtlR protein, which modifies its affinity for the mannitol promoter based on its phosphorylation state [73]. Using the constitutive promoter Pshutle09, Xiao et al. incorporated the MtlR box (TTGTCA-cacggctcc-TGCCAA) to create an artificial promoter inducible by mannitol [74]. This suggests that effectors can add transcription factor binding sites to constitutive promoters to influence the transcription process. In several species, the deletion of transcription factor binding sites has been observed to convert naturally occurring inducible promoters into constitutive promoters [75].

The nitrogen global transcription factor GlnR was recently used to create a sorbitol-activated nitrogen metabolism regulation system. The GlnR binding site motif in B. licheniformis has been identified as “TGTNAN7TNACA” [24]. Sorbitol can achieve up to 99% suppression of the target protein by regulating the binding of GlnR and the GlnR box through the use of the promoter PmtlA. This technique can be used to reroute carbon overflow metabolism, leading to a 2.6-fold increase in acetic acid synthesis and a 79.5% decrease in acetoin production.

A malic acid-induced biosensor was created through the production of malic acid reactive TF (MalR) from B. licheniformis. Zhang et al. reported that all six promoter groups involved in malic acid metabolism genes (PcimH, PmaeA, PmaeN, PmdH, PmalA, and PytsJ) were sensitive to malic acid. PcimH had the highest malate response value [76]. Malic acid and the transcription factor MalR control the activity of PcimH. The minimum inducible functional unit of malic acid was determined to be “TTAATTAGTTAAATAACTCAGAGCAAAGGGATAACAAAAA” (MalR box) through in vitro and in vivo fluorescence tests. The activity of the hybrid promoter created by assembling the MalR box into the constitutive promoter Pshutle09 responds linearly to malic acid concentrations ranging from 5 to 15 g/L. The biosensor based on this promoter can be used to screen B. licheniformis for malic acid synthesis by providing standardised components for biosynthesis.

5.3. RBS Engineering

The ribosome binding site (RBS) directly impacts protein abundance and quality by influencing translation fidelity and efficiency [77]. Rao et al. constructed an RBS library in B. licheniformis, providing incremental regulation of expression levels over a 104-fold range [78]. Zhang et al. engineered a novel mRNA leader sequence containing multiple RBSs, which could initiate translation from multiple sites, vastly enhancing translation efficiency in B. licheniformis [79].

These artificial promoters can better detect the dynamic changes in intracellular metabolite concentrations and balance the competition between product synthesis and cellular metabolism.

6. Concluding Remarks and Outlook

With recent advances in synthetic biology, B. licheniformis has become increasingly popular. Although there have been some satisfactory results in B. licheniformis, such as (1) the recombinant B. licheniformis designed by Zhou et al. producing 11.33 g/L nicotinamide riboside (NR) [80] and (2) the engineering strain of B. licheniformis designed by Zhan et al. producing 5.16 g/L 2-phenylethanol using molasses as a carbon source [81], the promoter remains a major factor limiting the application of B. licheniformis. Promoters are genetic elements that refine gene expression, and promoter engineering maximises the production of target compounds by regulating overall metabolic balance. Despite the significant progress made through promoter engineering strategies, challenges still limit their application in B. licheniformis. The main reasons include (1) the incomplete characterisation of endogenous promoters; (2) the few endogenous promoters developed; (3) the lack of understanding of dynamic control components.

One of the Gram-positive bacteria that has been investigated the most is B. subtilis. Currently, B. subtilis has a more effective gene editing system than B. licheniformis. Wu et al.‘s CRISPR/Cpf1, for instance, has a 100% effectiveness rate in achieving single-gene insertion, six-site mutations, and dual-gene knockout [82]. By creating a new generation base editor with an extended editing window, Hao et al. were able to significantly increase B. subtilis cell evolution screening efficiency [83]. Furthermore, Guo et al. prevented potential antibiotic contamination by creating plasmid-free, stable B. subtilis [84]. The various forms of promoters found in B. subtilis serve as the foundation for the above investigations. There are not as many studies on B. licheniformis’ promoters as there are on B. subtilis. Further development of promoters is a necessary step toward broadening the industrial applicability of B. licheniformis.

The quorum sensing promoter can balance bacterial production and product synthesis well and is therefore favoured by metabolic engineering. Currently, there is a lack of reported quorum sensing promoters in B. licheniformis, with only Plan available. Further development should be carried out on the quorum sensing promoter of B. licheniformis.

The application scenarios of sugar alcohol-inducible promoters are extensive, encompassing CRISPR gene editing systems and high-value enzyme production. In industrial contexts, the cost of inducers is a critical factor in evaluating the efficacy of inducible promoters. Maltose, being inexpensive, has not yet been exploited in B. licheniformis. In B. subtilis, the maltose-inducible promoter has been developed into a robust induction expression system [85]. Therefore, by analysing the maltose metabolism pathway and exploring potential maltose promoters, a maltose-induced expression system suitable for B. licheniformis can also be developed. A significant obstacle in the application of sugar alcohol-inducible promoters is the glucose-mediated carbon catabolite repression (CCR) effect. Understanding the molecular mechanisms underlying CCR is crucial for enhancing the performance of sugar alcohol-induced promoters.

