Skip to main content
NCBI home page
International Journal of Microbiology logoLink to International Journal of Microbiology
. 2024 Aug 23;2024:4674138. doi: 10.1155/2024/4674138

Virulence and Antimicrobial-Resistant Gene Profiles of Salmonella spp. Isolates from Chicken Carcasses Markets in Ibague City, Colombia

Kelly Johanna Lozano-Villegas 1,2, Iang Schroniltgen Rondón-Barragán 1,2,✉
PMCID: PMC11364481  PMID: 39220438

Abstract

Salmonella spp. is one of the leading causes of foodborne bacterial infections, with major impacts on public health and healthcare system. Salmonella is commonly transmitted via the fecal-to-oral route, and food contaminated with the bacteria (e.g., poultry products) is considered a common source of infection, being a potential risk for public health. The study aims to characterize the antimicrobial resistance- and virulence-associated genes in Salmonella isolates recovered from chicken marketed carcasses (n = 20). The presence of 14 antimicrobial and 23 virulence genes was evaluated using end-point PCR. The antimicrobial genes were detected in the following proportion among the isolates: blaTEM 100%, dfrA1 and blaCMY2 90% (n = 18), aadA1 75% (n = 15), sul1 and sul2 50% (n = 10), floR 45% (n = 9), qnrD 20% (n = 4), and aadA2 15% (n = 3). catA, sul3, qnrS, and aac(6′)-Ib genes were absent in all isolates. Regarding virulence-associated genes, all Salmonella strains contain invA, fimA, avrA, msgA, sopB, and sopE. The cdtB gene was present in 95% (n = 19) of isolates, whereas spvC and spvB were present in 55% (n = 11). Other virulence genes such as spiC, lpfC, lpfA, and csgA were present in 90% (n = 18) of strains. The presence of antimicrobial and virulence genes in several Salmonella strains in chicken meat suggests the potential pathogenicity of the strains, which is relevant given the possibility of cross-contamination which represents a significant threat to public health.

1. Introduction

Foodborne diseases caused by microorganisms are a significant global public health concern [1]. According to the Centers for Disease Control and Prevention (CDC), foodborne pathogens with the highest annual burden of disease and overall impact on public health are Campylobacter, Listeria monocytogenes, Salmonella, STEC, Shigella, Vibrio, and Yersinia [2, 3]. Salmonella spp. infections are among the leading causes of foodborne bacterial infections, with major impacts on human health and the economy [4–6]. Salmonella remains one of the most burdensome foodborne pathogens globally, with an estimated 200 million to over 1 billion infections, 93 million gastroenteritis cases, and 155,000 fatalities [7].

Currently, more than 2600 different serotypes of Salmonella have been identified, but only a small number of these are commonly associated with foodborne illnesses in humans [8]. In clinical human medicine, Salmonella serotypes can be grouped into typhoidal serotypes (Salmonella Typhi and Salmonella Paratyphi A, B, C) and non-typhoidal Salmonella serotypes (NTS) (caused by other Salmonella strains) [9, 10]. The typhoidal Salmonellas are invasive and cause systematic infection [11, 12]. In contrast, NTS serotype infections cause diarrhea, nausea, vomiting, abdominal pain, myalgia, and arthralgia and are usually self-limiting, although immunocompromised patients can develop a sepsis [13, 14].

The route of Salmonella spp. transmission is commonly through a fecal-to-oral route with the consumption of contaminated food or water [15, 16]. Many foods containing Salmonella are derived from animals (such as eggs, poultry, seafood, and meat), and the transfer of bacteria to these products occurs as a result of cross-contamination during food processing [17, 18]. Epidemiological studies have identified poultry meat as the main vehicle for Salmonella infection [17, 19]. Poultry meat serves as a good environment for the growth of pathogenic Salmonella spp. due to its high nutrient content, pH of 5.5 to 6.5, and water [7, 20]. However, the prevalence of Salmonella in poultry products depends on the type of poultry store (supermarkets and fresh food markets) [21].

Currently, several studies have identified that Salmonella isolates from chicken farms carry mobile genetic elements (MGEs) that contribute to increased pathogenicity and antimicrobial resistance [22–25]. MGEs include plasmids, integrons, and transposons, which play a crucial role in the dissemination of antibiotic resistance genes (ARGs) and the development of biofilm-mediated antibiotic resistance [26]. Salmonella pathogenicity is mediated by virulence genes, which facilitate the survival, colonization, and damage of the host [27]. Consequently, identification and assessment of pathogenic potential and antimicrobial resistance of Salmonella serovars in chicken and poultry products is crucial for disease assessment and epidemiological surveillance [21]. Thus, this study aimed to characterize the antimicrobial resistance- and virulence-associated genes in Salmonella isolates recovered from chicken carcasses marketed in Ibague, Colombia.

In Colombia, a study on 1.003 retail broiler chicken carcasses reported that 27% were contaminated with Salmonella, indicating a risk of infection from poultry products in the country [28]. However, the prevalence of Salmonella spp. in chicken carcasses varied among Colombian cities, ranging from 0% to 57% [28]. For example, in Ibague (central region of Colombia), Salmonella Enteritidis was identified as a significant source of salmonellosis, particularly linked to contaminated eggs and raw chicken meat, emphasizing the genetic relationship between isolates from poultry and human gastroenteritis cases [29]. Additionally, studies on raw chicken meat sold in Ibague revealed a high prevalence of Salmonella, with specific serotypes such as S. Paratyphi B, S. Hvittingfoss, and S. Muenster being predominant and posing a potential threat to human health due to multidrug resistance patterns [30]. Thus, this study aimed to characterize the antimicrobial resistance- and virulence-associated genes in Salmonella isolates recovered from chicken carcasses marketed in Ibague, Colombia.

2. Materials and Methods

2.1. Ethical Approval

Ethical approval was not required for this study. Salmonella spp. strains were obtained from the Bacterial Strain Collection at the Laboratory of Immunology and Molecular Biology (Universidad del Tolima).

2.2. Salmonella Strains

Twenty strains of Salmonella previously isolated from broiler carcasses marketed at Ibague, Colombia, were used in this study [31]. The strains used were previously serotyped using the Kauffmann–White scheme as Salmonella Paratyphi B (n = 5), Salmonella Manhattan (n = 1), Salmonella Bovismorbificans (n = 1), Salmonella Typhimurium (n = 2), Salmonella Othmarschen (n = 1), Salmonella Newport (n = 1), Salmonella Hvittingfoss (n = 5), Salmonella Heidelberg (n = 1), and Salmonella Muenster B (n = 3).

2.3. Genomic DNA Extraction and Molecular Confirmation of Salmonella

Genomic DNA (gDNA) was extracted from fresh bacterial colonies using Wizard® Genomic DNA Purification Kit (Promega, USA) according to the manufacturer's conditions. DNA samples were stored at −20°C prior to use. Molecular confirmation of Salmonella isolates was performed by amplification of a 284 bp fragment of the invA gene (accession number: M90846.1) by endpoint polymerase chain reaction (PCR), using Salmonella Enteritidis (ATCC 13076®) as positive control and E. coli (ATCC 25922®) as negative control [31].

