Efficacy of aqueous extract of flower of Edgeworthia gardneri (Wall.) Meisn on glucose and lipid metabolism in KK/Upj-Ay/J mice

Abstract

OBJECTIVE

To observe the effects of the flower of Edgeworthia gardneri (Wall.) Meisn (EWM) on glucose and lipid metabolism in KK/upj-Ay/J (KKAy) mice and investigate the possible mechanism of EWM in the liver of KKAy mice by transcriptome analysis.

METHODS

Forty KKAy mice were fed a high-sugar and high-fat diet for 3 weeks to establish the animal model of metabolic syndrome. After 5 weeks of continuous administration of EWM, serum high-density lipoprotein (HDL), low-density lipoprotein (LDL), triglycerides (TG), total cholesterol (TC), and free fatty acids (FFA) were detected by radioimmunoassay. Serum fasting insulin (Fins) and adiponectin levels were measured by enzyme-linked immunosorbent assay. Liver tissue fixed with paraformaldehyde was stained with hematoxylin-eosin and oil red O. Transcriptome analysis was used to evaluate the liver tissue. The expressions of lipoprotein lipase (LPL), peroxisome proliferator-activated receptor-γ (PPARγ), adenosine 5‘-monophosphate-activated protein kinase (AMPK), sterol regulatory element binding protein-1c (SREBP-1c), and fatty acid synthase (Fas) mRNA and protein in liver tissue were detected by reverse transcription-polymerase chain reaction (RT-PCR) and Western blot analysis.

RESULTS

EWM slightly reduced FBG and Fins in KKAy mice. Furthermore, EWM was able to downregulate serum LDL, TG, TC, and FFA and upregulate the expression of serum HDL and adiponectin. Transcriptome analysis revealed the following differential pathways: the peroxisome proliferator-activated receptor (PPAR) signaling pathway and the AMPK signaling pathway. RT-PCR and western blot analysis detected the associated genes and proteins. In addition, EWM was able to upregulate the expression of AMPK and downregulate the expression of PPARγ, SREBP1c, and Fas mRNA and protein and upregulate the expression of LPL mRNA.

CONCLUSIONS

EWM can alleviate lipid metabolism disorders and to some extent improve glucose metabolism disorders in KKAy mice. These effects may be related to regulating PPARγ/LPL and activating the AMPK/SREBP1c/Fas pathway.

1. INTRODUCTION

Metabolic syndrome is a group of metabolic disorders, including hypercholesterolemia, elevated plasma triglycerides, decreased HDL-cholesterol level, central obesity, and hypertension, and insulin resistance is a potential associated pathogenic factor.¹ In recent years, urbanization, a sedentary lifestyle, the overconsumption of nutrients, and an unhealthy diet have been found to be the main causes of these disorders.² Non-alcoholic fatty liver disease (NAFLD) can be regarded as the liver manifestation of metabolic syndrome.³ At present, the prevalence of metabolic syndrome in the general population is about 25%.⁴ NAFLD is a chronic progressive liver disease. The pathogenesis and complications of NAFLD are complex and not completely clear. However, natural supplements may be a good resource to explore safe and effective agents for the treatment of NAFLD.

The flower of Edgeworthia gardneri (Wall.) Meisn (EWM) (Lü Luo Hua in China) is consumed as an herbal tea in Tibet. The flower of EWM can improve glucose metabolism disorders. In vivo experiments have shown that EWM extract can reduce fasting blood glucose (FBG) in a diabetic mouse model.⁵ Furthermore, in vitro experiments on lipid metabolism have shown that the ethyl acetate extract of EWM has anti-adipogenesis effects on 3T3-L1 adipocytes.⁶ However, only a few in vivo studies have been conducted on lipid metabolism using the aqueous extract of EWM, particularly concerning its the mechanism of action in the liver, which remains unclear. In order to explore the effects of the aqueous extract of EWM, we used KKAy mice as an animal model of metabolic syndrome and used transcriptomics to investigate possible mechanism of its action.

2. MATERIALS AND METHODS

2.1. Animals

Six-week-old male C57BL/6J (C57) and KK/upj-Ay/J (KKAy) mice and high-sugar, high-fat feed were purchased from the Chinese Academy of Medical Sciences Laboratory Animal Research Institute with license number SCXK (Beijing, China) 2014-0004. The animal experiments were approved by the Subcommittee of Experimental Animal Ethics of the Academic Committee of Beijing University of Chinese Medicine, No. BUCM-4-2018120301-4052.

