IL-10 deficiency aggravates cell senescence and accelerates BLM-induced pulmonary fibrosis in aged mice via PTEN/AKT/ERK pathway

Abstract

Background

Pulmonary fibrosis (PF) is an aging-related progressive lung disorder. The aged lung undergoes functional and structural changes termed immunosenescence and inflammaging, which facilitate the occurrence of fibrosis. Interleukin-10 (IL-10) is a potent anti-inflammatory and immunoregulatory cytokine, yet it remains unclear how IL-10 deficiency-induced immunosenescence participates in the development of PF.

Methods

Firstly we evaluated the susceptibility to fibrosis and IL-10 expression in aged mice. Then 13-month-old wild-type (WT) and IL-10 knockout (KO) mice were subjected to bleomycin(BLM) and analyzed senescence-related markers by PCR, western blot and immunohistochemistry staining of p16, p21, p53, as well as DHE and SA-β-gal staining. We further compared 18-month-old WT mice with 13-month-old IL-10KO mice to assess aging-associated cell senescence and inflamation infiltration in both lung and BALF. Moreover, proliferation and apoptosis of alveolar type 2 cells(AT2) were evaluated by FCM, immunofluorescence, TUNEL staining, and TEM analysis. Recombinant IL-10 (rIL-10) was also administered intratracheally to evaluate its therapeutic potential and related mechanism. For the in vitro experiments, 10-week-old naïve pramily lung fibroblasts(PLFs) were treated with the culture medium of 13-month PLFs derived from WT, IL-10KO, or IL-10KO + rIL-10 respectively, and examined the secretion of senescence-associated secretory phenotype (SASP) factors and related pathways.

Results

The aged mice displayed increased susceptibility to fibrosis and decreased IL-10 expression. The 13-month-old IL-10KO mice exhibited significant exacerbation of cell senescence compared to their contemporary WT mice, and even more severe epithelial-mesenchymal transition (EMT) than that of 18 month WT mice. These IL-10 deficient mice showed heightened inflammatory responses and accelerated PF progression. Intratracheal administration of rIL-10 reduced lung CD45 + cell infiltration by 15%, including a 6% reduction in granulocytes and a 10% reduction in macrophages, and increased the proportion of AT2 cells by approximately 8%. Additionally, rIL-10 significantly decreased α-SMA and collagen deposition, and reduced the expression of senescence proteins p16 and p21 by 50% in these mice. In vitro analysis revealed that conditioned media from IL-10 deficient mice promoted SASP secretion and upregulated senescence genes in naïve lung fibroblasts, which was mitigated by rIL-10 treatment. Mechanistically, rIL-10 inhibited TGF-β-Smad2/3 and PTEN/PI3K/AKT/ERK pathways, thereby suppressing senescence and fibrosis-related proteins.

Conclusions

IL-10 deficiency in aged mice leads to accelerated cell senescence and exacerbated fibrosis, with IL-10KO-PLFs displaying increased SASP secretion. Recombinant IL-10 treatment effectively mitigates these effects, suggesting its potential as a therapeutic target for PF.

Graphical Abstract

Supplementary Information

The online version contains supplementary material available at 10.1186/s12890-024-03260-x.

Background

Pulmonary fibrosis (PF) is a debilitating age-related lung disease characterized by the progressive scarring of lung tissue, leading to impaired gas exchange and respiratory failure [1–3]. Accumulating evidence suggests that immunosenescence, the age-related decline in immune system function [4, 5], plays a significant role in the pathogenesis of pulmonary fibrosis [6]. Immunosenescence is marked by a progressive deterioration in the immune system’s capacity to mount an effective response to infection, injury, or other environmental challenges [7, 8]. This decline is accompanied by a chronic, low-grade inflammation, termed “inflammaging,” [9, 10] which contributes to the development of age-related diseases, including pulmonary fibrosis [6, 11].

Interleukin-10 (IL-10), primarily produced by regulatory T cells, macrophages, and other immune cell types, plays a key role in mitigating excessive inflammatory responses and promoting tissue repair [12, 13]. Several studies have demonstrated that IL-10 plays a critical role in modulating the aging immune system, particularly by suppressing chronic inflammation [14] and promoting tissue repair [13, 15]. Recent researches have also shown that IL-10 deficiency is associated with increased susceptibility to fibrosis and exacerbated inflammatory responses in various models, including liver fibrosis [16, 17], cardiac fibrosis [18], and renal fibrosis [19], while hydrogel-based delivery of IL-10 or AAV-6 mediated IL-10 improves treatment of bleomycin-induced lung fibrosis in mice [20, 21] Moreover, aging IL-10-deficient murine lungs were adopted as a model of accelerated aging and frailty, reconciling features of both immunosenescence and lung aging [22]. However, the relationship between IL-10 deficiency induced immunosenescence and the development of PF remains poorly understood.

Cellular senescence is a state of irreversible cell cycle arrest that occurs in response to various stressors, including DNA damage, oxidative stress, and oncogene activation [23]. Senescent cells can promote tissue damage and contribute to the progression of fibrosis through the secretion of pro-inflammatory and pro-fibrotic factors, a phenomenon known as the senescence-associated secretory phenotype (SASP) [24, 25]. Recent evidences suggest that IL-10 promotes activated hepatic stellate cells (HSCs) senescence and alleviates liver fibrosis via STAT3-p53 pathway, while p53 science inhibites IL-10 deficiency-induced activated HSCs senescence and mitigates liver fibrosis [26, 27], futher studies reveal that senescent cells lead to enhanced SASP [25, 28, 29], and targeting those senescent cells improves fibrosis [30–32].

