Skip to main content
PMC home page
Revista Peruana de Medicina Experimental y Salud Publica logoLink to Revista Peruana de Medicina Experimental y Salud Publica
. 2022 Dec 15;39(4):450–455. doi: 10.17843/rpmesp.2022.394.11069
View full-text in Spanish

Detection of human papilloma virus in breast cancer biopsies using PCR and immunohistochemistry at the santa rosa hospital during 2019

Enrique Mamani- Zapana 1,2, Meyling Vilcapoma-Diaz 2, Nazario Ortiz-Muchotrigo 3
PMCID: PMC11397775  PMID: 36888807

ABSTRACT

The aim of this study was to determine the presence of Human Papillomavirus (HPV) type 16 and 18 in biopsies of paraffin-embedded breast tissue from patients with clinically diagnosed breast cancer. 32 paraffin-embedded breast cancer biopsies were analyzed in order to detect HPV DNA by real-time PCR, the primers were directed at the E6 gene. The histological type, histological grade and overexpression of C-erB2 and Ki-67 were evaluated by immunohistochemistry. 84.38% (27) of the samples were positive for HPV, 25% (8) were positive for HPV-16 and 59.38% (19) were positive for HPV-18. Mixed infection was found in 15.63% (5) of the samples. Overexpression of C-erbB2 and Ki-67 was seen in 6.25% (2) of the samples positive for HPV-16 and in 15.63% (5) samples positive for HPV-18. HPV-16 and HPV-18 DNA was detected in the biopsy samples analyzed by real-time PCR.

Keywords: Human Papillomavirus type 16 and 18, breast cancer, biopsy, qPCR, IHC

INTRODUCTION

Breast cancer (BCa) is one of the most complex disease 1 that occurs gradually 2 and constitutes a worldwide public health concern that mainly affects women. Internationally, breast cancer is considered the fifth type of cancer with the highest number of deaths, with approximately 685,000 deaths 3 . In Peru, breast cancer is the most frequent cancer in women between 40 and 69 years of age 4 , who are usually diagnosed in the last stages 5 .

This neoplasm is related to modifiable factors (parity, age at first pregnancy, breastfeeding, and lifestyle) and non-modifiable factors (genetic mutations, family history, sex, age, race, ethnicity, dense breasts, age at menarche and late menopause) 6 . However, it is difficult to determine a single risk factor that causes breast cancer, since some women with several risk factors do not develop cancer and some women who are not exposed to risk factors do develop cancer 7 .

In recent decades, HPV has been the risk factor most frequently associated with BCa, mainly due to reports finding the genetic material of this virus in women diagnosed with BCa. In 2008, Khan et al. examined the presence, genotype, and viral load of HPV in 124 Japanese patients diagnosed with mammary carcinoma 8 , detecting the HPV genome in 26 patients, in whom HPV-16 (92%) was the most frequent. In 2015, Lawson et al. detected the presence of HPV in 50 specimens from a total of 855 samples with mammary carcinoma, of which 20 were high-risk (HPV-18, HPV-16, HPV-52 and HPV-113) and 30 were low-risk 9 . In 2018, Chumpitaz confirmed the existence of HPV-18 and HPV-16 in breast tumor tissue in Peruvian women 10 .

Due to previous reports and the increase in breast cancer cases in Peru, the present study sought to determine the presence of HPV type 16 and type 18 in breast carcinoma biopsies from patients who visited the Hospital Santa Rosa during 2019.

KEY MESSAGES

Motivation for the study: there are few studies about high-risk Human Papillomavirus in patients with breast cancer, which is currently the most recurrent neoplasm in Peru.

Main findings: greater presence of Human Papillomavirus was evidenced in infiltrating ductal carcinoma and grade III samples. In addition, real-time polymerase chain reaction showed greater diagnostic accuracy than immunohistochemistry.

Implications: a better understanding of the presence of Human Papillomavirus and its possible relationship with breast cancer will contribute to improve preventive measures for this disease.

THE STUDY

Design and place of study

Descriptive-retrospective study carried out at the Santa Rosa Hospital (H.S.R.) and at the Universidad Nacional Mayor de San Marcos.

Variables

The independent variables were divided into two groups: social (age) and clinical (type of breast carcinoma, histological grade, and overexpression of C-erbB2 and Ki-67 receptors). The dependent variable was the presence of HPV-16 and HPV-18. We used the statistical package IBM SPSS Statistics for Windows, version 25 (IBM Corp). The dependent variable was expressed by sector graphs and the independent variables by histogram graphs. In addition, we constructed a comparative graph of the qPCR and IHC techniques using the XLSTAT statistical software. Absolute and relative frequencies were used.

Sample collection

We analyzed 32 paraffin-embedded breast tissue biopsy samples from female patients older than 30 years (age range: 32-93 years) with BCa who visited the H.S.R. during January-April 2019. Participants were selected consecutively (routinely), and samples from all patients with BCa during the study period were included. Each sample was obtained in triplicate from 2-micrometer-thick histological sections deposited on poly-L-lysine slides.