2.4. Molecular Detection of Antibiotic Resistance Genes and Virulence-Associated Genes

Fourteen antibiotic resistance genes (ARGs) were examined in all isolates by endpoint PCR using specific primers described in Table 1. The ProFlex™ PCR System (Applied Biosystems, Waltham, MA, USA) was utilized for conducting the reactions, using a final volume of 25 μL made up of 14,875 µL deionized distilled water, 5 μL of Flexi Buffer 5× Colorless GoTaq® (Promega, Madison, WI, USA), 1 µL of dNTPs (Invitrogen, Carlsbad, CA, USA), 1 µL of each primer (forward and reverse) (10 pmol/Μl) (Macrogen, Seoul, Korea), 1 μL of MgCl2 (25 mM) (Promega, Madison, WI, USA), 0.125 μL of GoTaq Flexi DNA Polymerase (Promega, Madison, WI, USA), and as template 1 µL of gDNA. PCR amplification was performed with the following conditions: initial denaturation at 95°C for 3 minutes, 35 cycles of denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, extension at 72°C for 30 seconds, and final extension at 72°C for 8 minutes. For all experiments, Salmonella spp. strains previously characterized in the Laboratory of Immunology and Molecular Biology were used as reference strains. The annealing temperature and extension time were defined based on the primer melting temperatures and the expected amplicon size (Table 1).

Table 1.

Primer sequences used for amplification of resistance genes.

Antimicrobial family Antibiotic Gene Primer sequences (5′-3′) Amplicon size (bp) References
β-Lactams Ceftriaxone bla CMY2 F-AAATCGTTATGCTGCGCTCT 224 [32]
R-CCGATCCTAGCTCAAACAGC
Ampicillin bla TEM F-ATCAGTTGGGTGCACGAGTG 236
R-ACGCTCACCGGCTCCAGA
Chloramphenicol Chloramphenicol catA F-CCAGACCGTTCAGCTGGATA 454
R-CATCAGCACCTTGTCGCCT
Florfenicol floR F-CACGTTGAGCCTCTATATGG 888
R-CACGTTGAGCCTCTATATGG
Aminoglycoside Streptomycin aadA1 F-CTCCGCAGTGGATGGCGG 631
R-GATCTGCGCGCGAGGCC
aadA2 F-CATTGAGCGCCATCTGGAAT 500
R-ACATTTCGCTCATCGCCGGC
Tetracycline Trimethoprim dfrA1 F-CAATGGCTGTTGGTTGGAC 254
R-CCGGCTCGATGTCTATTGT
dfrA12 F-TTCGCAGACTCACTGAGGG 330
R-CGGTTGAGACAAGCTCGAAT
Sulfonamide Sulfamethoxazole sul1 F-CGGACGCGAGGCCTGTATC 591
R-GGGTGCGGACGTAGTCAGC
sul2 F-GCGCAGGCGCGTAAGCTGAT 514
R-CGAAGCGCAGCCGCAATTC
sul3 F-GGGAGCCGCTTCCAGTAAT 500
R-TCCGTGACACTGCAATCATTA
Quinolone Quinolone and fluoroquinolone qnrD F-CGAGATCAATTTACGGGGAATA 582 [33]
R-AACAAGCTGAAGCGCCTG
qnrS F-ACGACATTCGTCAACTGCAA 417
R-TAAATTGGCACCCTGTAGGC
aac (6′)-Ib
qnrD 		F-TTGCGATGCTCTATGAGTGGCTA 482
582
F-CGAGATCAATTTACGGGGAATA
Open in a new tab

2.5. Molecular Detection of Virulence-Associated Genes and Integrons

The determination of twenty-three Salmonella virulence genes was performed by PCR using the conditions described previously. Primers sequences, annealing temperature, amplicon size, and corresponding references are listed in Table 2. For integron detection, gDNA from isolates was used as a template for the reaction, using gene-specific primer sets (Table 2). PCR conditions were as described above, and the annealing temperature is listed in Table 2.

Table 2.

Primer sequences used for amplification of virulence genes.

Category Gene Broad action Primer sequences (5′-3′) Annealing temperature (°C) Amplicon size (bp) References
SPIs
SPI-1 fimA Fimbriae F: CCTTTCTCCATCGTCCTGAA 55 85 [34]
R: TGGTGTTATCTGCCTGACCA
sitC Iron metabolism F-CAGTATATGCTCAACGCGATGTGGGTCTCC 58 768 [35]
R-CGGGGCGAAAATAAAGGCTGTGATGAAC
spaN F-AAAAGCCGTGGAATCCGTTAGTGAAGT 55 504
R-CAGCGCTGGGGATTACCGTTTTG
sipB F-GGACGCCGCCCGGGAAAAACTCTC 58 875
R-ACACTCCCGTCGCCGCCTTCACAA
invA F-GTGAAATTATCGCCACGTTCGGGCAA 55 284
R-TCATCGCACCGTCAAAGGAACC
hilA Regulatory protein—(TTSS) F-CTGCCGCAGTGTTAAGGATA 50 497
R-CTGTCGCCTTAATCGCATGT
avrA Effector protein—the invasion-(TTSS) F-AGCCTGGCGCTCGCCAAAAA 57 123 [36]
R-GCGGTCTGCTTTATCGGACGGG
SPI-2 spiA Survival inside cells F-CCAGGGGTCGTTAGTGTATTGCGTGAGATG 56 550 [35]
R-CGCGTAACAAAGAACCCGTAGTGATGGATT
sifA Effector protein—the invasion-(TTSS) F-TTTGCCGAACGCGCCCCCACACG 58 449
R-GTTGCCTTTTCTTGCGCTTTCCACCCATCT
SPI-3 msgA Survival inside cells F-GCCAGGCGCACGCGAAATCATCC 57 189
R-GCGACCAGCCACATATCAGCCTCTTCAAAC
SPI-4 siiD Adaptor protein—(T1SS) F: GTCAGGGCGTTATCACTACTAAA 55 826 [37]
R: TTCACATCGGCCAGCATAG
SPI-5 sopB Effector protein—the invasion-(TTSS) F-CGGACCGGCCAGCAACAAAACAAGAAGAAG 55 220 [35]
R-TAGTGATGCCCGTTATGCGTGAGTGTATT
SPI-6 sefA Fimbriae F-GATACTGCTGAACGTAGAAGG 54 488
R-GCGTAAATCAGCATCTGCAGTAGC
SPI-7 sopE Effector protein—the invasion-(TTSS) F-GAGGGCCGGGCAGTGTTGAC 55 121 [36]
R-CTTCACGGGTCTGGCTGGCG
Non-SPI genes
Plasmid spvC PSLT plasmid F: ACTCCTTGCACAACCAAATGCGGA 59 572 [34]
R: TGTCTTCTGCATTTCGCCACCATCA
spvB F-CTATCAGCCCCGCACGGAGAGCAGTTTTTA 58 717 [35]
R-GGAGGAGGCGGTGGCGGTGGCATCATA
Toxins cdtB Non-SPI genes F-ACAACTGTCGCATCTCGCCCCGTCATT 57 268
R-CAATTTGCGTGGGTTCTGTAGGTGCGAGT
Fimbriae lpfC Adhesins other adhesins F-GCCCCGCCTGAAGCCTGTGTTGC 57 641
R-AGGTCGCCGCTGTTTGAGGTTGGATA
pefA F-GCGCCGCTCAGCCGAACCAG 55 157
R-GCAGCAGAAGCCCAGGAAACAGTG
lpfA F-CTTTCGCTGCTGAATCTGGT 57 250
R-CAGTGTTAACAGAAACCAGT
pagC F-CGCCTTTTCCGTGGGGTATGC 55 454
R-GAAGCCGTTTATTTTTGTAGAGGAGATGTT
csgA Adhesins curli fibers (AGF) F-TCCACAATGGGGCGGCGGCG 54 350
R-CCTGACGCACCATTACGCTG
Integrons
intI1 F-TCCACGCATCGTCAGGC 55 280 [38]
R-CCTCCCGCACGATGATC
intI2 F-GGCAGACAGTTGCAAGACAA 57 247 [32]
R-AAGCGATTTTCTGCGTGTTT
intI23 F-CCGGTTCAGTCTTTCCTCAA 57 155
R-GAGGCGTGTACTTGCCTCAT
Open in a new tab

2.6. Gel Electrophoresis and Visualization

All amplification products were revealed by gel electrophoresis in 2% agarose gel in 0.5x TBE buffer stained with HydraGreen™ (ACTGene, Piscataway, NJ, USA). 3 μL PCR products were loaded in each well with 100 bp DNA Ladder (NEB, Ipswich, MA, USA) as the molecular weight marker. Electrophoresis was conducted at 100 V for 40 minutes using the PowerPac™ HC gel electrophoresis system (Bio-Rad, Hercules, CA, USA) containing 0.5x TBE buffer. The ENDURO™ GDS gel documentation system (Labnet International, Edison, NJ, USA) was utilized to visualize and document amplification products.