Ten C57 mice were fed a normal maintenance diet and 40 KKAy⁷ mice were fed a high-sugar, high-fat diet. Three weeks later, based on FBG levels ≥ 11.1, 40 KKAy mice were divided into four groups, with 10 mice in each group. They included the KKAy group; KKAy + metformin (KKAy + M) group (1.0 g/kg); KKAy + aqueous extract of EWM low-dose (KKAy + A-L) group (0.134 g/kg); and KKAy + aqueous extract of EWM medium-dose (KKAy + A-M) group (0.268 g/kg). The treatment was prepared with ultrapure water, 0.5 mL per 100 g body weight, and subjected to ultrasonic dissolution for 30 min. It was administered by gavage once a day for 5 weeks. Both C57 and KKAy mice were given the same volume of ultrapure water.

2.2. Aqueous extract of EWM and Identification of EWM components by liquid chromatography-mass spectrometry (LC-MS)

The flower of EWM was purchased from Sichuan Hao Rui Jia Biotechnology Co., Ltd. (Chengdu, China) and authenticated by Professor Tunhai Xu (School of Chinese Materia Medica, Beijing University of Chinese Medicine). Voucher specimens have been deposited at the Department of Pharmacology, School of Chinese Medicine, Beijing University of Chinese Medicine. Metformin hydrochloride tablets (lot AAY0148, Sino-American Shanghai Squibb Pharmaceuticals Ltd., Shanghai, China) were also obtained from Sino-American Shanghai Squibb Pharmaceuticals Ltd.

The aqueous extract of EWM was prepared as follows: 1272.01 g of EWM was decocted with water three times, in a ratio of 1:15 (EWM:water). Each decoction lasted 2 h, and the dregs were filtered out. The filtrate was concentrated to a relative density of about 1.00-1.10 (80 ℃), cooled, freeze-dried overnight, and made into 174.82 g extract powder, with an extraction rate of 13.74%. The extract was stored at 4℃. The LC-MS detection and analysis were conducted by OE Biotech Co., Ltd. (Shanghai, China).

2.3. Serum and histology examination

Food intake, water consumption, body weight, and FBG of mice in each group were measured every week (Rapid blood glucose meter, lot GT-1941, ARKRAY, Inc., Kyoto, Japan; blood glucose test strips, lot m193E06, ARKRAY, Inc., Kyoto, Japan). Serum high-density lipoprotein (HDL), low-density lipoprotein (LDL), triglyceride (TG), total cholesterol (TC), and free fatty acids (FFA) were evaluated by the Beijing SINO-UK Institute of Biological Technology. Detection of serum fasting insulin (Fins) (lot GR313414-1, Abcam, Cambridge, Massachusetts, USA) and adiponectin (lot GR3231129-2, Abcam, Cambridge, Massachusetts, USA) expression was achieved by enzyme-linked immune-osorbent assay kits. The insulin resistance index was calculated as follows: homeostasis model assessment of insulin resistance (HOMA-IR) = FBG (mmol/L) × Fins (ng/mL) / 22.5. Liver tissue was fixed in 4% paraformaldehyde and frozen. Paraffin embedded sections of the frozen liver tissue were subsequently made. Paraffin sections were subjected to hematoxylin-eosin (HE) staining, frozen sections were subjected to oil red O staining, and the ipsilateral liver tissues were immediately placed in liquid nitrogen for transcriptome analysis, reverse transcription-polymerase chain reaction (RT-PCR) and Western blot detection.

2.4. Transcriptome

Transcriptome sequencing and analysis were conducted by OE Biotech Co., Ltd., Shanghai, China. The main transcriptome processes are as follows: RNA extraction and library preparation, quality control and mapping, Gene-level quantification, analysis of differentially expressed genes (DEGs), cluster analysis, Gene Ontology (GO), and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment.

2.5. Real-time quantitative RT-PCR

Quantification was carried out using a two-step reaction process comprising reverse transcription and PCR. At the end of the PCR cycles, melting curve analysis was performed to validate the specific generation of the expected PCR product. The primer sequences were designed in the laboratory and synthesized by TsingKe Biotech (Beijing, China) based on the mRNA sequences obtained from the National Center for Biotechnology Information database (Table 1). The expression levels of mRNAs were normalized to β-actin and calculated using the 2^-ΔΔCt method.

Table 1.