Extraction and evaluation of DNA quality

The NucleoSpin ® DNA FFPE XS kit was used, following the manufacturer’s instructions 11 . DNA concentration and quality were measured with a DeNovix spectrophotometer, model DS-11FX+, using 2uL per sample; readings were taken at 260 NM and A260 / A280 ratio, respectively.

Real-time PCR

HPV was detected by qPCR following the methodology described by Frega et al. 10 and modified for the present study. The probe and primers were targeted to the E6 gene as described by Schmitz et al. 11 (Table 1). The SensiFAST™ Probe No-ROX Kit (Bioline, Meridian Bioscience) was used 12 . The qPCR required a volume of 20 µL for each reaction: 10 µL of Taq polymerase (2X SensiFast Probe No-ROX Mix), 0.8 µL of primer (HPV-16/18 For and HPV-16 /18Rev), 0.4 µL of TaqMan probe (HPV-16 /18Probe) ,7 µL of ultrapure water, and 1 µL of viral DNA were used. Cycling conditions were optimized as shown in Table 2. Positive controls (HPV-16 and HPV-18 cervical positive sample) and a negative control were included in each reaction.

Table 1. Sequence of the primers and TaqMan probe for the detection of the E6 gene of HPV-16 and HPV-18.

Oligonucleotides Sequence (5’-3’) qPCR product size
Oligonucleotides for HPV-16 128 bp
HPV-16 For GAACCGAAACCGGTTAGTATAA
HPV-16 Rev ATGTATAGTTGTTTGCAGCTCTGT
HPV-16 p 6HEX-CATTTTATGCACCAAAAGAGAACTGCAATGTTTC-BHQ1
Oligonucleotides for HPV-18
HPV-18 For GGACCGAAAACGGTGTATATAA 124 bp
HPV-18 Rev CAGTGAAGTGTTCAGTTCGGT
HPV-18 p TAMRA-ATGTGAGAAACACACCACAATACTATGGCGCG-BHQ2
Open in a new tab

Table 2. Cycling program for HPV qPCR.

Step Temperature Time No. of cycles
Initial activation 95 °C 15 min 1
Denaturation 94 °C 5 s 45
Hybridization 50 °C 20 s
Extension 60 °C 40 s
Open in a new tab

Immunohistochemistry (IHC)

Tissue sections with a thickness of 2 microns were deposited on poly-L-lysine slides. The following kits were used: BIO SB Mouse/Rabbit Immunodetector HRP/DAB, BIO SB Tinto HPV-16 Mouse Antibody, clone CAMVIR-1, Santa Cruz Biotechnology HPV-18 Mouse Antibody, clone E6. C-erB2 and Ki-67 were used to measure overexpression in tumor tissues.

Ethical aspects

This research was approved by the Research Ethics Committee of Hospital Santa Rosa.

FINDINGS

Real-time PCR

Of the 32 samples from patients with BCa, 84.38% (27) were positive for HPV, of which 25% (8) corresponded to HPV-16 and 59.38% (19) to HPV-18. Mixed infection was found in 15.63% (5) of the samples.

Relation of the independent variables with HPV-16 and HPV-18 PCR

The age range was 32 to 93 years, with a median of 59 years. Of the total HPV-16 positive cases (8), 50% (4) were younger than 59 years and the other 50% (4) were older than 59 years. Regarding histological grade, 75% (6/8) corresponded to grade III and 25% (2/8) to grade II. Regarding the type of BCa, 87% (7/8) of the samples presented infiltrating ductal carcinoma and 13% (1/8) intraductal carcinoma.

Of the HPV-18 positive cases (19), 42% (8/19) were younger than 59 years and 58% (11/19) were older than 59 years. Regarding the histological grade, 58% (11/19) corresponded to grade III, 37% (7/19) to grade II and 5% (1/19) to grade I. The distribution according to the type of BCa was 95% (18/19) for infiltrating ductal carcinoma and 5% (1/19) for intracystic carcinoma.

Immunohistochemistry

Of the 32 samples analyzed for HPV-16 and HPV-18, only 6.25% (2) and 15.63% (5) showed overexpression of the immunohistochemical markers C-erbB2 and Ki-67, respectively (Figures 1 and 2). HPV-16 and HPV-18 positive samples with overexpression of C-erbB2 and Ki-67 presented the infiltrating ductal carcinoma type and grade III.

Figure 1. Comparative graph between the results of qPCR and IHC techniques for HPV-18. Of the 19 samples positive for HPV- 18 by qPCR, 5 samples overexpressing ki-67 and C-erbB2 receptors were positive by the two techniques: 19 - 574 ONCO (sample 4), 19 - 410 ONCO 2 (sample 6), 19 - 617 ONCO (sample 10), 19 - 753 ONCO (sample 15) and 877 -19 ONCO (sample 22).