Promoters induced by amino acids can be utilised to develop specific amino acid biosensors for the biosynthesis of amino acids [86]. Currently, there are few reports on amino acid-inducible promoters in B. licheniformis. One approach to developing amino acid-inducible promoters is to extract promoters from amino acid operons. For example, the proline-inducible promoter in B. subtilis is derived from the proline operon [87]. By analysing the amino acid metabolism pathways and regulatory mechanisms in B. licheniformis, suitable amino acid-inducible promoters can be developed.

High-temperature fermentation can significantly reduce contamination and condensation costs [88]. Industrially, fermentation processes using thermophiles (above 45 °C) are defined as high-temperature fermentation [89]. B. licheniformis is an excellent high-temperature platform strain capable of rapid growth at 50 °C [18,19]. Overexpression of the heat-resistant gene groES (originating from B. licheniformis) in B. subtilis can enhance its heat tolerance [90]. However, the lack of available promoters for B. licheniformis at high temperatures currently limits its application. In the future, high-temperature transcriptome data can be used to develop high-temperature-responsive promoters for B. licheniformis.

Anaerobic fermentation offers unique advantages such as low energy consumption and reduced pollution risk, especially in biofuel production [91]. B. licheniformis is better adapted to anaerobic growth than B. subtilis [92]. The Fnr protein is the main transcription factor in B. licheniformis under anaerobic conditions [93]. Currently, there are no reports of anaerobic promoters in B. licheniformis. By analysing the regulatory mechanism of Fnr, artificial anaerobic promoters can be developed for metabolic engineering under anaerobic conditions.

The pace of biological engineering and discovery is being substantially accelerated by the merging of artificial intelligence (AI) with synthetic biology. Synthetic biology and newly created AI tools have the potential to work wonders for intelligent manufacturing in the fourth industrial revolution (industry 4.0) in the years to come [94]. In the future, B. licheniformis promoters may be engineered using machine learning based on deep learning techniques. Accelerating the engineering of B. licheniformis promoters can be achieved by de novo TF design and by calculating and predicting the ideal TF recognition site.

Promoter engineering relies on a clear understanding of the interaction between transcription factors and promoters. It is crucial to further expand the promoter library of B. licheniformis and develop promoters suitable for various biosynthesis scenarios hosted by B. licheniformis.

Author Contributions

F.X., Y.Z. and L.Z.: writing—original draft preparation; S.L., W.C., G.S. and Y.L.: writing—review and editing; F.X.: project administration. All authors have read and agreed to the published version of the manuscript.

Conflicts of Interest

The authors declare no conflicts of interest.

Funding Statement

This study was funded by the National Key Research & Development Program of China (2020YFA0907700, 2018YFA0900504, and 2018YFA0900300), the National Natural Foundation of China (32172174, 31401674), the National First-Class Discipline Program of Light Industry Technology and Engineering (LITE2018-22), and the Top-notch Academic Programs Project of Jiangsu Higher Education Institutions, Jiangsu Funding Program for Excellent Postdoctoral Talent (2024ZB371).