2.7. Statistical Analysis

All data were analyzed using Microsoft Excel. Prevalence as the ratio of positive animals to the total number of samples is expressed as a percentage [39].

3. Results

3.1. Distribution of Antibiotic Resistance Genes among Salmonella Serovars

Among the β-lactamase-encoding genes (blaTEM and blaCMY2), only blaCMY2, which confers resistance to ampicillin, was detected in all the strains (100%), and blaCMY2, which confers resistance to ceftriaxone, was found at a high frequency (90%; n = 18) (Table 3). Among the genes specific for chloramphenicol, such as catA and floR, only floR, which confers resistance to florfenicol, was detected in 45% (n = 9) of Salmonella strains. Regarding the genes that encode aminoglycoside resistance, aadA1 and aadA2 were found to be in 75% (n = 15) and 15% (n = 3) of strains, respectively (Table 3).

Table 3.

Genotypic antibiotic resistance profiles of Salmonella spp. isolates.∗

graphic file with name IJMICRO2024-4674138.tab3.i001.jpg
Open in a new tab

∗For PCR-based patterns, black box indicates that the detection of the resistance gene was positive and white box indicates that the detection of the resistance gene was negative. Abbreviations: Ceft, Ceftriaxone; Amp, Ampicillin; Chlor, Chloramphenicol; Flor, Florfenicol.

Gene cassettes encoding resistance to trimethoprim, such as dfrA1 and dfrA12, were present in 95% (n = 15) and 20% (n = 4) of strains, respectively. Regarding sulfonamide resistance, only sul1 and sul2 genes were detected in 50% (n = 10) of Salmonella strains. Moreover, among the quinolone and fluoroquinolone resistance genes evaluated, only qnrD, a plasmid-mediated quinolone resistance gene, was detected among Salmonella strains (20%; n = 4).

3.2. Distribution of Virulence-Associated Genes among Salmonella Serovars

All 20 Salmonella isolates were assessed by PCR for virulence genes presence. All Salmonella strains amplified the expected DNA fragment of gene operon invasion A (InvA) that was used to confirm the Salmonella genus (Figure 1). In most isolates, all SPI-1 genes were present; fimA, sitC, spaN, sipB, hilA, and avrA were found to be 100%, 80% (n = 16), 80% (n = 16), 65% (n = 13), 100%, 85% (n = 17), 100%, and 90% (n = 18) in the isolates tested, respectively. In addition, virulence genes located on SPI-3 (msgA), SPI-5 (sopB), and SPI-7 (sopE) were present in all the serotypes. Likewise, virulence genes located on SPI-4, such as siiD (60%; n = 12), and SPI-6, such as sefA (65%; n = 13), were present at a lower frequency of strains.

Figure 1.

Figure 1

Open in a new tab

PCR amplification of a 284 bp fragment from the invA gene of Salmonella isolated from carcasses marketed in Ibague, Colombia. M: molecular-weight size marker, 100 bp DNA ladder (New England Biolabs, Ipswich, MA, USA); Lane 1: UT-SPb14007 S. Paratyphi B; Lane 2: UT-SPb14008 S. Paratyphi B; Lane 3: UT-SPb14012 S. Manhattan; Lane 4: UT-SPb14016 S. Bovismorbificans; Lane 5: UT-SPb14017 S. Typhimurium; Lane 6: UT-SPb14018 S. Typhimurium; Lane 7: UT-SPb14019 S. Othmarschen; Lane 8: UT-SPb14021 S. Newport; Lane 9: UT-SPb14024 S. Hvittingfoss; Lane 10: UT-SPb14027 S. Heidelberg; Lane 11: UT-SPb14028 S. Hvittingfoss; Lane 12: UT-SPb14030 S. Hvittingfoss; Lane 13: UT-SPb14032 S. Hvittingfoss; Lane 14: UT-SPb14033 S. Hvittingfoss; Lane 15: UT-SPb14034 S. Paratyphi B; Lane 16: UT-SPb14035 S. Muenster; Lane 17: UT-SPb14037 S. Muenster; Lane 18: UT-SPb14039 S. Muenster; Lane 19: UT-SPb14043 S. Paratyphi B; Lane 20: UT-SPb14047 S. Paratyphi B.

Moreover, the frequencies of virulence genes were in non-SPI category. Genes located on the Salmonella virulence plasmid, such as spvC and spvB, were present in 55% (n = 11) of the Salmonella isolates. In addition, the cdtB gene encoding typhoid toxins was present in 95% (n = 19) of the isolates. Furthermore, the fimbrial genes lpfC, pefA, lpfA, pagC, and csgA were found in 90% (n = 18), 70% (n = 14), 90% (n = 18), 85% (n = 17), and 90% (n = 18) of the isolates tested, respectively.

3.3. Distribution of Class 1, 2, and 3 Integrons

Class 1 and 3 integrons were not detected in any of the Salmonella strains. In contrast, class 2 integrons were present in 19 strains (Figure 2).

Figure 2.

Figure 2

Open in a new tab

PCR amplification of a ≈247 bp fragment from the intI2 gene of Salmonella isolated from carcasses marketed in Ibague, Colombia. M: molecular-weight size marker, 100 bp DNA ladder (New England Biolabs, Ipswich, MA, USA). Lane 1: UT-SPb14007; Lane 2: UT-SPb14008; Lane 3: UT-SPb14012; Lane 4: UT-SPb14016; Lane 5: UT-SPb14017; Lane 6: UT-SPb14018; Lane 7: UT-SPb14019; Lane 8: UT-SPb14021; Lane 9: UT-SPb14024; Lane 10: UT-SPb14028; Lane 11: UT-SPb14030; Lane 12: UT-SPb14032; Lane 13: UT-SPb14033; Lane 14: UT-SPb14034; Lane 15: UT-SPb14035; Lane 16: UT-SPb14037; Lane 17: UT-SPb14039; Lane 18: UT-SPb14043; Lane 19: UT-SPb14047.

4. Discussion

Poultry meat is one of the most economical and consumable sources of animal protein [40, 41]. However, poultry meat production involves several stages before the meat reaches consumers [42]. Among the stages of poultry production, food safety is an important consideration because of the bacterial pathogens present in broilers, such as Salmonella [43]. Contaminated poultry products are the major source of human Salmonella infection [44]. Contamination can occur at various stages during production on the farm (preharvest stage), during transportation to the processing plant, at slaughter and evisceration (processing stage), post-evisceration processing, cutting and boning, packaging and storage, distribution and retail, and transportation and handling [45, 46]. Also, Salmonella strains isolated from poultry products exhibit high levels of resistance to antibiotics, making disease control difficult and posing serious risks to global public health [47]. To minimize the impact of Salmonella-related outbreaks, determining the susceptibility of the bacteria to antimicrobial agents is essential [48].