Figure 1

Open in a new tab

Figure 2. Comparative graph between the results of qPCR and IHC techniques for HPV-16. Of the 8 samples positive for HPV-16 by qPCR, 2 samples overexpressing ki-67 and C-erbB2 receptors were positive by the two techniques: 19-025 ONCO (sample 1) and 19-751 ONCO (sample 14).

Figure 2

Open in a new tab

DISCUSSION

The present study demonstrated the presence of HPV-16 and HPV-18 in BCa samples, by using the E6 gene as a detection target, which remains preserved and is not lost during viral integration as occurs with the L1 gene 13 ; this is probably the reason why previous studies did not report HPV in BCa samples.

Our results coincide with previous reports that used primers targeting the E6 gene. In 2009, Cantú de León et al. 14 determined the prevalence of HPV DNA, collecting 51 BCa cases at the National Cancer Institute of Mexico; 29.4% 15 were positive for HPV, 66.6%  10 of these were positive for HPV-16, 20% 3 were positive for HPV-18 and 13.4% 2 were positive for both. Similarly, in 2017 Ngamkhan et al. 15 evaluated the prevalence of HPV in 700 samples of Thai women with BCa by analyzing the statistical correlation between HPV infection and sociodemographic and histopathological characteristics; the researchers found that patients with benign breast tumor lesions had an average age of 41.76 and those with breast carcinoma samples averaged 52.73 years of age, they also detected HPV DNA in 25 genotypes in 700 samples with breast tumors, which accounted for 3.57% of the total. HPV-16 was the most prevalent, followed by HPV-33 and HPV-18. In our study, we found 25% (8/32) of HPV-16 and 59.38% (19/32) of HPV-18. This indicates that the prevalence of HPV infection varies between different geographical areas and would be related to non-modifiable factors such as genetic factors and ethnicity, among others, which give rise to the competition of the virus for population niches and results in some types being more prevalent. Of the total number of genotypes found, 15.63% (5) corresponded to mixed infections, related to grade II and grade III of BCa and also to the type of infiltrating ductal carcinoma. This allows us to infer that in addition to viral competition between HPV types in the same tissue, the infection persists and breast lesions progress.

The age of the women positive for HPV-16 and HPV-18 varied, so it was not possible to determine the relationship between age and the HPV type. However, Kroupis et al. 22 , after evaluating the presence of HPV in cases of BCa in 107 samples, found that 21 samples were positive for high-risk HPV, 14 of them being younger than the rest of the patients. On the other hand, Khan et al. 8 found no significance between age and the presence of HPV in BCa, the ages of the patients ranged from 23 to 90 years and the median was 55 years; of the 15 cases that were younger than 40 years, 3 were positive for HPV; of the 37 cases that had ages between 40 and 49, 9 were positive for HPV; of the 27 patients with ages between 50 and 59 years, 5 had the HPV viral genome and of the 45 cases that had ages between 60 and 93, 9 were positive for HPV. Therefore, in order to establish a possible relationship between age and the presence of HPV, it is necessary to evaluate a larger number of samples so the prevalence of this virus can be analyzed. The results of the aforementioned studies coincide with the National Plan for the Prevention and Control of Breast Cancer in Peru 2017-2021, which reports that breast cancer is more frequent in Peruvian women between 40 and 69 years of age 23 .

The overexpression of C-erbB2 and Ki-67 receptors was determined by using IHC on breast samples. Several studies have used these markers and labeled them as specific for cancer cells with a high association with high-risk HPV. The greater the expression of Ki-67, the greater the increase in C-erbB2 expression and, therefore, the greater the aggressiveness of the cancer 16 . This would explain the greater overexpression of C-erbB2 and Ki-67 in high-grade BCa samples and would be the reason why greater overexpression of these receptors was found in infiltrating ductal carcinoma samples. On the other hand, HER-2 proteins are found on the surface of breast cells, both normal and cancerous cells 17 . HER-2 is overexpressed by up to 30% in breast cancers 18 . The Ki-67 protein is found in the nucleus of the human cell and expresses cell proliferation in both normal and malignant tissue, reaching maximum expression levels during mitosis 19 . Currently, since the main characteristic of cancer is uncontrolled cell proliferation, the Ki-67 proliferative index is being used more frequently to evaluate and monitor cancer as a prognostic indicator 18 , 19 . By using IHC, we found overexpression of these immunomarkers in women with BCa, positive for HPV-18 in 15.63% and for HPV-16% in 6.25%. Of the 19 samples that tested positive for HPV-18 by qPCR, 5 samples that overexpressed ki-67 and C-erbB2 receptors were positive by both techniques; and of the 8 samples that tested positive for HPV-16 by qPCR, 2 that overexpressed ki-67 and C-erbB2 receptors were positive by both techniques. This would demonstrate the high diagnostic accuracy of the qPCR technique, which would allow us to consider it as a complementary test to IHC, to possibly contribute to early BCa diagnosis.