Footnotes

Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

References

  • 1.Muras A., Romero M., Mayer C., Otero A. Biotechnological applications of Bacillus licheniformis. Crit. Rev. Biotechnol. 2021;41:609–627. doi: 10.1080/07388551.2021.1873239. [DOI] [PubMed] [Google Scholar]
  • 2.Alrumman S.A., Mostafa Y.S., Al-Izran K.A., Alfaifi M.Y., Taha T.H., Elbehairi S.E. Production and anticancer activity of an L-Asparaginase from Bacillus licheniformis isolated from the red sea, saudi arabia. Sci. Rep. 2019;9:3756. doi: 10.1038/s41598-019-40512-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Sotnychuk N.M., Cutshaw L.R., Tuhela L., Beckmann C. Prevalence of feather-degrading Bacillus spp. on the plumage of birds in Australia. Emu Austral Ornithol. 2019;120:65–73. doi: 10.1080/01584197.2019.1686995. [DOI] [Google Scholar]
  • 4.Othoum G., Bougouffa S., Razali R., Bokhari A., Alamoudi S., Antunes A., Gao X., Hoehndorf R., Arold S.T., Gojobori T., et al. In silico exploration of red sea Bacillus genomes for natural product biosynthetic gene clusters. BMC Genom. 2018;19:382. doi: 10.1186/s12864-018-4796-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Liu J., Zhang J., Zhu M., Wan H., Chen Z., Yang N., Duan J., Wei Z., Hu T., Liu F. Effects of plant growth promoting rhizobacteria (PGPR) strain Bacillus licheniformis with biochar amendment on potato growth and water use efficiency under reduced irrigation regime. Agronomy. 2022;12:1031. doi: 10.3390/agronomy12051031. [DOI] [Google Scholar]
  • 6.de O. Nunes, P.S.; de Medeiros, F.H.V.; de Oliveira, T.S.; de Almeida Zago, J.R.; Bettiol, W. Bacillus subtilis and Bacillus licheniformis promote tomato growth. Braz. J. Microbiol. 2023;54:397–406. doi: 10.1007/s42770-022-00874-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Liu Q., Liu Y., Kang Z., Xiao D., Gao C., Xu P., Ma C. 2,3-Butanediol catabolism in Pseudomonas aeruginosa PAO1. Environ. Microbiol. 2018;20:3927–3940. doi: 10.1111/1462-2920.14332. [DOI] [PubMed] [Google Scholar]
  • 8.Effantin G., Rivasseau C., Gromova M., Bligny R., Hugouvieux-Cotte-Pattat N. Massive production of butanediol during plant infection by phytopathogenic bacteria of the genera Dickeya and Pectobacterium. Mol. Microbiol. 2011;82:988–997. doi: 10.1111/j.1365-2958.2011.07881.x. [DOI] [PubMed] [Google Scholar]
  • 9.Li Y., Jin K., Zhang L., Ding Z., Gu Z., Shi G. Development of an inducible secretory expression system in Bacillus licheniformis based on an engineered xylose operon. J. Agric. Food Chem. 2018;66:9456–9464. doi: 10.1021/acs.jafc.8b02857. [DOI] [PubMed] [Google Scholar]
  • 10.Ji Y., Li J., Liang Y., Li L., Wang Y., Pi L., Xing P., Nomura C.T., Chen S., Zhu C., et al. Engineering the Tat-secretion pathway of Bacillus licheniformis for the secretion of cytoplasmic enzyme arginase. Appl. Microbiol. Biotech. 2024;108:89. doi: 10.1007/s00253-023-12917-2. [DOI] [PubMed] [Google Scholar]
  • 11.Wang C., Niu D., McHunu N.P., Zhang M., Singh S., Wang Z. Secretory expression of amylosucrase in Bacillus licheniformis through twin-arginine translocation pathway. J. Ind. Microbiol. Biot. 2024;51:kuae004. doi: 10.1093/jimb/kuae004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Li L., Wei X., Yu W., Wen Z., Chen S. Enhancement of acetoin production from Bacillus licheniformis by 2,3-butanediol conversion strategy: Metabolic engineering and fermentation control. Process Biochem. 2017;57:35–42. doi: 10.1016/j.procbio.2017.03.027. [DOI] [Google Scholar]
  • 13.Gao Y., Huang H., Chen S., Qi G. Production of optically pure 2,3-butanediol from miscanthus floridulus hydrolysate using engineered Bacillus licheniformis strains. World J. Microb. Biot. 2018;34:66. doi: 10.1007/s11274-018-2450-7. [DOI] [PubMed] [Google Scholar]
  • 14.Zhou J., Wu Y., Liu D., Lv R. The effect of carbon source and temperature on the formation and growth of Bacillus licheniformis and Bacillus cereus biofilms. LWT Food Sci. Technol. 2023;186:115239. doi: 10.1016/j.lwt.2023.115239. [DOI] [Google Scholar]
  • 15.Klaewkla M., Pichyangkura R., Charoenwongpaiboon T., Wangpaiboon K., Chunsrivirot S. Computational design of oligosaccharide producing levansucrase from Bacillus licheniformis RN-01 to improve its thermostability for production of levan-type fructooligosaccharides from sucrose. Int. J. Biol. Macromol. 2020;160:252–263. doi: 10.1016/j.ijbiomac.2020.05.102. [DOI] [PubMed] [Google Scholar]