Among the 20 Salmonella strains, antimicrobial resistance- and virulence-associated genes were determined to explore the molecular mechanisms underlying multidrug resistance (MDR) and pathogenicity. The most common resistance genes found were those encoding for β-lactams (blaTEM and blaCMY−2), tetracycline (dfrA1), streptomycin (aadA1), and sulfonamide (sul1 and sul2). The family of β-lactam antibiotics is the most prescribed family of antibiotics prescribed to treat bacterial infections [49]. Nevertheless, their use has been limited by the emergence of bacteria with resistance mechanisms, such as β-lactamases [50]. Some mechanisms by which bacteria acquire resistance to β-lactams include the production of β-lactamases, efflux pumps, and alterations in penicillin-binding proteins [51]. The β-lactamase-encoding genes blaTEM and blaCMY−2 were predominant among the antimicrobial resistance genes detected. These findings are similar to previous studies that have reported blaTEM and blaCMY−2 as the main genes involved in the mechanisms of resistance to β-lactam antibiotics and cephalosporins, respectively [52, 53]. This differs with the prevalence rates reported in a previous study conducted in China on Salmonella isolated from chickens, where the rates of blaTEM and blaCMY−2β-lactamase genes were 61.11%, and 63.89%, respectively.

Regarding sulfamethoxazole resistance (sul) genes, high positivity rates for sul1 (50%), and sul2 (50%) were observed, which is in accordance with previous reports that indicate sul1 and sul2 genes are the most frequently detected Sul genes in Salmonella spp. [54, 55]. This is relevant because sulfonamide resistance usually arises from the acquisition of sul1 and sul2 genes, which encode forms of dihydropteroate synthase that are not inhibited by the drug [56]. Also, in Brazil, 68% of Salmonella isolated from chicken meat samples contained sul2 [57]. The detection of sul genes in Salmonella strains isolated from carcasses is relevant because of the potential transfer of these genes from commensal bacteria into more virulent bacteria via integrons, transposons, or plasmids [58, 59]. Concerning chloramphenicol resistance genes, the floR gene was found in 45% of the Salmonella strains. In addition, in previous studies from China, floR was identified in 35.1% of Salmonella strains isolated from chickens, ducks, and pigs [60]. The frequency of this gene could be related to the long-term use of florfenicol in veterinary medicine, leading to the appearance of these resistance genes [61]. For example, floR is particularly prevalent in multidrug-resistant strains of Salmonella isolated from poultry [52].

Dihydrofolate reductase gene (dfrA1), which conferred resistance to trimethoprim (integron-encoded dihydrofolate reductase), was commonly detected between Salmonella strains (95%). Also, high positivity rates for dfrA1 gene were reported on isolates recovered from clinical and environmental samples [62]. A comparative study conducted in Iraq reported 77.6% of isolates resistant to dfrA1 gene [63]. Furthermore, 15 (75%) Salmonella strains contained the aminoglycoside resistance gene aadA1, which is relevant because of the association between aadA1 and streptomycin resistance in Salmonella strains isolated from chicken meat [64]. Likewise, its frequency is also relevant because this gene is encoded by a conjugal plasmid, which can be transferred to E. coli, with or without selective pressure from antibiotics [65]. Regarding plasmid-mediated quinolone resistance (PMQR) genes, this study identified high frequency of qnrD (20%) compared to a previous report from Colombia [33]. Genetic elements, such as integrons, are able to recognize and capture cassettes carrying the antibiotic resistance genes, leading to the spread of multidrug resistance (MDR) [66]. Class 2 integrons are one of the most common integrons in pathogenic bacteria [67]. Also, the presence of integrons in Salmonella has been associated with antimicrobial resistance [60]. In this study, class 2 integron was detected in 95% of Salmonella isolates, which was higher than previous studies in South Africa (33%) and Iran (9.2%) [68, 69].

Pathogenic Salmonella strains isolated in poultry contain various genes associated with Salmonella pathogenicity islands (SPIs), including pathogenicity islands 1 and 2 (SPI-1 and SPI-2) [44]. SPI-1 allows the bacteria to penetrate non-phagocytic host cells, while SPI-2 is important for survival within the macrophage and for establishment of systemic infection [70, 71]. The SPI-1 genes, such as fimA, invA, and avrA, were detected in 100% of the tested strains, followed by other genes such as spiC (90%), hilA (85%), sitC (80%), spaN (80%), and sipB (65%), with lower frequencies (Table 4). The extensive presence of invA in Salmonella species has led to its use as a molecular marker for confirming Salmonella genus [72, 73]. Regarding Salmonella fimbriae virulence gene fimA, the prevalence rates were similar to a previous study in United States [74]. The fimA codes for the major fimbrial subunit in Salmonella, which helps to adhere to the cell surface and promotes colonization [75]. Another relevant gene in Salmonella virulence is hilA, which stimulates the expression of invasive genes [76]. In addition, similar results have been reported from commercial farms in Egypt, where the hilA gene was detected in 90% of Salmonella strains [77]. Likewise, the prevalence of avrA in strains is a concern because this gene can enhance bacteria proliferation during infections by inhibiting inflammation and regulating epithelial apoptosis [78]. Among SPI-2, various genes were detected (sifA (70%); spiA (90%)) (Table 4). The spiA gene is associated with the ability of biofilm formation and virulence in Salmonella species [79]. In this way, the presence of SPI-1 and SPI-2 genes among Salmonella strains isolated from poultry meat is significant, as it suggests the potential of these isolates to cause infections in humans [80].

Table 4.

Distribution of virulence genes in Salmonella spp. isolates.∗

graphic file with name IJMICRO2024-4674138.tab4.i001.jpg
Open in a new tab

∗For PCR-based patterns, black box indicates that the detection of the virulence gene was positive and white box indicates that the detection of the virulence gene was negative.

Concerning SPI-3, msgA gene was present in all strains (Table 4), which agrees with previous reports on Salmonella isolated from poultry products in Iran [81]. By contrast, siiD gene of SPI-4 was found only in 60% of strains, which is relevant because this gene encodes a protein that links the inner and outer membranes [82]. Contributing to the virulence of Salmonella through the transport of specific proteins that enhance the bacteria's ability to invade host cells, evade the host immune system, and establish infections [83]. Another gene present among the strains was sopB of SPI-5, which is related to subverting host autophagy and inhibiting the fusion of Salmonella-containing vacuoles (SCVs) with lysosomes and autophagosomes [84]. In contrast, a study conducted in South Africa found that 31.8% of the isolates had sopB [85]. Therefore, the presence of sopB could facilitate the dissemination of bacteria in the host environment by inducing diarrhea during infection [86]. The detection rate of virulence plasmid-borne genes, such as spvB and spvC, was 55%, which was significantly higher than that in a previous report of Salmonella isolated from broiler chicken carcasses in the United States (5.5%) [87]. The spvB gene in Salmonella is associated with virulence and pathogenesis by promoting necroptosis of intestinal epithelial cells, leading to the destruction of the intestinal barrier and aggravation of infection [88]. The cdtB gene is another commonly detected gene. This gene encodes the cytolethal distending toxin B, which plays a significant role in the pathogenesis of Salmonella by causing cell cycle arrest, cytoplasmic distension, and nuclear enlargement in host cells [89]. Fimbriae virulence genes, such as lpfC, lpfA, and pefA, mediate the adhesion of Salmonella serovar to host cells contributing to the pathogenesis [90]. A high frequency of fimbriae virulence genes was observed among Salmonella strains, which is relevant because these genes contribute to inflammation, intestinal colonization, and long-term carriage of Salmonella in vertebrate animals [90, 91].