Our results are consistent with what Woods et al. described in 2015; they found that coexpression of E6 and C-erbB2 resulted in cells expressing higher levels of C-erbB2, thus concluding that there is probably an influence of the E6 oncoprotein of HPV-16 on HER-2 (C-erbB2) gene overexpression 20 . However, there are studies that indicate the opposite. In 2015, Delgado analyzed the relationship between HPV and the molecular marker Ki-67 in 275 breast cancer samples, finding no statistical significance between the presence of HPV and Ki-67 21 . However, Kroupis et al. examined the presence of HPV in breast cancer tissues by PCR; 17 samples out of 107 were positive for HPV and statistical significance was found between HPV and Ki-67 22 . Therefore, it can be concluded that it is not possible to determine whether or not the overexpression of C-erbB2 and Ki-67 is related to the presence of HPV when working with few samples.

One of the limitations of this study is that the prevalence of HPV-16 and HPV-18 in breast cancer and their correlation with the immunohistochemical markers C-erbB2 and Ki-67 were not determined. On the other hand, one of the strengths of the study is that we analyzed clinical and social variables that have not been found in other studies at the national level. Likewise, we considered the different factors that influence DNA quality, so we worked with a specialized extraction kit for paraffinized breast tissue samples, standardized qPCR and worked with amplicons of less than 200 bp, which guarantee high diagnostic accuracy.

In conclusion, the presence of HPV-16 and HPV-18 was confirmed in breast carcinoma biopsies of Peruvian patients, with a higher presence of HPV in infiltrating ductal carcinoma and grade III samples. Likewise, our results have allowed us to confirm that, in addition to the presence of HPV, other intrinsic or extrinsic factors that act synergistically and predispose to the development of cancer in humans are required.

Acknowledgments:

to the Hospital Santa Rosa for providing the samples, the Clinical and Molecular Virology Laboratory for providing the space and equipment for this study, and the VRIP-UNMSM for funding.

Funding Statement

VRIP-UNMSM (B19102081) Undergraduate Thesis Promotion Program of the Vice-Rectorate for Research and Graduate Studies (VRIP) de la Universidad Nacional Mayor de San Marcos (B19102081).

Funding: VRIP-UNMSM (B19102081) Undergraduate Thesis Promotion Program of the Vice-Rectorate for Research and Graduate Studies (VRIP) de la Universidad Nacional Mayor de San Marcos (B19102081).

Cite as:

Mamani- Zapana E, Vilcapoma-Diaz M, Ortiz-Muchotrigo N. Detection of human papilloma virus in breast cancer biopsies using PCR and immunohistochemistry at the santa rosa hospital during 2019 Rev Peru Med Exp Salud Publica. 2022;39(4):450-5. doi: https://doi.org/10.17843/rpmesp.2022.394.11069.

5

The thesis: Vilcapoma, M. (2021). “Detección del Virus Papiloma Humano de Alto Riesgo Tipo 16 (HPV-16) en muestras de biopsias de carcinoma mamario del Hospital Santa Rosa, 2019”. [Undergraduate thesis, Universidad Nacional Mayor de San Marcos, Faculty of Biological Sciences, Professional School of Microbiology and Parasitology]. Institutional repository Cybertesis UNMSM, is part of this work.

References

Rev Peru Med Exp Salud Publica. 2022 Dec 15;39(4):450–455. [Article in Spanish]

Deteccion del virus del papiloma humano en biopsias de cancer de mama mediante PCR e inmunohistoquimica en el Hospital Santa Rosa durante el 2019

Enrique Mamani- Zapana 1,2,3, Meyling Vilcapoma-Diaz 1,2,3, Nazario Ortiz-Muchotrigo 1,2,3

RESUMEN

El objetivo de este estudio fue determinar la presencia del Virus Papiloma Humano (VPH) tipo 16 y 18 en biopsias de tejido mamario parafinado de pacientes con diagnóstico clínico de cáncer de mama. Se analizaron 32 biopsias de cáncer de mama embebidas en parafina para detectar el ADN de VPH mediante PCR en tiempo real, los iniciadores estuvieron dirigidos al gen E6. Se evaluaron el tipo histológico, grado histológico y la sobreexpresión de C-erB2 y Ki-67 mediante inmunohistoquímica. El 84,38% (27) fueron positivos para VPH, el 25% (8) fueron positivos para VPH-16 y el 59,38% (19) para VPH-18. El 15,63% (5) de las muestras presentaron infección mixta. Se evidenció la sobrexpresión de C-erbB2 y Ki-67 en 6,25% (2) de las muestras positivas para VPH-16 y 15,63% (5) de las muestras positivas para VPH-18. Se detectó ADN de VPH-16 y VPH-18 en las muestras de biopsias analizadas mediante PCR en tiempo real.