PF is involved in various cell types, including immune cells, fibroblasts, and epithelial cells [33, 34], as well as the dysregulation of numerous signaling pathways. Notably, IPF is driven by dysregulation of Alveolar type 2 (AT2) cells [35, 36], which are crucial in maintaining lung homeostasis for capable of self-renewal and differentiation to AT1 cells, protecting the alveolar epithelial cells integrity from acute and chronic injuries [37, 38]. IL-10 deficiency has been shown to exacerbate lung fibrosis by promoting the activation of pro-inflammatory and pro-fibrotic pathways [39–41], as well as enhancing the recruitment and activation of immune cells and fibroblasts [42, 43].

In this context, we aims to elucidate the role of IL-10 deficiency- induced immunosenescence in the development and progression of PF. We hypotheses that IL-10 deficiency accelerates the progression of PF through dysfunction of AT2 and enhanced SASP secreation of fibroblast. To test these hypotheses, we will investigate the molecular and cellular mechanisms underlying IL-10 deficiency -mediated regulation of inflammaging and cellular senescence in aging mice, with a focus on the regenerative AT2 cells and lung fibroblasts. Moreover, we will explore the potential therapeutic applications of IL-10 in the prevention and treatment of PF, offering novel insights into the complex interplay between immunosenescence and chronic lung diseases.

Materials and methods

Mice

Wild-type C57BL/6 N mice (male,2 month) were purchased from Beijing Vital River Laboratory Animal Technology (Beijing, China). IL-10 knockout (KO) mice were obtained from The Jackson Laboratory (Jax Cat# 002251) and kept in our lab for 9,13,18 month. SFTPC-EGFP mice were provided by Dr. Zhang Yuzhen, who obtained them from The Jackson Laboratory (Jax Cat# 028356). All mice were kept in a specific-pathogen-free (SPF) environment with controlled temperature (23–24 °C), humidity (55 ± 5%) and light (12-hour light-dark cycle). The mice were given free access to food and water. The in vivo manipulations were approved by the Institutional Animal Care and Use Committee of Tongji University (Number: TJBB00122107) and performed in accordance with ethical guidelines. The grouping of mice was randomized using computer-generated random numbers.

Primary lung fibroblasts isolation and treatment

Primary lung fibroblast cells (PLFs) were originally derived from 14 month WT mice and IL-10 KO mice lungs. Brifely, mice were anesthetized and their lungs were perfused with 5 mL of cold PBS, digested in HBSS for 30 min at 37 °C using several enzymes, including Collagen I (400 U/mL; Worthington), Dispase (5U/mL; Corning), Elastase (4 U/mL; Worthington), and DNase I (100 u/mL; Sigma). After neutralizing with an equal quantity of 10% FBS-contained DMEM medium, single-cell suspensions were filtered using a 70-µm cell strainer and washed with HBSS, then lysised with 1X red blood lysis and resuspended with MEM medium supplemented with 10% FBS, seeded in T25 cell culturing flask. After culturing for 3 h with upside down, turning the flask back to its right position to continue culturing until a single layer of cells were grown. The fibroblasts were purified through differential adhesion method [44]. The attached cell layer was trypsinized to single cell suspension, then plated onto a tissue culture flask for incubation for 40 min. The cells adhered to the substratum are largely fibroblastic in nature.

For PLFs treatment, naïve PLFs and old PLFs were isolated from 2 month and 13 month WT mice respectively, and cultured those cells to 7 passages. Naïve PLFs were treated with media collected from 13 month PLFs, or the control MEM medium for 72 h, then collected the naïve PLFs for PCR analysis of senescence related genes [45].

Bleomycin-induced lung fibrosis model

For establishing the BLM-induced fibrosis model, WT (13 m,18 m) and IL-10 KO mice(9 m,13 m,18 m) were humanely euthanized by administering 50 mg/mL of sodium pentobarbital (0.6 mg/10 g body weight). Under anesthesia, 2.5 mg/kg of bleomycin sulfate was administered intratracheally via a 20-gauge catheter, and the control mice received an equal amount of PBS. They were weighed every two days [46, 47]. Lung tissues were collected on day 7, 14,21. All pathological examinations were conducted on the left lung, while the right lung was frozen in liquid nitrogen and kept at − 80 °C for the following experiments.

Mouse lung dissociation and flow cytometry analysis

The mice were anesthetized, and their lungs were perfused with 5 mL of cold PBS and digested in HBSS for 30 min at 37 °C using several enzymes, including Collagen I (400 U/mL; Worthington), Dispase (5U/mL; Corning), Elastase (4 U/mL; Worthington), and DNase I (100 u/mL; Sigma) [36]. After neutralizing with an equal quantity of 10% FBS-contained DMEM medium, single-cell suspensions were filtered using a 100-µm cell strainer and washed with HBSS. Then, red blood cell lysis was performed, and the cells were blocked with CD16/32 and stained with primary antibodied. Briefly, primary antibodies for AECs including CD31-PECy7, CD34-PECy7, CD45-PECy7 and EpCAM-APC, or antibodies for macrophages and neutriphils including CD45-PEcy7, CD11b-BV510, Ly6G-BV786, F4/80-BV421, and Ki67 for AT2 proliferation using SPC-EGFP mice. Those antibodies were added to incubate cells for 15 min in the dark and 7-AAD or zombie yellow was added to identify dead cells. Flow cytometry was performed using BD-LSR Fortessa flow cytometer (BD Immunocytometry Systems, San Jose, CA) and analyzed using the Flow Jo 10.8.1 software (Tree Star, Ashland, OR).