Primer list

Gene	Forward primer (5→3)	Reverse primer (5→3)	Temperature (℃)
PPARγ	GCATTTCTGCTCCACACTAT	ACTTTGATCGCACTTTGGTA	60
AMPK	TCTATGAACTGGAGGAGCACA	GAAATGCAGACAAGTGGCTTA	60
SREBP-1c	GCTACCGGTCTTCTATCAATGA	CGCAAGACAGCAGATTTATTCA	60
Fas	TGTGACCACTGTGAGAAGCA	CTCCTCTTCCAAGCAACCTC	60
LPL	GAGTTGTAGAAAGAATCGCTGT	TCTGAGAGCGAGTCTTCAGGTA	60
GAPDH	TGCGACTTCAACAGCAACTC	ATGTAGGCAATGAGGTCCAC	60

Notes: PPARγ: peroxisome proliferator-activated receptor-γ; AMPK: adenosine 5‘-monophosphate -activated protein kinase; SREBP-1c: sterol regulatory element binding protein-1c; Fas: fatty acid synthase; LPL: lipoprotein lipase; GAPDH: glycera ldehyde-3-phosphate dehydrogenase.

2.6. Western blot analysis

Preparation of protein electrophoretic samples from liver tissue. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis was performed using 20 µg of the protein sample. After electrophoresis, the protein was electrically transferred to a nitrocellulose membrane. After being sealed with 5% skimmed milk powder for 1 h, the primary antibodies were incubated in a shaking table at 4℃ overnight. The primary antibodies included the following: PPAR-γ (lot ab45036, Abcam, Cambridge, Massachusetts, USA); adenosine 5‘-monophosphate -activated protein kinase (AMPK) (lot ab32047, Abcam, Cambridge, MA, USA); p-AMPK (phospho T172, lot ab133448, Abcam, Cambridge, Massachusetts, USA); SREBP1 (lot ab28481, Abcam, Cambridge, MA, USA); Fas (lot ab22759, Abcam, Cambridge, MA, USA); and β-actin (lot ab8226, Abcam, Cambridge, Massachusetts, USA). The next day the membrane was incubated with horseradish peroxidase-labeled secondary antibody (Goat Anti-Rabbit IgG H&L, lot ab205718, Abcam, Cambridge, Massachusetts, USA) at 24 ℃ for 1 h. Electrochemiluminescence solution was added to the membrane to enhance detection. The Image Lab software was used for gray scale analysis.

2.7. Statistical analysis

All tested data were analyzed using the IBM SPSS Statistics for Windows, Version 20.0 (IBM Corp, Armonk, NY, USA). The data were presented as the mean ± standard deviation ($\bar{x}±s$). The differences between groups were analyzed with one-way analysis of variance followed by the Tukey's multiple comparison test. P < 0.05 represented a statistically significant difference.

3. RESULTS

3.1. LC-MS determination of the components of the aqueous extract of EWM

A total of 10 122 metabolites were obtained from EWM, associated with 7556 positive and 2566 negative ions. The measured metabolites were scored according to the qualitative results of the compounds. The top 10 metabolites with expression levels from high to low are Kaempferol 3-(3''-p-coumarylglucoside); Isovitexin 4'-O-glucoside 2''-O-arabinoside; 5Z-Caffeoylquinic acid; 8-Hydroxygalangin 7-methyl ether 8-acetate; 6''-O-Acetyldaidzin; Chlorogenic acid; Rhamnocitrin 3-(6''-acetylglucoside); L-Aspartic Acid; L-Isoleucine; Kaempferol 3-neohesperidoside.

3.2. General observation

After 5 weeks of continuous administration, no significant differences were noted in food intake or water consumption and body weight among the treatment groups. The group administered a high-dose of the aqueous extract of EWM received 0.536 g/kg, which was considered an unsafe dose because of the severe decline in weight and poor state of mice during administration. Further analysis of this dose was discontinued.

3.3. Changes in FBG

As shown in Table 2, compared with the C57 group, the FBG in the KKAy group showed significantly higher expression (P < 0.01), and the FBG level was increased with increasing age in mice. Compared with the KKAy group, after 4 and 5 weeks of intervention, the FBG of mice in the KKAy + M and KKAy + A-M groups was significantly decreased (P < 0.01).

Table 2.