Palabras clave: Virus del Papiloma Humano tipo 16 y 18, cáncer de mama, biopsia, qPCR, IHQ

INTRODUCCIÓN

El cáncer de mama (CaMa) es una de las patologías más complejas 1 ) que se da de forma gradual 2 y constituye un problema mundial de salud pública que afecta principalmente a las mujeres. A nivel internacional, el cáncer de mama es considerado el quinto tipo de cáncer con mayor número de fallecimientos, con aproximadamente 685 000 defunciones ( 3 . En el Perú, el CaMa es la neoplasia más frecuente en mujeres de 40 a 69 años 4 , quienes son diagnosticadas en las últimas etapas del cáncer 5 .

Esta neoplasia está relacionada con factores modificables (paridad, edad del primer embarazo, lactancia materna y estilo de vida) y no modificables (mutaciones genéticas, antecedentes familiares, sexo, edad, raza, origen étnico, mamas densas, edad de la menarquía y menopausia tardía) 6 . Sin embargo, es difícil determinar un único factor de riesgo que cause el CaMa, ya que ciertas mujeres con varios factores de riesgo no desarrollan cáncer y algunas que no están expuestas a los factores de riesgo si lo desarrollan 7 .

En las últimas décadas, el factor de riesgo asociado con más frecuencia al CaMa es el VPH, debido principalmente a la aparición de reportes que muestran la presencia del material genético de este virus en mujeres diagnosticadas con CaMa. En el 2008, Khan et al. examinaron la presencia, genotipo y carga viral del VPH en 124 pacientes japonesas diagnosticadas con carcinoma mamario 8 , detectando el genoma de VPH en 26 pacientes, en quienes el más frecuente fue VPH-16 (92%). En el 2015, Lawson et al. demostraron la presencia del VPH en 50 ejemplares de un total de 855 muestras con CaMa, de las cuales 20 fueron de alto riesgo (VPH -18, VPH -16, VPH -52 y VPH -113) y 30 de bajo riesgo 9 . En el año 2018, Chumpitaz confirmó la existencia de VPH -18 y VPH -16 en tejido tumoral de mama en mujeres peruanas 10 .

Debido a los reportes previos y el incremento en los casos de cáncer de mama en el Perú, el presente estudio buscó determinar la presencia del VPH tipo 16 y tipo 18 en biopsias de carcinoma mamario de pacientes atendidas en el Hospital Santa Rosa durante el año 2019.

MENSAJES CLAVE

Motivación para realizar el estudio: Existen pocos estudios acerca del Virus del Papiloma Humano (VPH) de alto riesgo en pacientes con cáncer de mama (CaMa), la cual es actualmente la neoplasia más recurrente en Perú.

Principales hallazgos: Se evidenció mayor presencia del VPH en las biopsias de carcinoma ductal infiltrante y grado III, además, se demostró que la reacción en cadena de la polimerasa en tiempo real tuvo mayor precisión diagnóstica que la inmunohistoquímica.

Implicancias: Un mejor entendimiento de la presencia de VPH y su posible relación con CaMa contribuirán en las medidas preventivas para esta enfermedad.

EL ESTUDIO

Diseño y lugar de estudio

Estudio descriptivo-retrospectivo desarrollado en el Hospital Santa Rosa (H.S.R.) y en la Universidad Nacional Mayor de San Marcos.

Variables

Las variables independientes se dividieron en dos grupos: social (edad) y clínicos (tipo de carcinoma mamario, grado histológico y sobreexpresión de los receptores C-erbB2 y Ki-67). La variable dependiente fue la presencia de VPH-16 y VPH-18. Se utilizó el paquete estadístico IBM SPSS Statistics for Windows, versión 25 (IBM Corp). La variable dependiente se expresó por gráfico de sectores y las variables independientes, por gráficos de histogramas. Además, se realizó un gráfico comparativo de las técnicas qPCR e IHQ, para ello se empleó el Software estadístico XLSTAT. Se utilizaron frecuencias absolutas y relativas.

Recolección de muestras

Se evaluaron 32 muestras de biopsias de tejido mamario parafinado de pacientes mujeres mayores de 30 años (rango de edad: 32-93 años) con CaMa atendidas en el H.S.R. durante el periodo enero-abril del 2019. Las participantes fueron seleccionadas de manera consecutiva (rutinaria), y se incluyeron las muestras de todas las pacientes con CaMa durante el periodo de estudio. Cada muestra se obtuvo por triplicado de cortes histológicos de 2 micras de espesor depositadas en láminas de polilisina.

Extracción y evaluación de la calidad del DNA

Se utilizó el kit NucleoSpin ® DNA FFPE XS, siguiendo las indicaciones del fabricante 11 . Se midió la concentración y calidad del ADN con un espectrofotómetro marca DeNovix, modelo DS-11FX+, se utilizó 2uL por muestra y se procedió a las lecturas en 260 NM y relación A260 / A280, respectivamente.