BALF collection and FCM analysis

For BALF collection, once the mouse was anesthetized, made a midline incision on the neck to expose the trachea, and then inserted a 20-gauge catheter into the trachea and injected 1 ml of sterile PBS into the lung via the cannula. Aspirated the fluid back and repeated the lavage 3 times to increase the yield of cells and solutes from the alveolar space. Finally collected BALF for FCM staining. The cells were centrifuged at 400 g in 4 °C for 5 min and blocked with CD16/32 antibody. Then, they were stained with CD45 antibodies for 15 min, followed by washing and resuspension. Flow cytometry was performed using BD-LSR Fortessa flow cytometer.

Histology and immunohistochemistry

Mice from the BLM-induced fibrosis group were humanely sacrificed on indicated days. The left lungs were excised, fixed in 4% formaldehyde, and then dehydrated, embedded, and deparaffinized for hematoxylin and eosin (H&E) and Masson staining. For immunohistochemistry, paraffin sections of mice lungs were deparaffinized, and subjected to antigen retrieval and methanol treatment. They were blocked by 5% donkey serum and incubated with the P16, p21, P53 antibody (1:100, Santa Cruz, USA) overnight at 4 °C. After washing, the slides were incubated with species-specific secondary and streptavidin-HRP (1:1000, Cell Signaling Technology, USA) for signal amplification and visualized with diaminobenzidine (DAB). Bright-field images were captured with an upright microscope (Leica, Wetzlar, Germany).

Immunoflurescence staining

Paraffin-embedded lung tissues were sectioned at 5 μm, then deparaffinized and subjected to antigen retrieval for 20 min. After blocking with 5% BSA for 1 h at room temperature, the tissue sections were incubated overnight at 4 °C with primary antibodies a-SMA, or co-stained with CD45 and F4/80 (1:100, Cell Signaling Technology, USA), SPC (1:200, Millipore, USA) and Ki67(1:600, eBioscience, USA). After rinsing with PBS, the sections were incubated with conresponding fluorochrome-conjugated secondary antibodies (1:1,000, Cell Signaling Technology, USA) for 1 h at room temperature, protected from light, washed and counterstained with DAPI (Sigma-Aldrich, USA) for nuclear visualization. Then slides were mounted with an antifade medium and captured using a fluorescence microscope.

Terminal-deoxynucleoitidyl transferase-mediated Nick End Labeling (TUNEL) staining

Paraffin-embedded tissue Sect. (5 μm) were deparaffinized in xylene and rehydrated in a graded series of ethanol, washed in PBS for 5 min and permeabilized with 0.25% Triton X-100 for 2 min on ice. After permeabilization, the slides were washed with PBS and stained with TUNEL kit (A111-03, Vazyme Biotech Co. Ltd., China) following the manufacturer’s instructions. Brifly, 50 µL of TdT Enzyme solution was mixed with 450 µL of Label solution to create the TUNEL reaction mixture, and tissue sections were incubated with 50 µL of the TUNEL reaction mixture in a humidified chamber for 60 min at 37 °C in the dark. After incubation, slides were washed with PBS for 15 min, and then counterstained with 4’,6-diamidino-2-phenylindole (DAPI) for 5 min at room temperature to visualize the nuclei. Finally, fluorescent images were captured using a fluorescence microscope. TUNEL-positive cells and total cell nuclei were counted in at least five randomly selected fields per sample.

Real-time quantitative polymerase chain reaction (RT-qPCR)

RT-qPCR was performed to determine the expression of related genes. Lungs from aged WT or IL-10KO mice were collected 14 days and 21 days after BLM administration. Total RNA was isolated by Trizol reagent (Invitrogen), reverse transcribed into cDNA using the PrimeScript RT kit (Takara Bio, Inc), and reacted in a 10 µL reaction system using cDNA, specific primers and SYBR Green MasterMix (Applied Biosystems; Thermo Fisher Scientific, Inc.); three replicates of the experiment were performed. The samples were then analyzed by the Applied Biosystems ViiA 7 Real-Time PCR System (Thermo Fisher Scientific). The relative expression levels of the genes were calculated by the 2^−∆∆CT method. The primer sequences are shown in Table 1.

Table 1.

RT-qPCR primer sequences

Gene	Forward primer (5’-3’)	Reverse primer (5’-3’)
Actin	TGAGCTGCGTTTTACACCCT	GCCTTCACCGTTCCAGTTTT
GAPDH	TGTTTCCTCGTCCCGTAGA	ATCTCCACTTTGCCACTGC
IL-1β	GCAACTGTTCCTGAACTCAACT	ATCTTTTGGGGTCCGTCAACT
TNF-α	AAGCCTGTAGCCCACGTCGTA	GGCACCACTAGTTGGTTGTCTTTG
iNOS	CACCAAGCTGAACTTGAGCGA	CCATAGGAAAAGACTGCACCGA
IL-6	TAGTCCTTCCTACCCCAATTTCC	TTGGTCCTTAGCCACTCCTTC
Arg1	CTCCAAGCCAAAGTCCTTAGAG	GGAGCTGTCATTAGGGACATCA
IL-10	GCTCTTACTGACTGGCATGAG	CGCAGCTCTAGGAGCATGTG
MRC-1	TTCAGCTATTGGACGCGAGG	GAATCTGACACCCAGCGGAA
Ym1	CCAAGTGCAGCATGTGTCAG	CCTCTACGTTCCCCAAGTCG
P16	CTCTGCTCTTGGGATTGGC	GTGCGATATTTGCGTTCCG
P21	TAAGGACGTCCCACTTTGCC	CGTCTCCGTGACGAAGTCAA
P53	CACAATCCTCCCGGTCCCTT	GGTGTGGGGTAGGGTGAGATT
MMP1	GTCACTCCCTTGGGCTCAC	TGCTGCCTTTGAAATAGCGGAC
MMP3	CAGACTTGTCCCGTTTCCAT	GGTGCTGACTGCATCAAAGA
MMP9	CTACATAGACGGCATCCAG	CTGTCGGCTGTGGTTCAGT
Collagen1	GGAGGTGACAAGGGTGAA	CCAGTTTTCCCAGGAGGT
a-SMA	GCCCAGAGCAAGAGAGG	TGTCAGCAGTGTCGGATG
Vimentin	CTCCTACGATTCACAGCCA	GAGCCACCGAACATCCT
Fibronectin	CGTCATTGCCCTGAAGA	GAAGATTGGGGTGTGGAA