Changes of FBG in mice of each group ($\bar{x}±s$)

Group	n	0 W	1 W	2 W	3 W	4 W	5 W
C57	10	4.1±0.8	3.6±0.3	4.0±0.6	4.29±0.5	4.1±0.6	3.9±0.7
KKAy	10	5.9±0.9b	7.0±0.7b	8.2±1.4b	10.2±1.2b	11.2±1.2b	14.4±1.5b
KKAy+M	10	5.9±1.0	6.7±0.9	7.3±0.7c	7.8±1.2d	8.2±1.1d	9.7±0.9d
KKAy+A-L	10	5.9±1.0	7.0±1.0	8.0±0.9	9.6±1.5e	10.1±1.1cf	13.4±1.2cf
KKAy+A-M	10	5.9±0.9	6.8±1.0	7.4±0.8	8.7±1.4	9.2±0.9de	11.0±1.0de

Notes: C57BL/6J mice + ultrapure water: C57 group; KK/upj-Ay/J mice + ultrapure water: KKAy group; KKAy + metformin (1.0 g/kg): KKAy + M group; KKAy + aqueous extract of EWM low-dose (0.134 g/kg): KKAy + A-L group; KKAy + aqueous extract of EWM medium-dose (0.268 g/kg): KKAy + A-M group. These three groups were administered by gavage for 5 weeks. ^bP < 0 .01 vs C57 group; ^cP < 0.05 and ^dP < 0.01 vs KKAy group; ^eP < 0.05 and ^fP < 0.01 vs KKAy + M group.

3.4. Fins and HOMA-IR

Serum Fins and the HOMA-IR value in the KKAy group were significantly higher than those in the C57 group (P < 0.01). Compared with the KKAy group, the Fins in KKAy + M group (P < 0.01), KKAy + A-L group (P < 0.05), and KKAy + A-M group (P < 0.01) were significantly decreased. Furthermore, the HOMA-IR values in the KKAy + M group (P < 0.01) and KKAy + A-M group (P < 0.05) were significantly decreased.

3.5. Changes in blood lipid levels

As shown in Table 3, compared with the KKAy group, the expression levels of TC (P < 0.01), TG (P < 0.01), and FFA (P < 0.05) were significantly decreased in the KKAy + A-M group, while the expression values of HDL and adiponectin were upregulated (P < 0.05). Compared with the KKAy + M group, the effects on serum HDL (P < 0.05), LDL (P < 0.01), TC (P < 0.01), and TG (P < 0.01) in the KKAy + A-M group were more favorable.

Table 3.

Results of blood lipid of mice in each group ($\bar{x}±s$)

Group	n	HDL (mmol/L)	LDL (mmol/L)	TC（mmol/L)	TG（mmol/L)	FFA (mmol/L)	Adiponectin （μg/mL)
C57	6	2.13±0.20	0.25±0.01	2.25±0.20	2.19±0.18	0.20±0.03	9.30±0.71
KKAy	6	1.63±0.16b	0.27±0.02	2.94±0.15b	2.99±0.20b	0.43±0.02b	6.11±1.02b
KKAy+M	6	1.73±0.08	0.30±0.02	2.74±0.21	2.77±0.25	0.33±0.07c	6.72±1.19
KKAy+A-L	6	1.82±0.14	0.29±0.03	2.74±0.26	2.80±0.27	0.39±0.12	6.95±1.10
KKAy+A-M	6	1.96±0.03c,e	0.25±0.02f	2.47±0.18d,f	2.39±0.20d,f	0.34±0.05c	7.54±1.40 c

Notes: C57BL/6J mice + ultrapure water: C57 group; KK/upj-Ay/J mice + ultrapure water: KKAy group; KKAy + metformin (1.0 g/kg): KKAy + M group; KKAy + aqueous extract of EWM low-dose (0.134 g/kg): KKAy + A-L group; KKAy + aqueous extract of EWM medium-dose (0.268 g/kg): KKAy + A-M group. These three groups were administered by gavage for 5 weeks. ^b P < 0 .01 vs C57 group; ^c P < 0.05 and ^d P < 0.01 vs KKAy group; ^e P < 0.05 and ^f P < 0.01 vs KKAy + M group.

3.6. Changes in liver and kidney function

Compared with the C57 group, the expression levels of aspartate transaminase (AST), alanine aminotransferase (ALT), creatinine (CREA), and urea in the serum of mice in the KKAy group were significantly higher (P < 0.01). Compared with the KKAy group, the levels of ALT (P < 0.01 or P < 0.05), CREA, and urea (P < 0.05) in the KKAy + M group, KKAy + A-L group, and KKAy + A-M group were all decreased.

3.7. HE staining

Under light microscopy, the hepatocytes in the C57 mice were radially arranged around the central vein, with normal morphology. The nuclei were large, round, and centered, with homogeneous cytoplasm, an absence of steatosis. In the KKAy group, liver cells were disorganized and showed steatosis. Compared with the KKAy group, there was less steatosis of the hepatocytes in the treatment groups, and the arrangement was regular and neat (Figure 1).