  • 16.Zhu J., Liu M., Kang J., Wang S., Zha Z., Zhan Y., Wang Z., Li J., Cai D., Chen S. Engineering Bacillus licheniformis as industrial chassis for efficient bioproduction from starch. Bioresour. Technol. 2024;406:131061. doi: 10.1016/j.biortech.2024.131061. [DOI] [PubMed] [Google Scholar]
  • 17.Dutschei T., Zühlke M.-K., Welsch N., Eisenack T., Hilkmann M., Krull J., Stühle C., Brott S., Dürwald A., Reisky L., et al. Metabolic engineering enables Bacillus licheniformis to grow on the marine polysaccharide ulvan. Microb. Cell Fact. 2022;21:207. doi: 10.1186/s12934-022-01931-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Han X., Liu J., Wu Y., Yang Y., Tao F., Xu P. Activating a dormant metabolic pathway for high-temperature l-alanine production in Bacillus licheniformis. iScience. 2023;26:106397. doi: 10.1016/j.isci.2023.106397. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Han X., Liu J., Tian S., Tao F., Xu P. Microbial cell factories for bio-based biodegradable plastics production. iScience. 2022;25:105462. doi: 10.1016/j.isci.2022.105462. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Wu Z., Li Y., Xu Y., Zhang Y., Tao G., Zhang L., Shi G. Transcriptome analysis of Bacillus licheniformis for improving bacitracin production. ACS Synth. Biol. 2022;11:1325–1335. doi: 10.1021/acssynbio.1c00593. [DOI] [PubMed] [Google Scholar]
  • 21.Li Y., Wang H., Zhang L., Ding Z., Xu S., Gu Z., Shi G. Efficient genome editing in Bacillus licheniformis mediated by a conditional CRISPR/Cas9 system. Microorganisms. 2020;8:754. doi: 10.3390/microorganisms8050754. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Zhang Y., Xiao F., Zhang L., Ding Z., Shi G., Li Y. A new mechanism of carbon metabolism and acetic acid balance regulated by CcpA. Microorganisms. 2023;11:2303. doi: 10.3390/microorganisms11092303. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.He P., Hu S., Zhang Y., Xiang Z., Zhu A., Chen S. Transcription factor AbrB regulates ROS generation and clearance in Bacillus licheniformis. Microbiol. Res. 2024;287:127843. doi: 10.1016/j.micres.2024.127843. [DOI] [PubMed] [Google Scholar]
  • 24.He H., Li Y., Ma X., Xu S., Zhang L., Ding Z., Shi G. Design of a sorbitol-activated nitrogen metabolism-dependent regulatory system for redirection of carbon metabolism flow in Bacillus licheniformis. Nucleic Acids Res. 2023;51:11952–11966. doi: 10.1093/nar/gkad859. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Hu S., He P., Zhang Y., Jiang M., Wang Q., Yang S., Chen S. Transcription factor DegU-mediated multi-pathway regulation on lichenysin biosynthesis in Bacillus licheniformis. Metab. Eng. 2022;74:108–120. doi: 10.1016/j.ymben.2022.10.003. [DOI] [PubMed] [Google Scholar]
  • 26.He H., Zhang Y., Shi G., Li Y. Recent biotechnological advances and future prospective of Bacillus licheniformis as microbial cell factories. Syst. Microbiol. Biomanufacturing. 2023;3:521–532. doi: 10.1007/s43393-023-00162-7. [DOI] [Google Scholar]
  • 27.Wang Q., Zheng H., Wan X., Huang H., Li J., Nomura C.T., Wang C., Chen S. Optimization of inexpensive agricultural by-products as raw materials for bacitracin production in Bacillus licheniformis DW2. Appl. Biochem. Biotech. 2017;183:1146–1157. doi: 10.1007/s12010-017-2489-1. [DOI] [PubMed] [Google Scholar]
  • 28.Konz D., Klens A., Schorgendorfer K., Marahiel M.A. The bacitracin biosynthesis operon of Bacillus licheniformis ATCC 10716: Molecular characterization of three multi-modular peptide synthetases. Chem. Biol. 1997;4:927–937. doi: 10.1016/S1074-5521(97)90301-X. [DOI] [PubMed] [Google Scholar]
  • 29.Li K., Cai D., Wang Z., He Z., Chen S. Development of an efficient genome editing tool in Bacillus licheniformis using CRISPR-Cas9 nickase. Appl. Environ. Microbiol. 2018;84:e02608-17. doi: 10.1128/AEM.02608-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Zhan Y., Zhu C., Sheng B., Cai D., Wang Q., Wen Z., Chen S. Improvement of glycerol catabolism in Bacillus licheniformis for production of poly-γ-glutamic acid. Appl. Microbiol. Biotech. 2017;101:7155–7164. doi: 10.1007/s00253-017-8459-2. [DOI] [PubMed] [Google Scholar]
  • 31.Shi J., Zhan Y., Zhou M., He M., Wang Q., Li X., Wen Z., Chen S. High-level production of short branched-chain fatty acids from waste materials by genetically modified Bacillus licheniformis. Bioresour. Technol. 2019;271:325–331. doi: 10.1016/j.biortech.2018.08.134. [DOI] [PubMed] [Google Scholar]