Western blotting assay

Mice lungs from different groups were homogenized and lysed with RIPA, and the cells were collected with RIPA buffer. Then, the Bicinchoninic acid assay (BCA) kit (ThermoFisher Scientific) was used following the manufacturer’s instructions. All proteins were separated by electrophoresis and transferred onto PVDF membranes (Millipore). After blocking with 5% non-fat milk in TBST for 1 h, the membranes were incubated with primary antibodies overnight at 4 °C, followed by incubation with corresponding secondary antibodies for 1 h. Then, the bound antibodies were detected by Enhanced Chemiluminescence(ECL)reagent (Share-Bio). Primary and secondary antibodies were diluted to 1:1000. Anti-GAPDH, a-SMA, PTEN, PI3K, AKT, Smad2/3, Smad4, ERK, p-ERK were purchased from Cell Signaling Technology (Beverly, USA); E-cadherin, Collagen1, Collagen3 antibodies were from Abcam (Cambridge, UK), and anti- P16, P21, P53 antibodies were obtained from Santa Cruz (CA, USA).

Reactive oxygen species (ROS) assay

The cellular ROS level was measured by the ROS assay kit (S0033, Beyotime Technology Inc., China) according to its instructions. Brifely, fresh lung frozen sections were stained with 10µM Dihydroethidium (DHE) in a humidified chamber protected from light at 37 °C for 30 min. Post incubation, slides were washed three times with PBS, mounted using antifade mounting medium, and the coverslip was applied. The stained tissues were visualized under a fluorescent microscope.The images were analyzed, and the intensity of DHE fluorescence, which corresponds to the amount of reactive oxygen species (ROS) present in the tissue, was quantified using ImageJ software.

Measurement of the activity of senescence associated beta galactosidase (SA-β-gal)

The activity of SA-β-gal in freshly isolated mouse lungs was determined using 5-bromo-4-chloro-3-indolyl P3-D galactoside (X-gal), following the previous protocol [48]. For β-gal staining, frozen sections were first rinsed with PBS and then incubated at 37℃ in X-gal staining solution overnight in the dark. Following staining, sections were washed with PBS, counterstained with nuclear fast red for 5 min, then dehydrated through a graded series of ethanol (70%, 95%, and 100%) for 2 min each, and cleared in xylene for 5 min. Slides were then mounted with a non-aqueous, permanent mounting medium. SA-β-gal-positive cells (blue color) were counted under microscope and expressed as % of total cells.

Transmission electron microscope (TEM) analysis

The fresh mice lung were immediately fixed with 2.5% glutaraldehyde solution, performed in 1% osmium tetroxide in the same buffer for 2 h at room temperature, then dehydrated, embedded and polymerized in a 60 °C oven for 48 h. Ultrathin sections (approximately 60–70 nm) were prepared and collected on 200-mesh copper grids, stained with 2% phosphotungstic acid for 5 min at room temperature. The prepared slides were examined under a transmission electron microscope (TEM; Hitachi, HT7700) [49]. The microscope was operated at an accelerating voltage of 80 kV. Images of the regions of interest were captured and analyzed.

Statistical analysis

The data were calculated as the mean ± standard error of the mean (SEM) and analyzed using GraphPad Prism 8.0 (GraphPad Software, Inc.). For comparing data between groups, Student’s t-tests were performed for non-paired replicates, while comparisons among multiple groups were performed by the one-way analysis of variance (ANOVA), followed by Tukey’s multiple comparison tests. All differences among and between groups were considered to be statistically significant at p < 0.05.

Results

The aged mice are more susceptible to BLM-induced pulmonary fibrosis

The aging population has an elevated risk of developing pulmonary fibrosis(PF), a progressive and fatal lung disease. To investigate the response of aged and young mice to pulmonary fibrosis, young mice at 2 months and old mice at 18 months were used in this study. BLM (2.5 mg/kg) was administered intratracheally to induce PF, and control groups received an equal volume of saline. Lung tissues were collected at 14 days post-treatment for histological and molecular analyses. Hematoxylin and eosin (H&E) staining showed that aged mice exhibited more severe lung injury and increased collagen deposition in response to BLM treatment compared to young adult mice (Fig. 1A), and FCM analysis suggested that the proportion of CD45 + immune cells in 18-month-old WT mice had incresaed from 38.4% at baseline to 55.3%, with an additional 8% increase observed 14 days after BLM induction (Fig. 1B). Since the alveolar epithelial barrieris the first physical barrier preventing inflammatory infiltration when damaged, we analyzed the overall propotion of epithelial cells and found it decreased by about 5% in 18-month mice (Fig. 1C), with the statistical results supplied in Fig. 1D and E respectively, consistent with the previous finding that the senile individuals suffer persistent inflammaging [9, 10]. Moreover, Masson’s trichrome and immunofluorescent staining showed that aged mice displayed more serious fibrosis, especially higher α-SMA deposition in both PBS and BLM-treated groups, indicating increased myofibroblast activation in aged mice (Fig. 1F, G). Further, we investigated the induction of aging in young and old mice subjected to bleomycin, and found that the aging-related genes such as P16, P21, and P53 were upregulated in mice with BLM induction, regardless of whether they were young or old. Moreover, the expression of these genes was higher in the aged mice group than that of young mice when subjected to BLM (Fig. 1H). Interestingly, IL-10, a pleiotropic anti-inflammatory cytokine, was found to decreased in PF in all BLM-mice (Fig. 1H). All those data suggest that the aged mice are more susceptible to BLM-induced fibrosis and cell senescence.

