| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Rabbit anti-GFP | Life Technologies | Cat# A11122; RRID:AB_221569 |
| Mouse anti-Nestin | Millipore | Cat# MAB5326 RRID:AB_2251134 |
| Rabbit Anti-Pax6 | Biolegend | Cat# 901301 RRID:AB_25655003 |
| Mouse anti-Tuj1 | Biolegend | Cat# 801202 RRID:AB_10063408 |
| Mouse anti-MAP2 | Millipore | Cat# MAB3418 RRID:AB_11212326 |
| Rabbit anti-GFAP53 | Agilent Dako | Cat# Z0334 RRID:AB_10013382 |
| Rabbit anti-S100B | Agilent Dako | Cat# Z0311 RRID:AB_10013383 |
| Rat anti-MBP | Millipore | Cat# MAB386; RRID:AB_94975 |
| Mouse anti-BCAS1 | Santa Cruz | Cat# sc-136342 RRID:AB_10839529 |
| Rabbit anti-PDGFRα | Cell Signaling | Cat# 5241 RRID:AB_10692773 |
| Mouse anti-Human CD45 | Agilent Dako | Cat# M0701 RRID:AB_2314143 |
| Rat anti-CD11b | Biorad | Cat# MCA74GA RRID:AB_324660 |
| Rabbit anti-IBA1 | Wako | Cat# 019–19741 RRID:AB_839504 |
| Rabbit anti-TMEM119 | Sigma | Cat# HPA051870 RRID:AB_2681645 |
| Alexa Fluor donkey anti-rabbit 488 | Thermo Fisher Scientific | Cat# A32790 RRID:AB_2762833 |
| Alexa Fluor goat anti-mouse 546 | Thermo Fisher Scientific | Cat# A21133 RRID:AB_2535772 |
| Alexa Fluor goat anti-rat 663 | Thermo Fisher Scientific | Cat# A21094 RRID:AB_2535749 |
| Alexa Fluor goat anti-rat 546 | Thermo Fisher Scientific | Cat# A11081 RRID:AB_2534125 |
| Alexa Fluor goat anti-rabbit 546 | Thermo Fisher Scientific | Cat# A11010 RRID:AB_2534077 |
| Bacterial and virus strains | ||
| Chemically competent E. coli (One Shot TOP10) | Invitrogen | Cat# C404010 |
| Biological samples | ||
| Fibroblast cultures from cohort | This study | Table S1 |
| iPSC cultures from cohort | This study | Table S1 |
| CSF | This study | Table S6 |
| Chemicals, peptides, and recombinant proteins | ||
| B-27 supplement lacking vitamin A | Gibco | Cat# 12587-010 |
| N2 supplement | Gibco | Cat# 17502-048 |
| Matrigel (Matrigel Growth-factor-reduced) | Corning | Cat# 354263 |
| hESC-qualified matrix (MaES) | BD Biosciences | Cat# 354277 |
| ROCK inhibitor (Y-27632) | Calbiochem | Cat# 688000 |
| Collagenase type IV | Gibco | Cat# 17104-019 |
| Dorsomorphin | StemMACS | Cat# 130-104-466 |
| CHIR 99021 trihydrochloride | Tocris | Cat# 4953 |
| SB-431542 | StemMACS | Cat# 130-105-336 |
| Purmorphamine | ENZO | Cat# ALZ-420-045-M001 |
| Neurobasal medium | Gibco | Cat# 21103-049 |
| DMEM-F12 medium | Gibco | Cat# 21331-020 |
| mTeSR basal medium | STEMCELL | Cat# 05851 |
| Penicillin/streptomycin/glutamine | Gibco | Cat# 15140-122 |
| Ascorbic acid | Sigma Aldrich | Cat# A4403 |
| Accumax | Sigma Aldrich | Cat# A7089 |
| Smoothened Agonist (SAG) | Millipore | Cat# 566660 |
| BSA Molecular Biology Grade | New England Biolabs | Cat# B2000S |
| XbaI restriction enzyme | New England Biolabs | Cat# #R0145 |
| NheI restriction enzyme | New England Biolabs | Cat# R3131 |
| MluI restriction enzyme | New England Biolabs | Cat# R3198 |
| SpeI restriction enzyme | New England Biolabs | Cat# R3133 |
| T4 DNA Polymerase | Promega | Cat# M4211 |
| Antarctic Phosphatase | New England Biolabs | Cat# M0289S |
| T4 DNA-ligase | New England Biolabs | Cat# M0202S |
| SOC medium | Invitrogen | Cat# 15544034 |
| Ampicillin | Roche | Cat# 10835269001 |
| Triiodo-L-thyronine (T3) | Sigma Aldrich | Cat# T6397 |
| Recombinant human PDGF | Preprotech | Cat# 100-13A |
| Recombinant human NT3 | Preprotech | Cat# 450-03 |
| Recombinant human GDNF | Sino Biological Inc | Cat# 10561-HNCH |
| Recombinant human IGF-1 | Preprotech | Cat# 100-11 |
| Recombinant human BDNF | Sino Biological Inc | Cat# 50240-MANS |
| dcAMP analog | Sigma Aldrich | Cat# D0627 |
| Doxycycline hydrochloride | Sigma Aldrich | Cat# D3447 |
| Triton X-100 reagent | Sigma Aldrich | Cat# 93420 |