  • 32.Lu C., Ge Y., Cao M., Guo X., Liu P., Gao C., Xu P., Ma C. Metabolic engineering of Bacillus licheniformis for production of acetoin. Front Bioeng. Biotechnol. 2020;8:125. doi: 10.3389/fbioe.2020.00125. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Cai D., Wei X., Qiu Y., Chen Y., Chen J., Wen Z., Chen S. High-level expression of nattokinase in Bacillus licheniformis by manipulating signal peptide and signal peptidase. J. Appl. Microbiol. 2016;121:704–712. doi: 10.1111/jam.13175. [DOI] [PubMed] [Google Scholar]
  • 34.Zhang Y., Li Y., Xiao F., Wang H., Zhang L., Ding Z., Xu S., Gu Z., Shi G. CcpA mutants influence selective carbon source utilization by changing interactions with target genes in Bacillus licheniformis. Syst. Microbiol. Biomanufacturing. 2021;2:193–207. doi: 10.1007/s43393-021-00055-7. [DOI] [Google Scholar]
  • 35.Driessen A., Yang M., Zhang W., Ji S., Cao P., Chen Y., Zhao X. Generation of an artificial double promoter for protein expression in Bacillus subtilis through a promoter trap system. PLoS ONE. 2013;8:e56321. doi: 10.1371/journal.pone.0056321. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Dahi M.K., Schmiedel D., Hillen W. Glucose and glucose-6-phosphate interaction with xyl repressor proteins from Bacillus-spp may contribute to regulation of xylose utilization. J. Bacteriol. 1995;177:5467–5472. doi: 10.1128/jb.177.19.5467-5472.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Li Y., Liu X., Zhang L., Ding Z., Xu S., Gu Z., Shi G. Transcriptional changes in the xylose operon in Bacillus licheniformis and their use in fermentation optimization. Int. J. Mol. Sci. 2019;20:4615. doi: 10.3390/ijms20184615. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Li Y., Gu Z., Zhang L., Ding Z., Shi G. Inducible expression of trehalose synthase in Bacillus licheniformis. Protein Expr. Purif. 2017;130:115–122. doi: 10.1016/j.pep.2016.10.005. [DOI] [PubMed] [Google Scholar]
  • 39.Qiu Y., Xiao F., Wei X., Wen Z., Chen S. Improvement of lichenysin production in Bacillus licheniformis by replacement of native promoter of lichenysin biosynthesis operon and medium optimization. Appl. Microbiol. Biotech. 2014;98:8895–8903. doi: 10.1007/s00253-014-5978-y. [DOI] [PubMed] [Google Scholar]
  • 40.Thanh T.N., Jürgen B., Bauch M., Liebeke M., Lalk M., Ehrenreich A., Evers S., Maurer K.-H., Antelmann H., Ernst F., et al. Regulation of acetoin and 2,3-butanediol utilization in Bacillus licheniformis. Appl. Microbiol. Biotech. 2010;87:2227–2235. doi: 10.1007/s00253-010-2681-5. [DOI] [PubMed] [Google Scholar]
  • 41.Peng Q., Zhao X., Wen J., Huang M., Zhang J., Song F. Transcription in the acetoin catabolic pathway is regulated by AcoR and CcpA in Bacillus thuringiensis. Microbiol. Res. 2020;235:126438. doi: 10.1016/j.micres.2020.126438. [DOI] [PubMed] [Google Scholar]
  • 42.Xiao F., Li Y., Zhang Y., Wang H., Zhang L., Ding Z., Gu Z., Xu S., Shi G. Construction of a novel sugar alcohol-inducible expression system in Bacillus licheniformis. Appl. Microbiol. Biotech. 2020;104:5409–5425. doi: 10.1007/s00253-020-10618-8. [DOI] [PubMed] [Google Scholar]
  • 43.Lee H.K., Woo S., Baek D., Min M., Jung G.Y., Lim H.G. Direct and robust citramalate production from brown macroalgae using fast-growing Vibrio sp. dhg. Bioresour. Technol. 2024;394:130304. doi: 10.1016/j.biortech.2024.130304. [DOI] [PubMed] [Google Scholar]
  • 44.Xin B., Zhong C., Wang Y. Integrating the marine carbon resource mannitol into biomanufacturing. Trends Biotechnol. 2023;41:745–749. doi: 10.1016/j.tibtech.2022.12.010. [DOI] [PubMed] [Google Scholar]
  • 45.Xiao F., Li Y., Zhang Y., Wang H., Zhang L., Ding Z., Gu Z., Xu S., Shi G. A new CcpA binding site plays a bidirectional role in carbon catabolism in Bacillus licheniformis. iScience. 2021;24:102400. doi: 10.1016/j.isci.2021.102400. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Xue F., Ma X., Luo C., Li D., Shi G., Li Y. Construction of a bacteriophage-derived recombinase system in Bacillus licheniformis for gene deletion. AMB Express. 2023;13:89. doi: 10.1186/s13568-023-01589-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Zhang L., Li Y., Xiao F., Zhang Y., Zhang L., Ding Z., Gu Z., Xu S., Shi G. Transcriptional modulation of the global regulator CodY using a conditional CRISPRi system in Bacillus licheniformis. Syst. Microbiol. Biomanufacturing. 2024;4:953–964. doi: 10.1007/s43393-023-00229-5. [DOI] [Google Scholar]
  • 48.Li S., Xiao F., He H., Zhang Y., Liu P., Xu Y., Zhang L., Xu S., Ding Z., Shi G., et al. Multilevel regulation of lactose operon in Bacillus licheniformis: Coordination of LacR, CcpA and TnrA regulators. Food Biosci. 2024;61:104811. doi: 10.1016/j.fbio.2024.104811. [DOI] [Google Scholar]