Fig. 1.

Increased Susceptibility to Bleomycin-Induced Pulmonary Fibrosis in Aged Mice. (A) Hematoxylin and eosin (H&E) staining of 2 month young mice and 18 months old mice with BLM (2.5 mg/kg). (B-E) FCM analysis of CD45⁺ cells and alveolar epithelial cells(AECs: Lin-Epcam+) in PBS or BLM-treated young and old mice. (F,G) Representive images of Masson’s trichrome staining andimmunoflurescense staining of α-SMA in indicated mice, along with their quantitative analysis including Ashcroft scoring and fluorescence intensity analysis using ImageJ (scar bar 100 μm). (H) PCR analysis of aging-related genes, including P16, P21, P53 and IL-10 in PBS or BLM-treated young or old WT mice(N = 3–5/group). Data are presented as Mean + SEM. p < 0.05 indicates statistical significance

IL-10 deficiency aggravated cell senescence

Recent studies showed that IL-10 in involved in HSCs senescence during liver fibrosis. To uncover the effect of IL-10 decrease in pulmonary fibrosis, middle aged 13-month WT mice and IL-10 KO mice were subjected to BLM induction and then analyzed the senescence related markers, finding that 13-month IL-10 deficiency mice showed a significant exacerbation of cell senescence compared to WT mice, as evidenced by elevated levels of p16, p21 and p53, key regulators of the cell cycle and senescence (Fig. 2A). Thus we used these “middle aged” IL-10 KO mice and “aged” 18-month WT mice to further testify this hypothesis, and it was amazing that middle aged IL-10 deficiency mice should had higher p16, p21 and p53 than aged WT mice in all indicated times (Fig. 2B, C,D). Furthermore, those IL-10 KO mice showed increased β-gal staining, a well-established marker of senescence, suggesting an enhanced SASP (Fig. 2E). PCR analysis also indicated that 13-month IL-10 KO mice had a upregulation of p16,p21, p53 and MMP3 than 18-month WT mice in the baseline, and had higher expression of those genes when treated with BLM on day 7,14 (Fig. 2F). Moreover, DHE staining demonstrated that no matter in steady state or BLM exposure, IL-10 deficient mice had an increased production of reactive oxygen species (ROS) (Fig. 2G), which was known to contribute to the onset of senescence. Additionally, to testify the hypothesis, 9-month old IL-10 KO mice and 13 month WT mice were further exposed to BLM induction, showing that 9-month IL-10KO mice had a comparable ROS level to 13-month WT mice(Fig. 2H), and even more β-gal deposion (Fig. 2I), underscoring an evident accelerated senescence of IL-10 deficiency.

Fig. 2.

IL-10 deficiency accelerated cellular senescence during PF. (A) Immunohistochemistry (IHC) staining of p16, p21, p53 of 13 m WT and 13 m IL-10 KO mice on BLM-d14. (B-D) IHC staining of p16,p21,p53 of 18 m WT and 13 m IL-10 KO mice with PBS or BLM adminstration. (E) SA-β-gal staining of 18 m WT and 13 m IL-10 KO mice with PBS or BLM adminstration. (F) PCR analysis of P16, P21, P53 and MMP3 in PBS or BLM-treated 18 m-WT or 13 m-IL-10 KO mice. (G) DHE staining of PBS or BLM-treated 18 m-WT or 13 m-IL-10 KO mice. (H) DHE staining of PBS or BLM-treated 13 m-WT or 9 m-IL-10 KO mice. (I) Representive image of SA-β-gal staining in 13 m WT and 9 m IL-10 KO mice treated with PBS or BLM. (N = 3–5/group). Data are presented as Mean + SEM. p < 0.05 indicates statistical significance

IL-10 deficiency-induced immunosenescence accelerated BLM-induced pulmonary fibrosis

As pulmonary fibrosis is partly driven by cell senescence [30, 50], we wonder whether IL-10 deficiency induced accelerated senescence drives the severity of PF. We first analyzed the early inflamation infiltration process during fibrosis. As shown in H&E staining and co-satining of CD45 and F4/80, 13-month IL-10 KO mice suffered a severe inflammatory infiltration than 18-month WT mice on both day7 and 14 (Fig. 3A, B),consistent with the following FCM analysis of CD45⁺ immune cells in the lung and bronchoalveolar lavage fluid (BALF) (Fig. 3C-F), especially the neutriphils (CD11b⁺Ly6G⁺) and macrophages (CD11b⁺ F4/80⁺) (Fig. 3G, H), and even with a decrease of anti-imflammatory M2 related genes (Fig. 3I). Besides, we analysed fibrosis process in those indicated groups. Masson staining showed that 13-month IL-10 KO mice suffered more collagen deposion (Fig. 3J), which was further validated at mRNA (Fig. 3K) and protein level by immunofluorescence (Fig. 3L, M), including collagen1, a-SMA, fibronectin and vimentin. All those results uncovered a increase of inflammation and fibrosis of IL-10 deficiency mice than the much younger WT mice.

