REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Rabbit anti-GFP	Life Technologies	Cat# A11122; RRID:AB_221569
Mouse anti-Nestin	Millipore	Cat# MAB5326 RRID:AB_2251134
Rabbit Anti-Pax6	Biolegend	Cat# 901301 RRID:AB_25655003
Mouse anti-Tuj1	Biolegend	Cat# 801202 RRID:AB_10063408
Mouse anti-MAP2	Millipore	Cat# MAB3418 RRID:AB_11212326
Rabbit anti-GFAP53	Agilent Dako	Cat# Z0334 RRID:AB_10013382
Rabbit anti-S100B	Agilent Dako	Cat# Z0311 RRID:AB_10013383
Rat anti-MBP	Millipore	Cat# MAB386; RRID:AB_94975
Mouse anti-BCAS1	Santa Cruz	Cat# sc-136342 RRID:AB_10839529
Rabbit anti-PDGFRα	Cell Signaling	Cat# 5241 RRID:AB_10692773
Mouse anti-Human CD45	Agilent Dako	Cat# M0701 RRID:AB_2314143
Rat anti-CD11b	Biorad	Cat# MCA74GA RRID:AB_324660
Rabbit anti-IBA1	Wako	Cat# 019–19741 RRID:AB_839504
Rabbit anti-TMEM119	Sigma	Cat# HPA051870 RRID:AB_2681645
Alexa Fluor donkey anti-rabbit 488	Thermo Fisher Scientific	Cat# A32790 RRID:AB_2762833
Alexa Fluor goat anti-mouse 546	Thermo Fisher Scientific	Cat# A21133 RRID:AB_2535772
Alexa Fluor goat anti-rat 663	Thermo Fisher Scientific	Cat# A21094 RRID:AB_2535749
Alexa Fluor goat anti-rat 546	Thermo Fisher Scientific	Cat# A11081 RRID:AB_2534125
Alexa Fluor goat anti-rabbit 546	Thermo Fisher Scientific	Cat# A11010 RRID:AB_2534077
Bacterial and virus strains
Chemically competent E. coli (One Shot TOP10)	Invitrogen	Cat# C404010
Biological samples
Fibroblast cultures from cohort	This study	Table S1
iPSC cultures from cohort	This study	Table S1
CSF	This study	Table S6
Chemicals, peptides, and recombinant proteins
B-27 supplement lacking vitamin A	Gibco	Cat# 12587-010
N2 supplement	Gibco	Cat# 17502-048
Matrigel (Matrigel Growth-factor-reduced)	Corning	Cat# 354263
hESC-qualified matrix (MaES)	BD Biosciences	Cat# 354277
ROCK inhibitor (Y-27632)	Calbiochem	Cat# 688000
Collagenase type IV	Gibco	Cat# 17104-019
Dorsomorphin	StemMACS	Cat# 130-104-466
CHIR 99021 trihydrochloride	Tocris	Cat# 4953
SB-431542	StemMACS	Cat# 130-105-336
Purmorphamine	ENZO	Cat# ALZ-420-045-M001
Neurobasal medium	Gibco	Cat# 21103-049
DMEM-F12 medium	Gibco	Cat# 21331-020
mTeSR basal medium	STEMCELL	Cat# 05851
Penicillin/streptomycin/glutamine	Gibco	Cat# 15140-122
Ascorbic acid	Sigma Aldrich	Cat# A4403
Accumax	Sigma Aldrich	Cat# A7089
Smoothened Agonist (SAG)	Millipore	Cat# 566660
BSA Molecular Biology Grade	New England Biolabs	Cat# B2000S
XbaI restriction enzyme	New England Biolabs	Cat# #R0145
NheI restriction enzyme	New England Biolabs	Cat# R3131
MluI restriction enzyme	New England Biolabs	Cat# R3198
SpeI restriction enzyme	New England Biolabs	Cat# R3133
T4 DNA Polymerase	Promega	Cat# M4211
Antarctic Phosphatase	New England Biolabs	Cat# M0289S
T4 DNA-ligase	New England Biolabs	Cat# M0202S
SOC medium	Invitrogen	Cat# 15544034
Ampicillin	Roche	Cat# 10835269001
Triiodo-L-thyronine (T3)	Sigma Aldrich	Cat# T6397
Recombinant human PDGF	Preprotech	Cat# 100-13A
Recombinant human NT3	Preprotech	Cat# 450-03
Recombinant human GDNF	Sino Biological Inc	Cat# 10561-HNCH
Recombinant human IGF-1	Preprotech	Cat# 100-11
Recombinant human BDNF	Sino Biological Inc	Cat# 50240-MANS
dcAMP analog	Sigma Aldrich	Cat# D0627
Doxycycline hydrochloride	Sigma Aldrich	Cat# D3447
Triton X-100 reagent	Sigma Aldrich	Cat# 93420