Figure 1. Light microscope observation results of HE staining and oil red O staining of mice liver (× 200).

A1, A2: C57 group; B1, B2: KKAy group; C1, C2: KKAy+M group; D1, D2: KKAy+A-L group; E1, E2: KKAy+A-M group. Paraffin sections were subjected to hematoxylin-eosin (HE) staining (10×20), frozen sections were subjected to oil red O staining (10 × 20). C57BL/6J mice + ultrapure water: C57 group; KK/upj-Ay/J mice + ultrapure water: KKAy group; KKAy + metformin (1.0 g/kg): KKAy + M group; KKAy + aqueous extract of EWM low-dose (0.134 g/kg): KKAy + A-L group; KKAy + aqueous extract of EWM medium-dose (0.268 g/kg): KKAy + A-M group. These three groups were administered by gavage for 5 weeks.

3.8. Oil red O staining

No stained lipid droplets were detected in the liver tissue of the C57 mice. Lipid droplets in the hepatocytes of mice in the KKAy group were diffuse, showed granular accumulation, and converged into sheets. Compared with the KKAy group, the lipid droplets in mice in the treatment groups were significantly reduced and sparse, and the volume of lipid droplets was relatively small and unevenly distributed in small particles (Figure 1).

3.9. Transcriptome

Screening and expression level analysis of differential genes: DESeq software was used to analyze the number of DEGs. In the KKAy + A-M group the number of DEGs was 343, with 185 upregulated and 158 downregulated genes, compared with the KKAy group.

GO enrichment analysis of DEGs: results of the GO analysis showed that the lipoprotein lipase gene (LPL) was associated with lipid metabolism. The expression of LPL in the KKAy + A-M group was increased 2.096 times, compared with that in the KKAy group. RT-PCR was used to verify this finding.

KEGG enrichment analysis of DEGs: a bubble diagram of the top 20 KEGG pathways in the KKAy+A-M group compared with the KKAy group are shown in Figure 2. According to the disease correlation, the PPAR signaling pathway and AMPK signaling pathway were selected from the KEGG enrichment analysis. In the following mechanism experiments, we detected SREBP-1c, Fas, p-AMPK, and AMPK in the AMPK signaling pathway and PPARα, PPARδ/β, and PPARγ in the PPAR signaling pathway.

Figure 2. Bubble diagram of top 20 KEGG enrichment analysis pathways.

Caption: the x-axis displays the enrichment score. The larger the bubble, the greater the number of differential protein-coding genes. The color of the bubble changes from purple-blue-green-red. The smaller the enrichment P-value, the greater the significance.

3.10. Real-time quantitative RT-PCR

Compared with the KKAy group, the relative expression levels of PPARγ (P < 0.01), SREBP-1c (P < 0.05), and Fas mRNA in the KKAy + A-L group were decreased, and the relative expressions of LPL and AMPK mRNA were increased (P < 0.05). In the KKAy + A-M group, the mRNA expression levels of PPARγ (P < 0.05), SREBP-1c (P < 0.01), and Fas (P < 0.01) were decreased, while the mRNA expression levels of LPL and AMPK were increased (P < 0.01) (Figure 3).

Figure 3. Relative expression of mRNA ($\bar{x}±s$, n = 5) .

KK/upj-Ay/J mice + ultrapure water: KKAy group; KKAy + aqueous extract of EWM low-dose (0.134 g/kg): KKAy + A-L group; KKAy + aqueous extract of EWM medium-dose (0.268 g/kg): KKAy + A-M group. PPARγ: peroxisome proliferator-activated receptor-γ; AMPK: AMP-activated protein kinase; SREBP-1c: sterol regulatory element binding protein-1c; Fas: fatty acid synthase; LPL: lipoprotein lipase. ^aP < 0.01 and ^bP < 0.05 vs KKAy group.

3.11. Western blot

Compared with the KKAy group, the expression levels of the p-AMPK/AMPK protein in the KKAy + A-L group and KKAy + A-M group were increased (P < 0.05), while the expression levels of PPARγ, SREBP-1c, and Fas proteins in the KKAy + A-M group were decreased (P < 0.05) (Figure 4).

Figure 4. Protein expression in liver tissue of mice in each group ($\bar{x} ± s$, n = 5).