PCR en tiempo real

La detección del VPH se realizó mediante la qPCR siguiendo la metodología descrita por Frega et al. 10 ) y modificada para el presente estudio. La sonda e iniciadores estuvieron dirigidos al gen E6, según lo descrito por Schmitz et al. 11 (Tabla 1). Se empleó el Kit SensiFAST™ Probe No-ROX Kit (Bioline, Meridian Bioscience) 12 . La qPCR requirió un volumen de 20 µL por cada reacción: se empleó 10 µL de la Taq polimerasa (2X SensiFast Probe No-ROX Mix), 0.8 µL de iniciador (VPH-16/18 For y VPH-16 /18Rev), 0.4 µL de sonda TaqMan (VPH-16 /18Probe) ,7 µL de agua ultrapura, y 1 µL de ADN viral. Se optimizó las condiciones de ciclaje según se muestra en la Tabla 2. En cada reacción se incluyeron los controles positivos (muestra positiva para VPH-16 y VPH-18 de cérvix) y el control negativo.

Tabla 1. Secuencia de los primers y sonda TaqMan para la detección del gen E6 del HPV-16 y HPV-18.

Oligonucleótidos Secuencia (5’-3’) Tamaño del producto de la qPCR
Oligonucleótidos para HPV-16 128 bp
VPH-16 For GAACCGAAACCGGTTAGTATAA
VPH-16 Rev ATGTATAGTTGTTTGCAGCTCTGT
VPH-16 p 6HEX-CATTTTATGCACCAAAAGAGAACTGCAATGTTTC-BHQ1
Oligonucleótidos para HPV-18
VPH-18 For GGACCGAAAACGGTGTATATAA 124 bp
VPH-18 Rev CAGTGAAGTGTTCAGTTCGGT
VPH-18 p TAMRA-ATGTGAGAAACACACCACAATACTATGGCGCG-BHQ2
Open in a new tab

Tabla 2. Programa de ciclaje para la qPCR de VPH.

Ciclaje
Paso Temperatura Tiempo Nº de ciclos
Activación inicial 95 ºC 15 min 1
Denaturación 94 ºC 5 s 45
Hibridación 50 ºC 20 s
Extensión 60 ºC 40 s
Open in a new tab

Inmunohistoquímica (IHQ)

Secciones de tejidos de 2 micras de espesor fueron depositadas en láminas de polilisina. Se emplearon los kits: BIO SB Mouse/Rabbit Inmunodetector HRP/DAB, BIO SB Tinto HPV-16 Mouse Antibody, clona CAMVIR-1, Santa Cruz Biotechnology HPV-18 Mouse Antibody, clona E6. Se utilizó C-erB2 y Ki-67 para medir la sobreexpresión en los tejidos tumorales.

Aspectos éticos

Esta investigación fue aprobada por el Comité de Ética en investigación del Hospital Santa Rosa.

HALLAZGOS

PCR en tiempo real

De las 32 muestras de pacientes con CaMa, el 84,38% (27) fueron positivos para VPH, de las cuales, el 25% (8) correspondió a VPH-16 y el 59,38% (19) a VPH-18. El 15,63% (5) de las muestras presentaron infección mixta.

Relación de las variables independientes con la PCR de VPH-16 y VPH-18

El rango de la edad fue 32 a 93 años, con una mediana de 59 años. Del total de casos positivos para VPH-16 (8), el 50% (4) fueron menores de 59 años y el otro 50% (4) fueron mayores de 59 años. Con respecto al grado histológico, el 75% (6/8) correspondieron al grado III y el 25% (2/8) al grado II. Con respecto al tipo de CaMa, el 87% (7/8) presentaron carcinoma ductal infiltrante y el 13% (1/8) carcinoma intraductal.

De los casos positivos para VPH-18 (19), el 42% (8/19) fueron menores de 59 años y 58% (11/19) fueron mayores 59 años. Con respecto al grado histológico, el 58% (11/19) correspondió al grado III, 37% (7/19) al grado II y 5% (1/19) al grado I. La distribución según el tipo de CaMa fue 95% (18/19) para el carcinoma ductal infiltrante y 5% (1/19) para el carcinoma intraquístico.

Inmunohistoquímica

Con respecto a VPH-16 y VPH-18, se visualizó que, de las 32 muestras analizadas, solo el 6,25% 2 y el 15,63% 5 manifestaron la sobrexpresión de los marcadores inmunohistoquímicos C-erbB2 y Ki-67, respectivamente (Figuras 1 y 2). Las muestras positivas para VPH-16 y VPH-18 con expresión exagerada de C-erbB2 y Ki-67 pertenecían al tipo de carcinoma ductal infiltrante y al grado III.

Figura 1. Gráfica comparativa entre los resultados de las técnicas qPCR e IHQ para VPH-18. De las 19 muestras positivas para VPH-18 por qPCR, 5 muestras que sobreexpresaron los receptores ki-67 y C-erbB2 coincidieron con las dos técnicas: 19 - 574 ONCO (muestra 4), 19 - 410 ONCO 2 (muestra 6), 19 - 617 ONCO (muestra 10), 19 - 753 ONCO (muestra 15) y 877 -19 ONCO (muestra 22).