With respect to csgA gene, this gene encodes the major structural component of curli fimbriae, which stabilizes cell-cell interactions during biofilm formation [92]. Salmonella biofilm formation can enhance bacterial resistance to adverse conditions, such as environmental stresses, host defense mechanisms, and antibiotics, which is relevant because the detection rate of the csgA gene in Salmonella strains isolated from chicken meat was 90%, suggesting that Salmonella could be maintained on inert surfaces, such as those used in food production, being one of the main vehicles of foodborne salmonellosis outbreaks, which constitutes a public health problem [93]. Finally, it is essential to recognize that the presence of virulence genes is not a conclusive indicator of a bacterium's pathogenic potential [94]. It is the combined expression of multiple genes that is necessary for pathogenicity [95, 96]. Finally, we recommend using additional methods to confirm the expression of genes or proteins related to virulence factors.

5. Conclusions

Salmonella strains obtained from chicken meat containing antimicrobial and virulence genes raise concerns about their potential to cause disease and the health risk for humans. The possibility of cross-contamination in retail chicken is especially alarming, as it represents a significant danger to public health, particularly for individuals undergoing antimicrobial therapy due to Salmonella-contaminated chicken infections. Thus, this research holds significance for the monitoring of salmonellosis.

Acknowledgments

Funding for this research was provided by the Research Office of the University of Tolima (grant no. 60130521) and the Administrative Department of Science, Technology, and Innovation (Colciencias) (grant no. 907-2021).

Data Availability

The data that support the findings of this study are available from the corresponding author upon reasonable request.

Conflicts of Interest

The authors declare that there are no conflicts of interest.

Authors' Contributions

K.J.L.-V. and I.S.R.-B were responsible for conceptualization, formal analysis, and review and editing. K.J.L.-V. was responsible for data curation, original draft preparation, and methodology. I.S.R.-B. was responsible for resources, supervision, project administration, and funding acquisition. All authors have read and agreed to the published version of the manuscript.