DAPI fluorescence reagent for DNA	Thermo Fisher Scientific	Cat# D1306
RapiClear™ 1.47	SUNJin Lab	Cat# RC147001
Dako fluorescent mounting medium	Agilent	Cat# S3023
Epon resin	Electron Microscopy Science	Cat# 50-980-342
Papain	STEMCELL	Cat# 074ss66
DNAase I for cell culture	STEMCELL	Cat# 07900
EcoRI	New England Biolabs	Cat# R3101
AflIII restriction enzyme	New England Biolabs	Cat# R0541S
NotI restriction enzyme	New England Biolabs	Cat# R0189S
EcoRV restriction enzyme	New England Biolabs	Cat# R0195S
Iscove’s modified Dulbecco medium	Sigma Aldrich	Cat# I3390
Fetal Bovine Serum	Euroclone	Cat# ECS0180L
Ovomucoid protease inhibitor	Worthington Biochemical	Cat#LK003182
Critical commercial assays
Sendai virus kit Cytotune	Invitrogen	Cat# A16517
Plasmid DNA Extraction mini kit		Cat# DE-034
Xtra Maxi EF	Macherey-Nagel	Cat# 740424.50
STEMdiff™ Hematopoietic Kit	STEMCELL	Cat# 05310
STEMdiff™ Micorglia Differentiation Kit	STEMCELL	Cat# 100-0019
STEMdiff™ Microglia Maturation Kit	STEMCELL	Cat# 100-0020
RNeasy Mini kit	Qiagen	Cat# 74106
Thermo Script RT-PCR	Invitrogen	Cat# 11146-024
SuperScript IV First-Strand Synthesis System	Thermo Fisher Scientific	Cat# 18091050
Deposited data
scRNA-data of this study	Deposited to GEO	GSE233295
scRNA-seq for human adult cortex	Hao et al., 2021.18	GSE164378
scRNA-seq for human fetal brain	Cao et al., 2020.19	GSE156793
scRNA-seq for human cortical organoids	Birey et al., 2017.20	SRA: SRP096997
scRNA-seq for human cortical organoids	Fiddes et al., 2018.21	SRA: SRP121791
scRNA-seq for human cortical organoids	Giandomenico et al., 2019.22	SRA: SRP174405
scRNA-seq for human cortical organoids	Madhavan et al., 2018.23	SRA: SRP131980
scRNA-seq for human cortical organoids	Quadrato et al., 2017.24	SRA: SRP083140
scRNA-seq for human cortical organoids	Trujillo et al., 2019.25	SRA: SRP139859
scRNA-seq for human cortical organoids	Velasco et al., 2019.26	SRA: SRP191528
scRNA-seq for human cortical organoids	Xiang et al., 2017.27	SRA: SRP105219
scRNA-seq for human multiple sclerosis brain	Absinta et al., 2021.3	GSE180759
Experimental models: Cell lines
Human Embryonic Kidney (HEK293T) cells	ATCC	Cat# CRL-1573 RRID:CVCL_0045
Oligonucleotides
Probe LV (ATCTCTCTCCTTCTAGCCTC)	This paper	N/A
Primer FW (TACTGACGCTCTCGCACC)	This paper	N/A
Primer REV (TCTCGACGCAGGACTCG)	This paper	N/A
TaqMan Assay for GAPDH, TUBB3, MBP, SOX10, S100B, MAP2, GFAP, OLIG2, CNP, CXCL8, AIF1, NAMPT.	This paper	Table S7
Recombinant DNA
pZ M2rtTA_CAGG_TetON-Sox10 _GFP	Addgene	Cat# 115241 RRID:Addgene 115241
#945.pCCL.sin.cPPT.SV40ployA.eGFP.minCMV.hPGK. deltaLNGFR.Wpre	Kindly provided by Prof. Luigi Naldini	N/A
Plasmid coding for the non-correlated envelope of the vesicular stomatits virus (VSV, protein-G)	Kindly provided by Prof. Luigi Naldini	N/A
Plasmid coding for the packaging proteins MDLg/pRRE	Kindly provided by Prof. Luigi Naldini	N/A
Plasmid coding for REV protein	Kindly provided by Prof. Luigi Naldini	N/A
Software and algorithms
GraphPad Prism	https://Graphpad.com/	N/A
Fiji	https://ImageJ.net/software/fiji/downloads	N/A
Monocle	https://www.bioconductor.org/packages/release/bioc/html/monocle.html	2.18.0
CellChat	https://github.com/sqjin/CellChat	1.5.0
Seurat	https://satijalab.org/seurat/	4.3
R	https://www.r-project.org/	4.2