Figura 1

Open in a new tab

Figura 2. Gráfica comparativa entre los resultados de las técnicas qPCR e IHQ para VPH-16. De las 8 muestras positivas para VPH-16 por qPCR, 2 muestras que sobreexpresaron los receptores ki-67 y C-erbB2 coincidieron con las dos técnicas: 19-025 ONCO (muestra 1) y 19-751 ONCO (muestra 14).

Figura 2

Open in a new tab

DISCUSIÓN

En el presente estudio se demostró la presencia de VPH -16 y VPH-18 en muestras con CaMa, utilizando como blanco de detección al gen E6, el cual se mantiene conservado y no se pierde durante la integración viral como ocurre con el gen L1 13 ; este probablemente es el motivo por el cual estudios previos no reportaron VPH en muestras con CaMa.

Los resultados obtenidos concuerdan con reportes previos que emplearon iniciadores dirigidos al gen E6. En el 2009, Cantú de León et al. 14 ) determinaron la prevalencia de DNA de VPH, recopilando 51 casos con CaMa en el Instituto Nacional de Cancerología de México; el 29,4% 15 ) fueron positivos para VPH, 66,6% 10 ) de estos fueron positivos para VPH-16, 20% 3 fueron positivos para VPH-18 y el 13,4% ( 2 ) fueron positivos para ambos. De la misma manera, en el 2017 Ngamkhan et al. 15 investigaron la prevalencia del VPH en 700 muestras de mujeres tailandesas con CaMa analizando la correlación estadística entre la infección por VPH, parámetros sociodemográficos e histopatológicos; los investigadores encontraron que las pacientes con lesiones tumorales benignas de mama tenían una edad promedio de 41,76 y aquellas con muestras con carcinoma mamario promediaron 52,73 años de edad, además detectaron ADN de VPH en 25 genotipos de 700 muestras con tumores de mama, lo cual representó un 3,57% del total. El VPH-16, fue el más concurrente, seguido por VPH-33 y VPH-18. En nuestro estudio, obtuvimos un 25% (8/32) de VPH-16 y 59,38% (19/32) de VPH-18. Esto nos indica que la prevalencia de infección del VPH varía entre las distintas zonas geográficas y estaría relacionado con factores no modificables como el factor genético y origen étnico, entre otros que dan lugar a la competencia del virus por nichos poblacionales con la prevalencia de un determinado tipo. Del total de genotipos encontrados, el 15,63% (5) correspondió a infecciones mixtas, relacionadas al grado II y al grado III del CaMa y a su vez al tipo de carcinoma ductal infiltrante. Este hecho nos permite deducir que además de la competencia viral entre los tipos de VPH en un mismo tejido, también se observa la persistencia de la infección y la progresión de las lesiones en la mama.

Con respecto a la edad, se observó que las edades de las mujeres positivas para VPH-16 y VPH-18 fueron diversas, por lo que no se pudo determinar la relación de edad y el tipo de VPH. Sin embargo, Kroupis et al. 22 , luego de evaluar la presencia del VPH en casos de CaMa en 107 muestras, encontraron que 21 muestras fueron positivas para VPH de alto riesgo, siendo 14 de ellas más jóvenes que el resto de las pacientes. Por otro lado, Khan et al. 8 no encontraron significancia entre la edad y la presencia de VPH en CaMa, las edades de las pacientes fluctuaban entre 23 a 90 años y la mediana fue 55 años; de los 15 casos que eran menores de 40 años 3 fueron positivos para VPH, de los 37 casos que tenían edades entre 40 y 49 , 9 fueron positivos para VPH; de las 27 pacientes con edades entre 50 y 59 años, 5 albergaron el genoma viral del VPH y de los 45 casos que tenían edades entre 60 y 93, 9 fueron positivos para VPH. Por tanto, para poder entablar una posible relación de la edad y la presencia del VPH, se debe trabajar con un mayor número de muestras que permitan analizar la prevalencia de este virus. Los resultados de los estudios mencionados coinciden con el Plan Nacional para la Prevención y Control de Cáncer de Mama en el Perú 2017-2021, el cual reporta que el CaMa es más frecuente en mujeres peruanas de 40 a 69 años 23 .