References

  • 1.Narayan K. G., Sinha D. K., Singh D. K. Veterinary Public Health and Epidemiology: Veterinary Public Health-Epidemiology-Zoonosis-One Health . Berlin, Germany: Springer; 2023. Foodborne bacterial infections; pp. 253–273. [Google Scholar]
  • 2.Batz M. B. Foodborne Infections and Intoxications . Amsterdam, Netherlands: Elsevier; 2013. The foods most often associated with major foodborne pathogens: attributing illnesses to food sources and ranking pathogen/food combinations; pp. 19–35. [Google Scholar]
  • 3.Adley C. C., Ryan M. P. Antimicrobial Food Packaging . Amsterdam, Netherlands: Elsevier; 2016. The nature and extent of foodborne disease; pp. 1–10. [Google Scholar]
  • 4.Bintsis T. Foodborne pathogens. AIMS Microbiology . 2017;3:529–563. doi: 10.3934/microbiol.2017.3.529. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Tamber S. In: Salmonella . Dikeman M. B. T.-E., of M. S., Third E., editors. Oxford, UK: Elsevier; 2024. [Google Scholar]
  • 6.Popa G. L., Popa M. I. Salmonella spp. Infection-a continuous threat worldwide. Germs . 2021;11(1):88–96. doi: 10.18683/germs.2021.1244. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.He Y., Wang J., Zhang R., et al. Epidemiology of foodborne diseases caused by Salmonella in Zhejiang Province, China, between 2010 and 2021. Frontiers in Public Health . 2023;11 doi: 10.3389/fpubh.2023.1127925.1127925 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Zhang Z., Li J., Zhou R., et al. Serotyping and antimicrobial resistance profiling of multidrug-resistant non-typhoidal Salmonella from farm animals in Hunan, China. Antibiotics . 2023;12(7):p. 1178. doi: 10.3390/antibiotics12071178. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Vajda Á., Ózsvári L., Szakos D., Kasza G. Estimation of the impact of foodborne salmonellosis on consumer well-being in Hungary. International Journal of Environmental Research and Public Health . 2021;18(19) doi: 10.3390/ijerph181910131.10131 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Feasey N. A., Dougan G., Kingsley R. A., Heyderman R. S., Gordon M. A. Invasive non-typhoidal Salmonella disease: an emerging and neglected tropical disease in Africa. The Lancet . 2012;379(9835):2489–2499. doi: 10.1016/s0140-6736(11)61752-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Luby S. P. Bacteria: salmonella typhi and salmonella paratyphi. Encyclopedia of Food Safety . 2014;1:515–522. doi: 10.1016/B978-0-12-378612-8.00113-X. [DOI] [Google Scholar]
  • 12.Hiyoshi H., Tiffany C. R., Bronner D. N., Bäumler A. J. Typhoidal Salmonella serovars: Ecological opportunity and the evolution of a new pathovar. FEMS Microbiology Reviews . 2018;42(4):527–541. doi: 10.1093/femsre/fuy024. [DOI] [PubMed] [Google Scholar]
  • 13.Cdc C. for D. C., Cdc P. Yellow Book 2024: Health Information for International Travel . Oxford, UK: Oxford University Press; 2023. [Google Scholar]
  • 14.Lamichhane B., Mawad A. M. M., Saleh M., et al. Salmonellosis: an overview of epidemiology, pathogenesis, and innovative approaches to mitigate the antimicrobial resistant infections. Antibiotics . 2024;13(1):p. 76. doi: 10.3390/antibiotics13010076. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Gerba C. P. Environmental Microbiology . Amsterdam, Netherlands: Elsevier; 2009. Environmentally transmitted pathogens; pp. 445–484. [Google Scholar]
  • 16.Lacey R. W. Food-borne bacterial infections. Parasitology . 1993;107(S1):S75–S93. doi: 10.1017/s0031182000075521. [DOI] [PubMed] [Google Scholar]
  • 17.Ehuwa O., Jaiswal A. K., Jaiswal S. Salmonella, food safety and food handling practices. Foods . 2021;10(5):p. 907. doi: 10.3390/foods10050907. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Yeh Y., Purushothaman P., Gupta N., Ragnone M., Verma S. C., De Mello A. S. Bacteriophage application on red meats and poultry: Effects on Salmonella population in final ground products. Meat Science . 2017;127:30–34. doi: 10.1016/j.meatsci.2017.01.001. [DOI] [PubMed] [Google Scholar]
  • 19.Foley S. L., Nayak R., Hanning I. B., Johnson T. J., Han J., Ricke S. C. Population dynamics of Salmonella enterica serotypes in commercial egg and poultry production. Applied and Environmental Microbiology . 2011;77(13):4273–4279. doi: 10.1128/aem.00598-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Mani-López E., García H. S., López-Malo A. Organic acids as antimicrobials to control Salmonella in meat and poultry products. Food Research International . 2012;45(2):713–721. doi: 10.1016/j.foodres.2011.04.043. [DOI] [Google Scholar]
  • 21.Tan S. J., Nordin S., Esah E. M., Mahror N. Salmonella spp. in chicken: Prevalence, antimicrobial resistance, and detection methods. Microbiology Research . 2022;13(4):691–705. doi: 10.3390/microbiolres13040050. [DOI] [Google Scholar]
  • 22.Krüger G. I., Pardo-Esté C., Zepeda P., et al. Mobile genetic elements drive the multidrug resistance and spread of Salmonella serotypes along a poultry meat production line. Frontiers in Microbiology . 2023;14 doi: 10.3389/fmicb.2023.1072793.1072793 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Hong Y., Wu Y., Xie Y., et al. Effects of antibiotic-induced resistance on the growth, survival ability and virulence of Salmonella enterica. Food Microbiology . 2023;115 doi: 10.1016/j.fm.2023.104331.104331 [DOI] [PubMed] [Google Scholar]
  • 24.Alvarez D. M., Barrón-Montenegro R., Conejeros J., Rivera D., Undurraga E. A., Moreno-Switt A. I. A review of the global emergence of multidrug-resistant Salmonella enterica subsp. enterica serovar infantis. International Journal of Food Microbiology . 2023;403 doi: 10.1016/j.ijfoodmicro.2023.110297.110297 [DOI] [PubMed] [Google Scholar]
  • 25.Teklemariam A. D., Al-Hindi R. R., Albiheyri R. S., et al. Human salmonellosis: a continuous global threat in the farm-to-fork food safety continuum. Foods . 2023;12(9):p. 1756. doi: 10.3390/foods12091756. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Michaelis C., Grohmann E. Horizontal gene transfer of antibiotic resistance genes in biofilms. Antibiotics . 2023;12(2):p. 328. doi: 10.3390/antibiotics12020328. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Erhardt M., Dersch P. Regulatory principles governing Salmonella and Yersinia virulence. Frontiers in Microbiology . 2015;6:p. 949. doi: 10.3389/fmicb.2015.00949. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Donado-Godoy P., Clavijo V., León M., et al. Prevalence of Salmonella on retail broiler chicken meat carcasses in Colombia. Journal of Food Protection . 2012;75(6):1134–1138. doi: 10.4315/0362-028x.jfp-11-513. [DOI] [PubMed] [Google Scholar]
  • 29.Fandiño L. C., Verjan N. A common Salmonella enteritidis sequence type from poultry and human gastroenteritis in Ibagué, Colombia. Biomedica . 2019;39:50–62. doi: 10.7705/biomedica.v39i1.4155. [DOI] [PubMed] [Google Scholar]
  • 30.Hafiane F. Z., Tahri L., El Jarmouni M., et al. Incidence, identification and antibiotic resistance of Salmonella spp. in the well waters of Tadla plain, Morocco. Scientific Reports . 2024;14(1) doi: 10.1038/s41598-024-61917-3.15380 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Rodriguez J. M., Rondón I. S., Verjan N. Serotypes of Salmonella in broiler carcasses marketed at Ibague, Colombia. Revista Brasileira de Ciência Avícola . 2015;17(4):545–552. doi: 10.1590/1516-635x1704545-552. [DOI] [Google Scholar]
  • 32.Chuanchuen R., Padungtod P. Antimicrobial resistance genes in Salmonella enterica isolates from poultry and swine in Thailand. Journal of Veterinary Medical Science . 2009;71(10):1349–1355. doi: 10.1292/jvms.001349. [DOI] [PubMed] [Google Scholar]
  • 33.Herrera-Sánchez M. P., Castro-Vargas R. E., Fandiño-de-Rubio L. C., Rodríguez-Hernández R., Rondón-Barragán I. S. Molecular identification of fluoroquinolone resistance in Salmonella spp. Isolated from broiler farms and human samples obtained from two regions in Colombia. Veterinary World . 2021;14(7):1767–1773. doi: 10.14202/vetworld.2021.1767-1773. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Nikiema M. E. M., Kakou-Ngazoa S., Ky/Ba A., et al. Characterization of virulence factors of Salmonella isolated from human stools and street food in urban areas of Burkina Faso. BMC Microbiology . 2021;21(1):p. 338. doi: 10.1186/s12866-021-02398-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Webber B., Borges K. A., Furian T. Q., et al. Detection of virulence genes in Salmonella Heidelberg isolated from chicken carcasses. Revista do Instituto de Medicina Tropical de São Paulo . 2019;61:p. e36. doi: 10.1590/s1678-9946201961036. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Lozano-Villegas K. J., Herrera-Sánchez M. P., Beltrán-Martínez M. A., Cárdenas-Moscoso S., Rondón-Barragán I. S. Molecular detection of virulence factors in Salmonella serovars isolated from poultry and human samples. Veterinary Medicine International . 2023;2023(1) doi: 10.1155/2023/1875253.1875253 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Yang X., Wu Q., Huang J., et al. Prevalence and characterization of Salmonella isolated from raw vegetables in China. Food Control . 2020;109 doi: 10.1016/j.foodcont.2019.106915.106915 [DOI] [Google Scholar]