A: protein expression bands in liver tissue of mice in each group; B: protein expression level in liver tissue of mice in each group. C57BL/6J mice + ultrapure water: C57 group; KK/upj-Ay/J mice + ultrapure water: KKAy group; KKAy + aqueous extract of EWM low-dose (0.134 g/kg): KKAy + A-L group; KKAy + aqueous extract of EWM medium-dose (0.268 g/kg): KKAy + A-M group. PPARγ: peroxisome proliferator-activated receptor-γ; AMPK: AMP-activated protein kinase; SREBP-1c: sterol regulatory element binding protein-1c; Fas: fatty acid synthase; β-actin: beta-actin. ^bP < 0 .01 vs C57 group; ^cP < 0.05 vs KKAy group.

4. DISCUSSION

After 5 weeks of the intervention, the results of liver and kidney function indicated that the treatment caused no damage to the liver or renal function of mice. Compared with the KKAy group, the KKAy + A-M group showed a hypoglycemic effect, wherein the serum Fins content was reduced and HOMA-IR was decreased. Regarding lipid metabolism, the effects observed in the KKAy + A-M group were more favorable than those observed in the KKAy + M group. Both HE and oil red O staining suggested that EWM could reduce the number and volume of lipid droplets in hepatocytes.

The GO results showed that the DEG in lipid metabolism is LPL. LPL can transfer lipids from the circulation to tissue, which plays an important role in regulating lipid metabolism and energy balance in the human body.⁸ Triglycerides in serum lipoproteins are hydrolyzed by LPL and bind to free fatty acids hydrolyzed in the tissues.⁹ The results of RT-PCR detection showed that the expression of LPL mRNA in the KKAy + A-L and KKAy + A-M groups was twice as high as that in the KKAy group. Therefore, the levels of serum TG and FFA were decreased in the KKAy + A-L and KKAy + A-M groups, which may be related to the high expression of LPL.

The expression of PPARγ is upregulated in patients with NAFLD, and increased PPARγ activity in the liver may lead to increased lipid storage in that organ.¹⁰ Compared with the C57 group, the expression of PPARγ mRNA and protein in the KKAy group was upregulated. As a transcription factor, PPARγ controls the synthesis of fatty acids and TGs,¹¹ and influences the storage of fatty acids in adipose tissue, by regulating the expression of many genes such as LPL.¹² Compared with the KKAy group, the expression of PPARγ mRNA and protein in the KKAy + A-L and KKAy + A-M groups were downregulated. This suggests that EWM can downregulate the expression of PPARγ in the liver and reduce the levels of fatty acids and TG in the circulation, which may be related to the regulation of LPL by PPARγ.

Impaired AMPK activity in the liver is a key factor in the development of metabolic disorders related to insulin resistance and metabolic syndrome, including liver steatosis.¹³ The low level of AMPK expression in the liver has been demonstrated in various animal fatty liver models.¹⁴ Compared with the C57 group, the expression of AMPK mRNA and the p-AMPK/AMPK protein in the KKAy group was downregulated. The activation of AMPK in the liver can reduce lipid accumulation by inhibiting lipid synthesis and activating fatty acid oxidation. ¹⁵ Compared with the KKAy group, the expression of AMPK mRNA and the p-AMPK/AMPK protein was upregulated in the KKAy + A-L and KKAy + A-M groups. This suggests that EWM can reduce lipid accumulation by upregulating AMPK activity. In addition, AMPK can inhibit the transcription of lipogenic genes by phosphorylating the transcription factor, sterol regulatory element binding protein-1c (SREBP-1c).¹⁶ The activation of SREBP1c promotes the transcription of the Fas gene.¹⁷ Among the important lipogenic proteins, FAS is the key synthetase of TG.¹⁸ Compared with the KKAy group, the mRNA and protein expression levels of SREBP-1c and Fas in the KKAy + A-L and KKAy + A-M groups were decreased. This suggests that EWM can reduce the fat content in the liver and circulation through the AMPK/SREBP1c/Fas pathway.

In conclusion, EWM can alleviate lipid metabolism disorders and to some extent improve glucose metabolism disorders in KKAy mice. These effects may be related to regulating PPARγ/LPL and activating the AMPK/SREBP1c/Fas pathway.

5. ACKNOWLEDGMENTS

We thank Charlesworth Author Services for English language assistance and scientific editing.

Funding Statement

Supported by the Key Laboratory of TCM Health Cultivation of Beijing (grant No. BZ0259) and the Creation and Talent Introduction Base of Prevention and Treatment of Diabetes and Its Complications with Traditional Chinese Medicine (No. B20055)