  • 49.Gomaa L., Loscar M.E., Zein H.S., Abdel-Ghaffa N., Abdelhadi A.A., Abdelaal A.S., Abdallah N.A. Boosting isoprene production via heterologous expression of the Kudzu isoprene synthase gene (kIspS) into Bacillus spp. cell factory. AMB Expr. 2017;7:161. doi: 10.1186/s13568-017-0461-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Shen P., Niu D., Permaul K., Tian K., Singh S., Wang Z. Exploitation of ammonia-inducible promoters for enzyme overexpression in Bacillus licheniformis. J. Ind. Micro. Biotech. 2021;48:kuab037. doi: 10.1093/jimb/kuab037. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Tsigoriyna L., Arsov A., Gergov E., Petrova P., Petrov K. Influence of pH on Inulin conversion to 2,3-Butanediol by Bacillus licheniformis 24: A gene expression assay. Int. J. Mol. Sci. 2023;24:14065. doi: 10.3390/ijms241814065. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.He P., Zhang Z., Cai D., Chen Y., Wang H., Wei X., Li S., Chen S. High-level production of α-amylase by manipulating the expression of alanine racamase in Bacillus licheniformis. Biotechnol. Lett. 2017;39:1389–1394. doi: 10.1007/s10529-017-2359-5. [DOI] [PubMed] [Google Scholar]
  • 53.Trung N.T., Hung N.M., Thuan N.H., Canh N.X., Schweder T., Jürgen B. An auto-inducible phosphate-controlled expression system of Bacillus licheniformis. BMC Biotechnol. 2019;19:3. doi: 10.1186/s12896-018-0490-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Borgi M.A., Boudebbouze S., Mkaouar H., Maguin E., Rhimi M. Bacillus phytases: Current status and future prospects. Bioengineered. 2015;6:233–236. doi: 10.1080/21655979.2015.1048050. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Schroeter R., Hoffmann T., Voigt B., Meyer H., Bleisteiner M., Muntel J., Jürgen B., Albrecht D., Becher D., Lalk M., et al. Stress responses of the industrial workhorse Bacillus licheniformis to osmotic challenges. PLoS ONE. 2013;8:e80956. doi: 10.1371/journal.pone.0080956. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Hoffmann T., Bleisteiner M., Sappa P.K., Steil L., Mäder U., Völker U., Bremer E. Erhard Bremer. Synthesis of the compatible solute proline by Bacillus subtilis: Point mutations rendering the osmotically controlled proHJ promoter hyperactive. Environ. Microbiol. 2017;19:3700–3720. doi: 10.1111/1462-2920.13870. [DOI] [PubMed] [Google Scholar]
  • 57.Li B., Cai D., Hu S., Zhu A., He Z., Chen S. Enhanced synthesis of poly gamma glutamic acid by increasing the intracellular reactive oxygen species in the Bacillus licheniformis Δ1-pyrroline-5-carboxylate dehydrogenase gene ycgN-deficient strain. Appl. Microbiol. Biotechnol. 2018;102:10127–10137. doi: 10.1007/s00253-018-9372-z. [DOI] [PubMed] [Google Scholar]
  • 58.Freitals P.A.F., Carvalho H.H., Costa J.H., Miranda R.S., Saraiva K.D.C., Oliverira F.D.B., Coelho D.G., Prisco J.T., Gomes-Filho E. Salt acclimation in sorghum plants by exogenous proline: Physiological and biochemical changes and regulation of proline metabolism. Plant Cell Rep. 2019;38:403–416. doi: 10.1007/s00299-019-02382-5. [DOI] [PubMed] [Google Scholar]
  • 59.Guo J., Cheng G., Gou X.Y., Xing F., Li S., Han Y.C., Wang L., Song J.M., Shu C.C., Chen S.W., et al. Comprehensive transcriptome and improved genome annotation of Bacillus licheniformis WX-02. FEBS Lett. 2015;589:2372–2381. doi: 10.1016/j.febslet.2015.07.029. [DOI] [PubMed] [Google Scholar]
  • 60.Bindal S., Gupta R. Hyperproduction of γ-glutamyl transpeptidase from Bacillus licheniformis ER15 in the presence of high salt concentration. Prep. Biochem. Biotech. 2017;47:163–172. doi: 10.1080/10826068.2016.1188314. [DOI] [PubMed] [Google Scholar]
  • 61.ParK M.K., Hong C.P., Kim B.S., Lee D.Y., Kim Y.S. Integrated-Omics study on the transcriptomic and metabolic changes of Bacillus licheniformis, a main microorganism of fermented soybeans, according to alkaline pH and osmotic stress. J. Agric. Food Chem. 2023;71:14379–14389. doi: 10.1021/acs.jafc.3c01900. [DOI] [PubMed] [Google Scholar]
  • 62.Hornbæk T., Jakobsen M., Dynesen J., Nielsen A.K. Global transcription profiles and intracellular pH regulation measured in Bacillus licheniformis upon external pH upshifts. Arch. Microbiol. 2004;182:467–474. doi: 10.1007/s00203-004-0729-6. [DOI] [PubMed] [Google Scholar]