La aplicación de la IHQ en muestras de mama se realizó para determinar la sobreexpresión de los receptores C-erbB2 y Ki-67. Diversos estudios han utilizado estos marcadores y los han catalogado como específicos de células cancerosas de alta asociación con VPH de alto riesgo. A mayor expresión de Ki-67, mayor aumento de la expresión de C-erbB2 y, por lo tanto, mayor agresividad del cáncer 16 . Esto explicaría la mayor sobreexpresión de C-erbB2 y Ki-67 en las muestras de CaMa de alto grado y sería el motivo por el cual se observó mayor sobreexpresión de estos receptores en el carcinoma ductal infiltrante. Por otro lado, las proteínas HER-2, se encuentran en la superficie de las células de la mama, tanto células normales como cancerosas 17 . HER-2 se sobreexpresa hasta en un 30% en los cánceres de mama 18 . La proteína Ki-67 se encuentra en el núcleo de la célula humana y expresa proliferación celular tanto en el tejido normal como en el maligno, alcanzando niveles máximos de expresión durante la mitosis 19 . Actualmente, debido a que la característica principal del cáncer es la proliferación celular no controlada, se está usando más frecuentemente el índice proliferativo de Ki-67 para evaluar y controlar el cáncer como un indicador pronóstico 18 , 19 . Al usar IHQ observamos la sobreexpresión de estos inmunomarcadores en las mujeres con CaMa positivas para VPH-18 en un 15,63% y para VPH-16% en un 6,25%. De las 19 muestras que dieron positivo a VPH-18 por qPCR, 5 muestras que sobreexpresaron los receptores ki-67 y C-erbB2 coincidieron con las dos técnicas; y de las 8 muestras que dieron positivo a VPH-16 por qPCR, 2 que sobre expresaron los receptores ki-67 y C-erbB2 coincidieron con las dos técnicas. Este hecho indicaría la alta precisión diagnóstica de la técnica qPCR, lo cual nos permitiría considerarla como una prueba complementaria a la IHQ, para posiblemente poder contribuir con el diagnóstico preliminar para el CaMa.

Nuestros resultados concuerdan con lo descrito en el 2015 por Woods et al., quienes observaron que la coexpresión de E6 con C-erbB2 dio como resultado células que expresaban niveles más altos de C-erbB2, por lo que concluyeron que probablemente hay una influencia de la oncoproteína E6 del VPH-16 en la sobreexpresión del gen HER-2 (C-erbB2) 20 . Sin embargo, hay estudios que indican lo contrario. En el 2015, Delgado analizó la relación entre el VPH y el marcador molecular Ki-67 en 275 muestras de cáncer de mama, sin encontrar significancia estadística entre la presencia de VPH y Ki-67 21 . No obstante, Kroupis et al. examinaron la presencia de VPH en tejidos de cáncer de mama por medio de la PCR, 17 muestras de 107 dieron positivo para VPH y encontraron significancia estadística entre VPH y Ki-67 22 . Por tanto, se concluye que, al trabajar con pocas muestras, no se puede determinar si la sobreexpresión de C-erbB2 y Ki-67 guarda o no relación con la presencia del VPH.

Entre las limitaciones de este estudio debemos mencionar que no se determinó la prevalencia del VPH-16 y VPH-18 en el CaMa, y su correlación con los marcadores inmunohistoquímicos C-erbB2 y Ki-67. Por otra parte, entre las fortalezas, destacamos que se analizaron variables clínicas y sociales que no se han encontrado en otros estudios a nivel nacional. Asimismo, se tuvo en cuenta los diversos factores que influyen en la calidad del ADN, por ello se trabajó con un kit de extracción especializado para muestras de tejido mamario parafinado, se estandarizó la qPCR y se trabajó con amplicones menores a 200 bp, los cuales garantizan una alta precisión diagnóstica.

En conclusión, se evidenció la presencia de VPH-16 y VPH-18 en las biopsias de carcinoma mamario de pacientes peruanas, encontrándose mayor presencia de VPH en el carcinoma ductal infiltrante y de grado III. Asimismo, nuestros resultados nos han permitido confirmar que, además de la presencia del VPH, se requieren de otros factores intrínsecos o extrínsecos que actúan de forma sinérgica y predisponen el desarrollo del cáncer en el ser humano.

Agradecimientos:

al Hospital Santa Rosa por proveernos las muestras, al Laboratorio de Virología Clínica y Molecular por brindarnos el espacio y los equipos para efectuar este estudio y al VRIP-UNMSM por el financiamiento.

Financiamiento: VRIP-UNMSM (B19102081) Programa de Promoción de Tesis de Pregrado del Vicerrectorado de investigación y posgrado (VRIP) de la Universidad Nacional Mayor de San Marcos (B19102081).

Citar como: Mamani- Zapana E, Vilcapoma-Diaz M, Ortiz-Muchotrigo N. Detección del virus del papiloma humano en biopsias de cancer de mama mediante PCR e inmunohistoquimica en el Hospital Santa Rosa durante el 2019. Rev Peru Med Exp Salud Publica. 2022;39(4). doi: https://doi.org/10.17844/rpmesp.2022.394.11069.

10

La tesis: Vilcapoma, M. (2021). “Detección del Virus Papiloma Humano de Alto Riesgo Tipo 16 (HPV-16) en muestras de biopsias de carcinoma mamario del Hospital Santa Rosa, 2019”. [Tesis de pregrado, Universidad Nacional Mayor de San Marcos, Facultad de Ciencias Biológicas, Escuela Profesional de Microbiología y Parasitología]. Repositorio institucional Cybertesis UNMSM, forma parte de este proyecto.

Articles from Revista Peruana de Medicina Experimental y Salud Publica are provided here courtesy of Instituto Nacional de Salud

RESOURCES