| DAPI fluorescence reagent for DNA | Thermo Fisher Scientific | Cat# D1306 |
| RapiClear™ 1.47 | SUNJin Lab | Cat# RC147001 |
| Dako fluorescent mounting medium | Agilent | Cat# S3023 |
| Epon resin | Electron Microscopy Science | Cat# 50-980-342 |
| Papain | STEMCELL | Cat# 074ss66 |
| DNAase I for cell culture | STEMCELL | Cat# 07900 |
| EcoRI | New England Biolabs | Cat# R3101 |
| AflIII restriction enzyme | New England Biolabs | Cat# R0541S |
| NotI restriction enzyme | New England Biolabs | Cat# R0189S |
| EcoRV restriction enzyme | New England Biolabs | Cat# R0195S |
| Iscove’s modified Dulbecco medium | Sigma Aldrich | Cat# I3390 |
| Fetal Bovine Serum | Euroclone | Cat# ECS0180L |
| Ovomucoid protease inhibitor | Worthington Biochemical | Cat#LK003182 |
| Critical commercial assays | ||
| Sendai virus kit Cytotune | Invitrogen | Cat# A16517 |
| Plasmid DNA Extraction mini kit | Cat# DE-034 | |
| Xtra Maxi EF | Macherey-Nagel | Cat# 740424.50 |
| STEMdiff™ Hematopoietic Kit | STEMCELL | Cat# 05310 |
| STEMdiff™ Micorglia Differentiation Kit | STEMCELL | Cat# 100-0019 |
| STEMdiff™ Microglia Maturation Kit | STEMCELL | Cat# 100-0020 |
| RNeasy Mini kit | Qiagen | Cat# 74106 |
| Thermo Script RT-PCR | Invitrogen | Cat# 11146-024 |
| SuperScript IV First-Strand Synthesis System | Thermo Fisher Scientific | Cat# 18091050 |
| Deposited data | ||
| scRNA-data of this study | Deposited to GEO | GSE233295 |
| scRNA-seq for human adult cortex | Hao et al., 2021.18 | GSE164378 |
| scRNA-seq for human fetal brain | Cao et al., 2020.19 | GSE156793 |
| scRNA-seq for human cortical organoids | Birey et al., 2017.20 | SRA: SRP096997 |
| scRNA-seq for human cortical organoids | Fiddes et al., 2018.21 | SRA: SRP121791 |
| scRNA-seq for human cortical organoids | Giandomenico et al., 2019.22 | SRA: SRP174405 |
| scRNA-seq for human cortical organoids | Madhavan et al., 2018.23 | SRA: SRP131980 |
| scRNA-seq for human cortical organoids | Quadrato et al., 2017.24 | SRA: SRP083140 |
| scRNA-seq for human cortical organoids | Trujillo et al., 2019.25 | SRA: SRP139859 |
| scRNA-seq for human cortical organoids | Velasco et al., 2019.26 | SRA: SRP191528 |
| scRNA-seq for human cortical organoids | Xiang et al., 2017.27 | SRA: SRP105219 |
| scRNA-seq for human multiple sclerosis brain | Absinta et al., 2021.3 | GSE180759 |
| Experimental models: Cell lines | ||
| Human Embryonic Kidney (HEK293T) cells | ATCC | Cat# CRL-1573 RRID:CVCL_0045 |
| Oligonucleotides | ||
| Probe LV (ATCTCTCTCCTTCTAGCCTC) | This paper | N/A |
| Primer FW (TACTGACGCTCTCGCACC) | This paper | N/A |
| Primer REV (TCTCGACGCAGGACTCG) | This paper | N/A |
| TaqMan Assay for GAPDH, TUBB3, MBP, SOX10, S100B, MAP2, GFAP, OLIG2, CNP, CXCL8, AIF1, NAMPT. | This paper | Table S7 |
| Recombinant DNA | ||
| pZ M2rtTA_CAGG_TetON-Sox10 _GFP | Addgene | Cat# 115241 RRID:Addgene 115241 |
| #945.pCCL.sin.cPPT.SV40ployA.eGFP.minCMV.hPGK. deltaLNGFR.Wpre |
Kindly provided by Prof. Luigi Naldini | N/A |
| Plasmid coding for the non-correlated envelope of the vesicular stomatits virus (VSV, protein-G) | Kindly provided by Prof. Luigi Naldini | N/A |
| Plasmid coding for the packaging proteins MDLg/pRRE | Kindly provided by Prof. Luigi Naldini | N/A |
| Plasmid coding for REV protein | Kindly provided by Prof. Luigi Naldini | N/A |
| Software and algorithms | ||
| GraphPad Prism | https://Graphpad.com/ | N/A |
| Fiji | https://ImageJ.net/software/fiji/downloads | N/A |
| Monocle | https://www.bioconductor.org/packages/release/bioc/html/monocle.html | 2.18.0 |
| CellChat | https://github.com/sqjin/CellChat | 1.5.0 |
| Seurat | https://satijalab.org/seurat/ | 4.3 |
| R | https://www.r-project.org/ | 4.2 |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.