Fig. 3.

IL-10 deficiency aggravated inflammaging and accelerated BLM-induced pulmonary fibrosis. (A, B) H&E staining or Co- immunoflurescense staining of CD45 and F4/80 in PBS or BLM-treated 18 m-WT or 13 m-IL-10 KO mice. (C) Gating strategy for total immune cells (CD45⁺),neutrophils (CD45⁺CD11b⁺Ly6G⁺) or monocytes (CD45⁺CD11b⁺Ly6G^-).(D, E) Representative FCM images of CD45⁺cells in lung and BALF. (F, G, H) Statistic results of CD45 in lung and BALF, with propotion of neutrophils and macrophages in the lung. (I) PCR analysis of macrophages related genes in PBS or BLM-treated 18 m-WT or 13 m-IL-10 KO mice, including MRC1, Dectin1, Arg1, YM1. (J) Representative Masson images in indicated mice. (K) Representive mRNA expression of fibrosis-related genes in indicated mice, including collagen1, a-SMA, fibronectin and vimentin. (L, M) Representive immunoflurescense image of α-SMA and Collagen1 in indicated mice (N = 3–5/group). Data are presented as Mean + SEM. p < 0.05 indicates statistical significance

IL-10 deficiency impaired AT2 proliferation without affecting its apoptosis

Recently, emerging evidences suggested that IL-10 had an influence on AT2 function, an essential player in lung repair and regeneration. To elucidate how IL-10 deficiency impact AT2 function during PF, proliferation and apoptosis of AT2 were evaluated using BLM-inducd 18-month WT and 13-month IL-10 KO mice. Figure 4A illustrated the gating strategy for identifying AT2 cells and their proliferation. FCM analysis revealed that the proportion of AT2 cells in 13-month IL-10 KO mice was consistently lower than in 18-month WT mice, both under baseline conditions (3.09% vs. 5.75%) and following BLM treatment (2.34% vs. 3.54%) (Fig. 4B). As AT2 propotion could be influenced by many factors including proliferation and apoptosis, to further uncover the potential reasons, we analyzed the proliferation of AT2 and found it significantly inhibited in 13 m-IL-10KO mice, with only 9.56% compared to 14.7% in 18 m-WT mice after BLM treatment (Fig. 4C, D), which was corroborated by immunofluorescence results (Fig. 4E). Then TUNEL staining with AT2 specific marker SPC indicated that, compared to “aged” WT mice, “middle aged” IL-10KO mice exhibit an increase in the total number of TUNEL-positive cells. However, the proportion of SPC⁺TUNEL⁺ cells does not show a significant difference. Therefore, we hypothesize that aging IL-10KO mice primarily affect AT2 cell function by inhibiting their proliferation rather than directly inducing apoptosis. Further transmission electron microscope(TEM) analysis uncovered several notable changes in the 13month IL-10KO mice lung compared to 18 month WT mice (Fig. 4H). we saw an increase in the thickness of the alveolar walls, a consequence of collagen and elastin fiber accumulation, leading to a decrease in the alveolar surface area. This, in turn, affected gas exchange efficiency. The alveolar septa were also found to be thickened, accompanied by an increase in the number of fibroblasts and myofibroblasts, indicative of a higher state of fibrosis. These alterations overall suggested a progressive decline in AT2 function and structure that associated with IL-10 deficiency in aged mice.

Fig. 4.

IL-10 deficiency inhibited AT2 proliferation and promoted its apoptosis. (A) Gating strategy of ki67⁺AT2 cells using SPC-EGFP mice. (B, D) representative FCM images of SPC-EGFP positives AT2 cells in BLM-treated 18 m-WT mice or 13 m-IL-10KO mice. (C, D) representative FCM images of ki67⁺AT2 cells in the indicated groups. (E, F). representative IF images of SPC and Ki67 in indicated mice. (G, H). Representive images of TUNEL staining with SPC (G) and TEM analysis (H) of BLM-treated 18 m-WT or 13 m-IL-10 KO mice(N = 3–5/group). Data are presented as Mean + SEM. p < 0.05 indicates statistical significance

Recombinant IL-10 administration alleviated BLM-induced cell senescence and fibrosis in aged mice

To further investigate the effects of recombinant IL-10 (rIL-10) on BLM-induced cellular senescence and fibrosis, 13 month IL-10KO mice were exposed to BLM and then administered with intratracheal rIL-10 (200ng/kg) or PBS once daily for seven days. H&E and FCM examination were conducted on 14 days post BLM, finding that rIL-10 effectively mitigated inflammatory CD45⁺ cells, especially neutriphils and macrophages infiltration during fibrosis (Fig. 5A, B,D). As AECs injury may cause the impairment of epithelial barriers and lead to this inflamatory exudation, we analyzed the proportion of AT2 using SPC-EGFP mice, finding that rIL-10 rescued the AECs injury especially the regenerative SPC⁺AT2 (Fig. 5C, E). Besides, Masson and IF staining suggested that rIL-10 administration rescused the BLM-induced fibrosis, especially reduced a-SMA and Collagen I deposion (Fig. 5F, G). Immunohistochemistry staining also discovered an obvious decrease in senescence marker including p16, p21 (Fig. 5H). All those results indicated a protective role of intratracheal rIL-10 administration in immunosenescence BLM mice.