  • 63.Wang J., Yuan H., Wei X., Chen J., Chen S. Enhancement of poly-γ-glutamic acid production by alkaline pH stress treatment in Bacillus licheniformis WX-02. J. Chem. Technol. Biot. 2015;91:2399–2403. doi: 10.1002/jctb.4822. [DOI] [Google Scholar]
  • 64.Shardendu K.T. pH modulates arsenic toxicity in Bacillus licheniformis DAS-2. Ecotox. Environ. Saf. 2016;130:240–247. doi: 10.1016/j.ecoenv.2016.04.029. [DOI] [PubMed] [Google Scholar]
  • 65.Dong Z., Chen X., Cai K., Chen Z., Wang H., Jin P., Liu X., Permaul K., Singh S., Wang Z. Exploring the metabolomic responses of Bacillus licheniformis to temperature stress by gas chromatography/mass spectrometry. J. Microbiol. Biotechnol. 2018;28:473–481. doi: 10.4014/jmb.1708.08019. [DOI] [PubMed] [Google Scholar]
  • 66.Dong Z., Chen Z., Wang H., Tian K., Jin P., Liu X., Mchunu N.P., Permaul K., Singh S., Niu D., et al. Tandem mass tag-based quantitative proteomics analyses reveal the response of Bacillus licheniformis to high growth temperatures. Ann. Microbiol. 2017;67:501–510. doi: 10.1007/s13213-017-1279-x. [DOI] [Google Scholar]
  • 67.Wang N., Gao J., Yuan L., Jin Y., He G. Metabolomics profiling during biofilm development of Bacillus licheniformis isolated from milk powder. Int. J. Food Microbiol. 2021;337:108939. doi: 10.1016/j.ijfoodmicro.2020.108939. [DOI] [PubMed] [Google Scholar]
  • 68.Lo H.F., Chen B.E., Lin M.G., Chi M.U., Wang T.F., Lin L.L. Gene expression and molecular characterization of a chaperone protein HtpG from Bacillus licheniformis. Int. J.Biol. Macromol. 2016;85:179–191. doi: 10.1016/j.ijbiomac.2015.12.080. [DOI] [PubMed] [Google Scholar]
  • 69.Li Y., Ma X., Zhang L., Ding Z., Xu S., Gu Z., Shi G. ; Engineering of Bacillus promoters based on interacting motifs between UP elements and RNA polymerase (RNAP) alpha-subunit. Int. J. Mol. Sci. 2022;23:13480. doi: 10.3390/ijms232113480. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70.Rao Y., Cai D., Wang H., Xu Y., Xiong S., Gao L., Xiong M., Wang Z., Chen S., Ma X. Construction and application of a dual promoter system for efficient protein production and metabolic pathway enhancement in Bacillus licheniformis. J. Biotechnol. 2020;312:1–10. doi: 10.1016/j.jbiotec.2020.02.015. [DOI] [PubMed] [Google Scholar]
  • 71.Agaisse H., Lereclus D. STAB-SD: A Shine–Dalgarno sequence in the 5′ untranslated region is a determinant of mRNA stability. Mol. Microbiol. 2003;20:633–643. doi: 10.1046/j.1365-2958.1996.5401046.x. [DOI] [PubMed] [Google Scholar]
  • 72.Xiao J., Peng B., Su Z., Liu A., Hu Y., Nomura C.T., Chen S., Wang Q. Facilitating protein expression with portable 5′-UTR secondary structures in Bacillus licheniformis. ACS Syn. Bio. 2020;9:1051–1058. doi: 10.1021/acssynbio.9b00355. [DOI] [PubMed] [Google Scholar]
  • 73.Bouraoui H., Ventroux M., Noirot-Gros M.F., Deutscher J., Joyet P. Membrane sequestration by the EIIB domain of the mannitol permease MtlA activates the Bacillus subtilis mtl operon regulator MtlR. Mol. Microbiol. 2013;87:789–801. doi: 10.1111/mmi.12131. [DOI] [PubMed] [Google Scholar]
  • 74.Xiao F., Zhang Y., Zhang L., Ding Z., Shi G., Li Y. Construction of the genetic switches in response to mannitol based on artifical MtlR box. Bioresour. Bioprocess. 2023;10:9. doi: 10.1186/s40643-023-00634-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 75.Heravi K.M., Wenzel M., Altenbuchner J. Regulation of mtl operon promoter of Bacillus subtilis: Requirements of its use in expression vectors. Microb. Cell Fact. 2011;10:83. doi: 10.1186/1475-2859-10-83. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 76.Zhang Y., Li Y., Xiao F., Wang H., Zhang L., Ding Z., Xu S., Gu Z., Shi G. Engineering of a biosensor in response to malate in Bacillus licheniformis. ACS Synth. Biol. 2021;10:1775–1784. doi: 10.1021/acssynbio.1c00170. [DOI] [PubMed] [Google Scholar]
  • 77.Faure G., Ogurtsov A.Y., Shabalina S.A., Koonin E.V. Role of mRNA structure in the control of protein folding. Nucleic Acids Res. 2016;44:10898–10911. doi: 10.1093/nar/gkw671. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 78.Rao X., Li D., Su Z., Nomura C.T., Chen S., Wang Q. A smart RBS library and its prediction model for robust and accurate fine-tuning of gene expression in Bacillus species. Metab. Eng. 2024;81:1–9. doi: 10.1016/j.ymben.2023.11.002. [DOI] [PubMed] [Google Scholar]
