| NAME | SEQUENCE 5'--3′ | Tm | GC Content (%) |
|---|---|---|---|
| Gapdh-F | ATGACATCAAGAAGGTGGTG | 60 | 45.00 |
| Gapdh-R | CATACCAGGAAATGAGCTTG | 59,7 | 45.00 |
| Col2a1-F | ACTGGTAAGTGGGGCAAGAC | 62,9 | 55.00 |
| Col2a1-R | CCACACCAAATTCCTGTTCA | 63,4 | 45.00 |
| Runx2-F | GGACTGTGGTTACCGTCAT | 66,7 | 52.63 |
| Runx2-R | GGAGGATTTGTGAAGACTGTT | 66,6 | 42.86 |
| Sox9-F | GAGGAAGTCGGTGAAGAACG | 63,8 | 55.00 |
| Sox9-R | CTGAGATTGCCCAGAGTGCT | 64,6 | 55.00 |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.