  • 38.Persing D. H. Diagnostic Molecular Microbiology: Principles and Applications . Washington, DC, USA: American Society for Microbiology Headquarters; 1993. Diagnostic molecular microbiology: Principles and Applications; p. p. 641. [Google Scholar]
  • 39.Spronk I., Korevaar J. C., Poos R., et al. Calculating incidence rates and prevalence proportions: not as simple as it seems. BMC Public Health . 2019;19:512–519. doi: 10.1186/s12889-019-6820-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Font-i-Furnols M. Meat consumption, sustainability and alternatives: An overview of motives and barriers. Foods . 2023;12(11):p. 2144. doi: 10.3390/foods12112144. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Sajid Q. U. A., Asghar M. U., Tariq H., Wilk M., Płatek A. Insect meal as an alternative to protein concentrates in poultry nutrition with future perspectives (an updated review) Agriculture . 2023;13(6):p. 1239. doi: 10.3390/agriculture13061239. [DOI] [Google Scholar]
  • 42.Ricke S. C. In: Poultry Food Safety and Foodborne Illness . Dikeman M. B. T.-E., of M. S., Third E., editors. Oxford, UK: Elsevier; 2024. [Google Scholar]
  • 43.Maes D., Kyriazakis I., Chantziaras I., Van Limbergen T., Christensen J.-P. Advancements and Technologies in Pig and Poultry Bacterial Disease Control . Amsterdam, Netherlands: Elsevier; 2021. Bacterial diseases in pigs and poultry: occurrence, epidemiology, and biosecurity measures; pp. 25–51. [Google Scholar]
  • 44.Shaji S., Selvaraj R. K., Shanmugasundaram R. Salmonella infection in poultry: A review on the pathogen and control strategies. Microorganisms . 2023;11:p. 2814. doi: 10.3390/microorganisms11112814. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Heyndrickx M., Vandekerchove D., Herman L., Rollier I., Grijspeerdt K., De Zutter L. Routes for Salmonella contamination of poultry meat: Epidemiological study from hatchery to slaughterhouse. Epidemiology and Infection . 2002;129(2):253–265. doi: 10.1017/s0950268802007380. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Corry J. E. L., Allen V. M., Hudson W. R., Breslin M. F., Davies R. H. Sources of Salmonella on broiler carcasses during transportation and processing: Modes of contamination and methods of control. Journal of Applied Microbiology . 2002;92(3):424–432. doi: 10.1046/j.1365-2672.2002.01543.x. [DOI] [PubMed] [Google Scholar]
  • 47.Castro-Vargas R. E., Herrera-Sánchez M. P., Rodríguez-Hernández R., Rondón-Barragán I. S. Antibiotic resistance in Salmonella spp. Isolated from poultry: A global overview. Veterinary World . 2020;13(10):2070–2084. doi: 10.14202/vetworld.2020.2070-2084. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Thung T. Y., Radu S., Mahyudin N. A., et al. Prevalence, virulence genes and antimicrobial resistance profiles of Salmonella serovars from retail beef in Selangor, Malaysia. Frontiers in Microbiology . 2017;8:p. 2697. doi: 10.3389/fmicb.2017.02697. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Escamilla P., Bartella L., Sanz‐Navarro S., et al. Degradation of penicillinic antibiotics and β‐lactamase enzymatic catalysis in a biomimetic Zn‐based metal–organic framework. Chemistry (Weinheim an der Bergstrasse, Germany) . 2023;29(51) doi: 10.1002/chem.202302315.e202302315 [DOI] [PubMed] [Google Scholar]
  • 50.Turner J., Muraoka A., Bedenbaugh M., et al. The chemical relationship among beta-lactam antibiotics and potential impacts on reactivity and decomposition. Frontiers in Microbiology . 2022;13 doi: 10.3389/fmicb.2022.807955.807955 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Hong S., Su S., Gao Q., et al. Enhancement of β-lactam-mediated killing of gram-negative bacteria by lysine hydrochloride. Microbiology Spectrum . 2023;11(4):e0119823–23. doi: 10.1128/spectrum.01198-23. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Shen X., Yin L., Zhang A., et al. Prevalence and characterization of Salmonella isolated from chickens in Anhui, China. Pathogens . 2023;12(3):p. 465. doi: 10.3390/pathogens12030465. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Shalaby A., Ismail M. M., El-Sharkawy H. Isolation, identification, and genetic characterization of antibiotic resistance of Salmonella species isolated from chicken farms. Journal of Tropical Medicine . 2022;2022:9. doi: 10.1155/2022/6065831.6065831 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Pavelquesi S. L. S., de Oliveira Ferreira A. C. A., Rodrigues A. R. M., de Souza Silva C. M., Orsi D. C., da Silva I. C. R. Presence of tetracycline and sulfonamide resistance genes in Salmonella spp.: Literature review. Antibiotics . 2021;10(11):p. 1314. doi: 10.3390/antibiotics10111314. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Tagg K. A., Francois Watkins L., Moore M. D., et al. Novel trimethoprim resistance gene DfrA34 identified in Salmonella Heidelberg in the USA. Journal of Antimicrobial Chemotherapy . 2019;74(1):38–41. doi: 10.1093/jac/dky373. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Enne V. I., Livermore D. M., Stephens P., Hall L. M. C. Persistence of sulphonamide resistance in Escherichia coli in the UK despite national prescribing restriction. The Lancet . 2001;357(9265):1325–1328. doi: 10.1016/s0140-6736(00)04519-0. [DOI] [PubMed] [Google Scholar]
  • 57.Lunara Santos Pavelquesi S., Carolina Almeida de Oliveira Ferreira A., Fernandes Silva Rodrigues L., Maria de Souza Silva C., Cristina Rodrigues da Silva I., Castilho Orsi D. Prevalence and antimicrobial resistance of Salmonella spp. Isolated from chilled chicken meat commercialized at retail in federal district, Brazil. Journal of Food Protection . 2023;86(9) doi: 10.1016/j.jfp.2023.100130.100130 [DOI] [PubMed] [Google Scholar]
  • 58.Sharahi J. Y., Hashemi A., Javad Mousavi S. M., Pournajaf A., Bidhendi S. M. Antimicrobial resistance patterns and virulence gene profiles of Salmonella enteritidis and Salmonella Typhimurium recovered from patients with gastroenteritis in three cities of Iran. Acta Microbiologica et Immunologica Hungarica . 2022;69(4):323–331. doi: 10.1556/030.2022.01841. [DOI] [PubMed] [Google Scholar]
  • 59.Xu F., Min F., Wang J., et al. Development and evaluation of a luminex XTAG assay for sulfonamide resistance genes in Escherichia coli and Salmonella isolates. Molecular and Cellular Probes . 2020;49 doi: 10.1016/j.mcp.2019.101476.101476 [DOI] [PubMed] [Google Scholar]
  • 60.Zhao X., Yang J., Zhang B., Sun S., Chang W. Characterization of integrons and resistance genes in Salmonella isolates from farm animals in Shandong province, China. Frontiers in Microbiology . 2017;8:p. 1300. doi: 10.3389/fmicb.2017.01300. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Mei X., Ma B., Zhai X., et al. Florfenicol enhances colonization of a Salmonella enterica serovar enteritidis FloR mutant with major alterations to the intestinal microbiota and metabolome in neonatal chickens. Applied and Environmental Microbiology . 2021;87(24) doi: 10.1128/aem.01681-21.e0168121 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.El-Tayeb M. A., Ibrahim A. S. S., Al-Salamah A. A., Almaary K. S., Elbadawi Y. B. Prevalence, serotyping and antimicrobials resistance mechanism of Salmonella enterica isolated from clinical and environmental samples in Saudi Arabia. Brazilian Journal of Microbiology . 2017;48(3):499–508. doi: 10.1016/j.bjm.2016.09.021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Kanaan M. H. G., Khalil Z. K., Khashan H. T., Ghasemian A. Occurrence of virulence factors and carbapenemase genes in Salmonella enterica serovar enteritidis isolated from chicken meat and egg samples in Iraq. BMC Microbiology . 2022;22(1):p. 279. doi: 10.1186/s12866-022-02696-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Fatima A., Nawaz S., Shahid M., Saleem M., Fatima I. Designing a rapid, reliable and reproducible method for the detection of SALMONELLA SPP. From poultry meat. The Journal of Microbiology and Molecular Genetics . 2022;3(2):12–23. doi: 10.52700/jmmg.v3i2.51. [DOI] [Google Scholar]
  • 65.van Essen-Zandbergen A., Smith H., Veldman K., Mevius D. In vivo transfer of an IncFIB plasmid harbouring a class 1 integron with gene cassettes DfrA1-AadA1. Veterinary Microbiology . 2009;137(3-4):402–407. doi: 10.1016/j.vetmic.2009.02.004. [DOI] [PubMed] [Google Scholar]
  • 66.Abdel Aziz S. A., Abdel-Latef G. K., Shany S. A. S., Rouby S. R. Molecular detection of integron and antimicrobial resistance genes in multidrug resistant Salmonella isolated from poultry, calves and human in beni-suef governorate, Egypt. Beni-Suef University Journal of Basic and Applied Sciences . 2018;7(4):535–542. doi: 10.1016/j.bjbas.2018.06.005. [DOI] [Google Scholar]
  • 67.Possebon F. S., Alvarez M. V. N., Ullmann L. S., Araujo Jr J. P. Antimicrobial resistance genes and class 1 integrons in MDR Salmonella strains isolated from swine lymph nodes. Food Control . 2021;128 doi: 10.1016/j.foodcont.2021.108190.108190 [DOI] [Google Scholar]
