FIG. 6.

MPA induces Stat3 binding to the high-affinity mutant of the SIE from the human c-fos promoter. C4HD cells were treated for 15 min at 37°C with MPA or MPA-RU486 or were left untreated growing in ChFCS. Twenty micrograms of protein from nuclear extracts was incubated for 20 min at room temperature with 1 ng of ³²P-labeled double-stranded DNA containing the high-affinity mutant of the SIE from the human c-fos promoter (5′GTGCATTTCCCGTAAATCTTGTCTACA3′) (m67) used as a probe and analyzed by EMSA. The specificity of the Stat3-DNA complexes is shown by competition with 25- and 100-fold mass excesses unlabeled m67 oligonucleotide and by the lack of competition with a 100-fold mass excess of mutant m67 (100xm67 mut). The right panel shows a supershift analysis that was performed by including either anti-Stat3 or anti-Stat1 antibodies. An equivalent amount of preimmune rabbit serum was used as a control in the EMSA reaction mixture (NRS [normal rabbit serum]). This experiment was repeated six times with similar results. wt, wild type.