Fig. 5.

Recombinant IL-10 alleviated BLM-induced pulmonary fibrosis in IL-10 KO mice. (A) H&E staining of 13-month IL-10 ko mice treated with or without BLM. (B, D) Representative FCM images of CD45⁺cells, neutrophils(CD45⁺CD11b⁺Ly6G⁺) and macrophages (CD45⁺CD11b⁺F4/80⁺) in the indicated lungs.(C, E) Representative FCM images of SPC-EGFP positive AT2 cells. (F, G) Masson and immunoflurescense staining of α-SMA or Collagen1 in 13 m IL-10KO mice treated with rIL-10. (H) IHC staining of p16, p21 in rIL-10 treated mice(N = 3–5/group). Data are presented as Mean + SEM. p < 0.05 indicates statistical significance

IL-10 protected cell senescence by inhibiting PLFs secreting SASP and attenuated fibrosis via TGF-β/smad/ PTEN/PI3K AKT pathway

Next, to testify our hyposis that senescent IL-10KO PLFs might play its role by secreting SASP, 10w naïve PLF were treated with the culture medium(CM) of 13-month PLFs derived from WT, IL-10KO, or IL-10KO + rIL-10 respectively. It found that compared to the CM of 13-month WT mice, the CM from 13-month IL-10KO mice could upregulate the senescence gene in naïve PLFs, including p16,p53, MMP1 and MMP9, which could in turn reduced by the CM pre-treated with rIL-10 (Fig. 6A, B). Further IF staining suggested a similar trends in fibroblasts differentiation, evidenced by decrease of PCNA⁺ a-SMA⁺ cells in rIL-10 pre-treated PLFs (Fig. 6C). Mechanically, TGF-β treatment increased fibrosis-related proteins in 13 m-WT-PLFs, including Collagen1, Collagen3, and a-SMA (Fig. 6D, E), as well as senescence-related proteins such as p16 and p53 (Fig. 6D, F). Additionally, fibrosis-related pathways such as the TGF-β-Smad2/3 pathway and the PTEN/PI3K/AKT/ERK pathway were activated (Fig. 6D, G). However, pre-treatment with IL-10 prior to TGF-β stimulation was able to reverse the upregulation of these proteins and the activation of these pathways induced by TGF-β alone (Fig. 6D-G). These findings suggest that IL-10 may have potential therapeutic implications in the management of fibrotic and senescent conditions.

Fig. 6.

Recombinant IL-10 inhibited SASP secretion via TGF-β/smad and PTEN /PI3K/ AKT/ ERK signalings. (A) Flow chart of SASP analysis. 13-month PLFs were isolated from WT or IL-10 KO mice, then treated with or without rIL-10(10ng/ml) for 48 h. Fresh isolated naïve PLFs were treated with the indicated culture medium(CM) for anothor 48 h, and then PCR analysis (B) was performed for Senescence Associated Secretory Phenotype (SASP), including P16,P53,MMP1,MMP9. (C) Representative IF images of a-SMA and PCNA co-staining in the indicated naïve PLFs. (D-G) Representative western blotting analysis of fibrosis, including Collagen1, Collagen3, a-SMA (E) and senescence related proteins including P53, P16 (F), as well as the coresponding pathways including Smad2/3, Smad4, PTEN, AKT, ERK, p-ERK (G)

Discussion

IPF is an age-related disease, with a mean age of onset of 65 years, and these populations tend to be immunocompromised. Of note, this aging immune system (immunosenescence) has increased morbidity and mortality in the elderly [51]. However, previous studies have focused on the use of 2-month-old mice to induce fibrosis models, which is inconsistent with the age and immunocompromised reality of clinical IPF patients. In order to more realistically simulate the pathology of clinical IPF, we selected 13-month-old and 18-month-old mice for the first time to model different stages of aging and their corresponding effects on PF. According to JAX Lab, mice aged 13 months fall within the middle age group, which corresponds to humans aged 38–47 years. This period represents a phase where significant physiological changes begin to occur, but not all senescent changes are fully apparent. Mice aged 18 months, on the other hand, are considered old and correlate with humans aged 56–69 years. This age range is characterized by the presence of senescent changes in almost all biomarkers across all animals.

When 13-month IL10KO mice and WT mice were exposed to BLM respectively, and the expression of senescence markers in lung tissues was compared, we found that 13-month-old IL-10 KO mice exhibited more senescence than that of WT mice. Remarkably, these IL-10 KO mice also showed more senescent cells than 18-month-old WT mice, which indicates that the “middle-aged” IL-10 KO mice experienced accelerated aging, appearing biologically older than the “old” WT mice. In the meanwhile, PLFs derived from 13-month IL-10KO mice also showed a more severe senescence compared to that of 18month WT mice. Those in vivo and in vitro results indicate that IL-10 deficiency aggravates cell senescence, a state of irreversible cell cycle arrest that contributes to tissue aging and various pathologies. More importantly, recombonant IL-10 adminstration could alleviate cell senescence induced by BLM or TGF-β, consistent with previous reports that IL-10 has anti-senescence effects in different cell types, including fibroblasts and endothelial cells [52].

Nowadays, numerous studies have explored the therapeutic potential of IL-10 in animal models and clinical trial [13], with a significant focus on inflammatory bowel disease (IBD) [53, 54] or as immunotherapy for solid tumors [55]. Administration of IL-10 or IL-10 overexpression in different animal models of colitis has proved consistently beneficial [54, 56], while adverse effects and related mechanisms remain challenges. For rheumatoid arthritis and psoriasis, IL-10 administration has shown promising results in both preclinical and clinical studies [57, 58].