  • 68.Ramatla T., Mileng K., Ndou R., et al. Molecular detection of integrons, colistin and β-lactamase resistant genes in Salmonella enterica serovars enteritidis and Typhimurium isolated from chickens and rats inhabiting poultry farms. Microorganisms . 2022;10(2):p. 313. doi: 10.3390/microorganisms10020313. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69.Ghazalibina M., Farahani R. K., Mansouri S., Meskini M., Farahani A. H. K., Khaledi A. Molecular detection of antibiotic resistance genes, and class I, and II integrons in Salmonella enteritidis isolated from Iranian one-day-old chicks. Gene Reports . 2019;16 doi: 10.1016/j.genrep.2019.100441.100441 [DOI] [Google Scholar]
  • 70.Pico-Rodríguez J. T., Martínez-Jarquín H., Gómez-Chávez J. d. J., Juárez-Ramírez M., Martínez-Chavarría L. C. Effect of Salmonella pathogenicity island 1 and 2 (SPI-1 and SPI-2) deletion on intestinal colonization and systemic dissemination in chickens. Veterinary Research Communications . 2023;48:49–60. doi: 10.1007/s11259-023-10185-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71.Kombade S., Kaur N. Salmonella spp.-A Global Challenge . London, UK: IntechOpen; 2021. Pathogenicity island in Salmonella. [Google Scholar]
  • 72.O’Regan E., McCabe E., Burgess C., et al. Development of a real-time multiplex PCR assay for the detection of multiple Salmonella serotypes in chicken samples. BMC Microbiology . 2008;8:156–211. doi: 10.1186/1471-2180-8-156. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 73.Rodríguez-Hernández R., Herrera-Sánchez M. P., Ortiz-Muñoz J. D., Mora-Rivera C., Rondón-Barragán I. S. Molecular characterization of Salmonella spp. Isolates from wild Colombian babilla (Caiman crocodilus fuscus) isolated in situ. Animals . 2022;12(23):p. 3359. doi: 10.3390/ani12233359. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 74.Obe T., Nannapaneni R., Schilling W., Zhang L., McDaniel C., Kiess A. Prevalence of Salmonella enterica on poultry processing equipment after completion of sanitization procedures. Poultry Science . 2020;99(9):4539–4548. doi: 10.1016/j.psj.2020.05.043. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 75.Rossolini G. M., Muscas P., Chiesurin A., Satta G. Analysis of the Salmonella fim gene cluster: Identification of a new gene (FimI) encoding a fimbrin-like protein and located downstream from the FimA gene. FEMS Microbiology Letters . 1993;114(3):259–265. doi: 10.1016/0378-1097(93)90281-6. [DOI] [PubMed] [Google Scholar]
  • 76.Siddiky N. A., Sarker M. S., Khan M. S. R., et al. Virulence and antimicrobial resistance profiles of Salmonella enterica serovars isolated from chicken at wet markets in Dhaka, Bangladesh. Microorganisms . 2021;9(5):p. 952. doi: 10.3390/microorganisms9050952. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 77.Algammal A. M., El-Tarabili R. M., Abd El-Ghany W. A., et al. Resistance profiles, virulence and antimicrobial resistance genes of XDR S. Enteritidis and S. Typhimurium. AMB Express . 2023;13(1):p. 110. doi: 10.1186/s13568-023-01615-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 78.Lu R., Liu X., Wu S., et al. Consistent activation of the β-catenin pathway by Salmonella type-three secretion effector protein AvrA in chronically infected intestine. American Journal of Physiology-Gastrointestinal and Liver Physiology . 2012;303(10):G1113–G1125. doi: 10.1152/ajpgi.00453.2011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 79.Dong H., Peng D., Jiao X., Zhang X., Geng S., Liu X. Roles of the SpiA gene from Salmonella enteritidis in biofilm formation and virulence. Microbiology (New York) . 2011;157(6):1798–1805. doi: 10.1099/mic.0.046185-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 80.Lou L., Zhang P., Piao R., Wang Y. Salmonella pathogenicity island 1 (SPI-1) and its complex regulatory network. Frontiers in Cellular and Infection Microbiology . 2019;9:p. 270. doi: 10.3389/fcimb.2019.00270. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 81.Bahramianfard H., Derakhshandeh A., Naziri Z., Khaltabadi Farahani R. Prevalence, virulence factor and antimicrobial resistance analysis of Salmonella enteritidis from poultry and egg samples in Iran. BMC Veterinary Research . 2021;17(1):p. 196. doi: 10.1186/s12917-021-02900-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 82.Morgan E., Bowen A. J., Carnell S. C., Wallis T. S., Stevens M. P. SiiE is secreted by the Salmonella enterica serovar Typhimurium pathogenicity island 4-encoded secretion system and contributes to intestinal colonization in cattle. Infection and Immunity . 2007;75(3):1524–1533. doi: 10.1128/iai.01438-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 83.Guo Y., Gu D., Huang T., et al. Salmonella enteritidis T1SS protein SiiD inhibits NLRP3 inflammasome activation via repressing the MtROS-ASC dependent pathway. PLoS Pathogens . 2023;19(5) doi: 10.1371/journal.ppat.1011381.e1011381 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 84.Zhao S., Xu Q., Cui Y., et al. Salmonella effector SopB reorganizes cytoskeletal vimentin to maintain replication vacuoles for efficient infection. Nature Communications . 2023;14(1):p. 478. doi: 10.1038/s41467-023-36123-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 85.Mahnaz J. S., Soheila M. B., Pejvak K. Assessment of Stn, SipB and SopB virulence genes in various Salmonella serovars. Archives of Razi Institute . 2023;78(5):1615–1623. doi: 10.22092/ARI.2023.78.5.1615. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 86.Feng Y., Wente S. R., Majerus P. W. Overexpression of the inositol phosphatase SopB in human 293 cells stimulates cellular chloride influx and inhibits nuclear MRNA export. Proceedings of the National Academy of Sciences . 2001;98(3):875–879. doi: 10.1073/pnas.98.3.875. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 87.Tasmin R., Gulig P. A., Parveen S. Detection of virulence plasmid–encoded genes in Salmonella Typhimurium and Salmonella Kentucky isolates recovered from commercially processed chicken carcasses. Journal of Food Protection . 2019;82(8):1364–1368. doi: 10.4315/0362-028x.jfp-18-552. [DOI] [PubMed] [Google Scholar]
  • 88.Dong K., Zhu Y., Deng Q., et al. Salmonella PSLT-encoded effector SpvB promotes RIPK3-dependent necroptosis in intestinal epithelial cells. Cell Death & Disease . 2022;8(1):p. 44. doi: 10.1038/s41420-022-00841-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 89.Haghjoo E., Galán J. E. Salmonella Typhi encodes a functional cytolethal distending toxin that is delivered into host cells by a bacterial-internalization pathway. Proceedings of the National Academy of Sciences . 2004;101(13):4614–4619. doi: 10.1073/pnas.0400932101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 90.Humphries A. D., Townsend S. M., Kingsley R. A., Nicholson T. L., Tsolis R. M., Bäumler A. J. Role of fimbriae as antigens and intestinal colonization factors of Salmonella serovars. FEMS Microbiology Letters . 2001;201(2):121–125. doi: 10.1016/s0378-1097(01)00250-6. [DOI] [PubMed] [Google Scholar]
  • 91.Weening E. H., Barker J. D., Laarakker M. C., Humphries A. D., Tsolis R. M., Bäumler A. J. The Salmonella enterica serotype Typhimurium Lpf, Bcf, Stb, Stc, Std, and Sth fimbrial operons are required for intestinal persistence in mice. Infection and Immunity . 2005;73(6):3358–3366. doi: 10.1128/iai.73.6.3358-3366.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 92.Hurtado-Escobar G. A., Grépinet O., Raymond P., Abed N., Velge P., Virlogeux-Payant I. H-NS is the major repressor of Salmonella Typhimurium Pef fimbriae expression. Virulence . 2019;10(1):849–867. doi: 10.1080/21505594.2019.1682752. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 93.El Hag M., Feng Z., Su Y., et al. Contribution of the CsgA and BcsA genes to Salmonella enterica serovar pullorum biofilm formation and virulence. Avian Pathology . 2017;46(5):541–547. doi: 10.1080/03079457.2017.1324198. [DOI] [PubMed] [Google Scholar]
  • 94.Xia Y., Li H., Shen Y. Antimicrobial drug resistance in Salmonella enteritidis isolated from edible snakes with pneumonia and its pathogenicity in chickens. Frontiers in Veterinary Science . 2020;7:p. 463. doi: 10.3389/fvets.2020.00463. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 95.Dionisio F., Domingues C. P. F., Rebelo J. S., Monteiro F., Nogueira T. The impact of non-pathogenic bacteria on the spread of virulence and resistance genes. International Journal of Molecular Sciences . 2023;24(3):p. 1967. doi: 10.3390/ijms24031967. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 96.Popoola O. D., Tajudeen A. O., Adesetan T. O., et al. Biological resolution of virulence genes of Salmonella species from different microbiomes. Journal of the Cameroon Academy of Sciences . 2022;18(2):407–416. doi: 10.4314/jcas.v18i2.2. [DOI] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.

Articles from International Journal of Microbiology are provided here courtesy of Wiley

RESOURCES