  • 79.Zhang M., Song J., Xiao J., Jin J., Nomura C.T., Chen S., Wang Q. Engineered multiple translation initiation sites: A novel tool to enhance protein production in Bacillus licheniformis and other industrially relevant bacteria. Nucleic Acids Res. 2022;50:11979–11990. doi: 10.1093/nar/gkac1039. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 80.Zhou M., Li Y., Che H., Sun Y., Wang S., Zhan Y., Cai D., Chen S. Metabolic engineering of Bacillus licheniformis for the bioproduction of nicotinamide riboside from nicotinamide and glucose. ACS Sustain. Chem. Eng. 2023;11:6201–6210. doi: 10.1021/acssuschemeng.2c07271. [DOI] [Google Scholar]
  • 81.Zhan Y., Zhou M., Wang H., Chen L., Li Z., Cai D., Wen Z., Ma X., Chen S. Efficient synthesis of 2-phenylethanol from L-phenylalanine by engineered Bacillus licheniformis using molasses as carbon source. Appl Micro. Biotech. 2020;104:7507–7520. doi: 10.1007/s00253-020-10740-7. [DOI] [PubMed] [Google Scholar]
  • 82.Wu Y., Liu Y., Lv X., Li J., Du G., Liu L. CAMERS-B: CRISPR/Cpf1 assisted multiple-genes editing and regulation system for Bacillus subtilis. Biotechnol. Bioeng. 2020;117:1817–1825. doi: 10.1002/bit.27322. [DOI] [PubMed] [Google Scholar]
  • 83.Hao W., Cui W., Liu Z., Suo F., Wu Y., Han L., Zhou Z. A new-generation base editor with an expanded editing window for microbial cell evolution in vivo based on CRISPR‒Cas12b engineering. Adv. Sci. 2024;11:e2309767. doi: 10.1002/advs.202309767. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 84.Guo Y., Xia Y., Liang Z., Yang S., Guo S., Sun L., Huo Y. Plasmid-stabilizing strains for antibiotic-free chemical fermentation. Acs. Synth. Biol. 2024 doi: 10.1021/acssynbio.4c00241. Online ahead of print . [DOI] [PubMed] [Google Scholar]
  • 85.Fu G., Yue J., Li D.D., Li Y.X., Lee S.Y., Zhang D.W. An operator-based expression toolkjt for Bacillus subtilis enables fine-tuning of gene expression and biosynthetic pathway regulation. Proc. Natl. Acad. Sci. USA. 2022;119:e2119980119. doi: 10.1073/pnas.2119980119. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 86.Ravikumar S., David Y., Park S.J., Choi J.-i. A chimeric two-component regulatory system-based Escherichia coli biosensor engineered to detect glutamate. Appl. Biochem. Biotech. 2018;186:335–349. doi: 10.1007/s12010-018-2746-y. [DOI] [PubMed] [Google Scholar]
  • 87.Morawska L.P., Detert Oude Weme R.G.J., Frenzel E., Dirkzwager M., Hoffmann T., Bremer E., Kuipers O.P. Stress-induced activation of the proline biosynthetic pathway in Bacillus subtilis: A population-wide and single-cell study of the osmotically controlled proHJ promoter. Microb. Biotechnol. 2022;15:2411–2425. doi: 10.1111/1751-7915.14073. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 88.Wang Y., Lin Y., Lu X., Zhuge B., Zong H. Selection and application of novel high temperature inducible promoters in the tolerant yeast Candida glycerinogenes. J. Biosci. Bioeng. 2020;130:1–5. doi: 10.1016/j.jbiosc.2020.02.006. [DOI] [PubMed] [Google Scholar]
  • 89.Arbab S., Ullah H., Khan M.I.U., Khattak M.N.K., Zhang J., Li K., Hassan I.U. Diversity and distribution of thermophilic microorganisms and their applications in biotechnology. J. Basic Microb. 2021;62:95–108. doi: 10.1002/jobm.202100529. [DOI] [PubMed] [Google Scholar]
  • 90.Dong Z., Chen X., Cai K., Shen P., Tian K., Jin P., Liu X., Wang Z. Overexpression of the Bacillus licheniformis GroES enhances thermotolerance of Bacillus subtilis WB600. Biotechnol. Biotechnol. Equip. 2018;32:1527–1532. doi: 10.1080/13102818.2018.1517029. [DOI] [Google Scholar]
  • 91.Wu L., Wei W., Chen Z., Chen X., Ni B.-J. Long-chain alcohol production in open culture anaerobic fermentation. Chem. Eng. J. 2023;452:139225. doi: 10.1016/j.cej.2022.139225. [DOI] [Google Scholar]
  • 92.Gudiña E.J., Teixeira J.A. Bacillus licheniformis: The unexplored alternative for the anaerobic production of lipopeptide biosurfactants? Biotechnol. Adv. 2022;60:108013. doi: 10.1016/j.biotechadv.2022.108013. [DOI] [PubMed] [Google Scholar]
  • 93.Cai D., Hu S., Chen Y., Liu L., Yang S., Ma X., Chen S. Enhanced Production of Poly-γ-glutamic acid by overexpression of the global anaerobic regulator Fnr in Bacillus licheniformis WX-02. Appl. Biochem. Biotech. 2018;185:958–970. doi: 10.1007/s12010-018-2693-7. [DOI] [PubMed] [Google Scholar]
  • 94.Iram A., Dong Y., Ignea C. Synthetic biology advances towards a bio-based society in the era of artificial intelligence. Curr. Opin. Biotech. 2024;87:130143. doi: 10.1016/j.copbio.2024.103143. [DOI] [PubMed] [Google Scholar]

Articles from Microorganisms are provided here courtesy of Multidisciplinary Digital Publishing Institute (MDPI)

RESOURCES