There are various strategies for IL-10 intervention, including administering recombinant IL-10, using agonists to boost IL-10 production, or delivering IL-10 through viral vectors [59]. However, preclinical results have been inconsistent, and IL-10 targeting for neuroimmune disorders has not yet been tested in clinical settings. In all, while IL-10 shows therapeutic potential in various diseases, the clinical application is complex due to its dual role in different pathologies. Further research is needed to refine these strategies and better understand the underlying mechanisms.

Hagai Yanai and his colleagues showed that primary lung fibroblasts from IPF patients had an accelerated cellular senescence and rapid accumulation of α-SMA, providing a new evidence that cell senescence was the bridge connecting aging and its prevalent outcome ‐‐ pulmonary fibrosis [60], and we found that IL-10 deficiency not only expedited cell senescence but also accelerated the following pulmonary fibrosis, showing that IL-10 defficiency strengthened this causality of cell senescence and fibrosis, therefore the early intervention with IL-10 may be a potential stratage to alleviate this intractable disease. Our further in vivo administration rIL-10 testified this protective effects of IL-10 on cell senescence and fibrosis, which was evidenced by the decrease of inflamatory CD45⁺cells infiltration especially CD11b⁺ Ly6G⁺ neutriphils and CD11b⁺ F4/80⁺ macrophages. In addition, rIL-10 intervention increased the propotion of SPC⁺AT2 cells, which maintained the epithelial barrier integrity therefore reduced the inflammatory exudation and oxidative stress.

It is reported that IL-10 may exert its anti-senescence effects by modulating the inflammatory microenvironment, which is known to promote senescence, and our in vitro culture of naïve PLF with the CM from senescent PLFs showed that IL-10KO-PLFs might play its role by secreting SASP, for it could induce the naïve PLFs to express higher p16, p53, MMP1 and MMP9, promoting it to a senescent phenotype. while the CM pre-treatment with rIL-10 reversed the those senescence markers in naïve PLFs, indicating an improtant role of IL-10 in inhibiting SASP.

Mechanically, previous studies demonstrated that in vivo IL-10 administration attenuated BLM-induced PF by inhibiting TGF-β production and activation [61, 62], and consistently, our data suggested that IL-10 deficiency led to enhanced activation of the TGF- β/Smad pathway, a key regulator of fibrosis. Further, it resulted in the downregulation of PTEN and the activation of the PI3K/AKT/ERK pathway, which is known to promote cellular senescence [63, 64]. This finding suggests that IL-10 may play a protective role in pulmonary fibrosis, possibly by suppressing inflammatory cells infiltration and SASP secreation by senescenct fibroblasts, two key processes in the pathogenesis of this disease. Therefore, targeting IL-10 and its downstream pathways may be a promising therapeutic strategy for pulmonary fibrosis. Further studies are needed to fully understand the mechanisms underlying the protective effects of IL-10 in PF and to develop effective IL-10-based therapies for this devastating disease.

Conclusion

In conclusion, this study discovers that IL-10 deficiency exacerbates the aging-associated cell senescence, leading to a heightened inflammatory response and accelerated progression of pulmonary fibrosis in aged mice. IL-10KO-PLFs can secrete more SASP cytokines therefore stimulate the naïve PLFs to express higher aging and senescence markers than that of WT-PLFs, while in vivo recombinant IL-10 intervention reverses this plight, alleviates BLM-induced cell senescence and inhibites the following fibrosis via TGF-β/smad2/3 and PTEN/PI3K/AKT/ERK pathways. All those results highlights the potential of IL-10 as a therapeutic target in senescence and pulmonary fibrosis. However, further research is required to explore its role in aging and PF, especially develop effective IL-10-based therapies for this progressive disease.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Abbreviations

IPF

Idiopathic pulmonary fibrosis

IL-10

Interleukin-10

KO

knockout

AECs

Alveolar epithelium cells

AT1

Alveolar type 1

AT2

Alveolar type 2 cells

BLM

Bleomycin

TGF-β

Transforming growth factor-β

a-SMA

α-Smooth Muscle Actin

PLFs

Primary lung fibroblasts

SPC

Surfactant protein C

TNF-a

Tumor necrosis factor-a

F4/80

Epidermal growth factor-like module-containing mucin-like hormone receptor-like 1

PBS

Phosphate-buffered saline

FBS

Fetal bovine serum

SASP

Senescence-associated secretory phenotype

PTEN

Phosphatase and tension homolog

Author contributions

Yinzhen Li: Conceptualization, Investigation, Conducting experiments, Formal analysis, Writing - original draft. Hui Yin: Conducting experiments, interpretation of data. Huixiao Yuan: Conceptualization, Investigation. Enhao Wang: Conducting experiments. Chunmei Wang: data curation. Hongqiang Li: Investigation. Xuedi Geng: Analyzing the histomorphology. Ying Zhang: drafting the article, Supervision. Jianwen Bai: Conceptualization, Funding, Supervision. All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported by the National Natural Science Foundation of China (Grant Nos. 82070073, 81670067 and 82003182) and Shanghai Pudong New Area Summit(emergency medicine and critical care) construction project(Grant No. PWYgf2021–03).

Data availability

Data is provided within the manuscript or supplementary information files.

Declarations

Ethics approval and consent to participate

The animal experiments were approved by the Institutional Animal Care and Use Committee of Tongji University (Number: TJBB00122107) and performed in accordance with ethical guidelines. Besides, the study is reported in accordance with ARRIVE guidelines.

Competing interests

The authors declare no competing interests.