Skip to main content
. 2024 Sep 6;14:1453309. doi: 10.3389/fonc.2024.1453309

Table 2.

Clinical and molecular characteristics among this cohort.

Patient (integrated diagnosis) Sex Age at Noonan syndrome diagnosis (y) Age at cancer diagnosis (y) Germline findings (VAF) Somatic findings (VAF) DNA array-based methylation classification (v12.5)
Individual 1 (RGNT) M 5 22 PTPN11 NM_002834.3:c.179G>C:p.Gly60Ala (50%) FGFR1 NM_023110.2:c.1966A>G: p.Lys656Glu (44%)
PIK3R1 NM_181532.2: c.1324_1362delATTGAAGCTGTAGGGAAAAAATTACATGAATATAACACT:p.Ile442_Thr454del (25%)
Rosette-forming glioneuronal tumor (class score: 0.56372)
Individual 2 (RGNT) M 19.5 19 PTPN11 NM_002834.3:c.922A>G:p.Asn308Asp (46%) FGFR1 NM_023110.2:c.1638C>T: p.Asn546Lys (32%)
PIK3R1 NM_181523.2:c.1353_1358delATATAA:p.Glu451_Asn453delinsAsp (34%)
PIK3R1 NM_181523.3: c.1359_1367delCACTCAGTT: p.Thr454_Phe456del (7%)
PIK3R1 NM_181523.2:c.2083G>A: p.Val695Met (43%)
Rosette-forming glioneuronal tumor (class score: 0.99998)
Individual 3 (glioneuronal neoplasm with worrisome molecular features, NEC) F 9 9 PTPN11 NM_002834.3:c.209A>G: p.Lys70Arg (45%) KRAS NM_004985.5:c.35G>A: p.Gly12Asp (13%)
Loss of chromosome arm 1p
Gain of chromosome arm 1q
4q12 amplification (PDGFRA, KIT, KDR, CHIC2, and FIP1L1)
Meningioma, benign, (class score: 0.35455); clinically reported as no match
Individual 4 (low-grade glioneuronal tumor, NEC) M 18.9 18 PTPN11 NM_002834.3:c.922A>G: p.Asn308Asp (50%) FGFR1 NM_023110.2:c.1638C>A: p.Asn546Lys (26%)
PIK3CA NM_006218.2:c.3140A>G: p.His1047Arg (25%)
PIK3CA NM_006218.2:c.3139C>T: p.His1047Tyr (5%)
N/A
Individual 5 (DNET) M 1.5 16 PTPN11 NM_002834.3:c.174C>A: p.Asn58Lys (43%)
EGFR NM_005228.3:c.1591C>T:p.Arg531Ter (47%)
FGFR1 NM_023110.2:c.1638C>A p.Asn546Lys (10%) No match

DNET, dysembryoplastic neuroepithelial tumor; NEC, not elsewhere classified; RGNT, rosette-forming glioneuronal tumor.