Table 2.
Clinical and molecular characteristics among this cohort.
| Patient (integrated diagnosis) | Sex | Age at Noonan syndrome diagnosis (y) | Age at cancer diagnosis (y) | Germline findings (VAF) | Somatic findings (VAF) | DNA array-based methylation classification (v12.5) |
|---|---|---|---|---|---|---|
| Individual 1 (RGNT) | M | 5 | 22 | PTPN11 NM_002834.3:c.179G>C:p.Gly60Ala (50%) |
FGFR1 NM_023110.2:c.1966A>G: p.Lys656Glu (44%) PIK3R1 NM_181532.2: c.1324_1362delATTGAAGCTGTAGGGAAAAAATTACATGAATATAACACT:p.Ile442_Thr454del (25%) |
Rosette-forming glioneuronal tumor (class score: 0.56372) |
| Individual 2 (RGNT) | M | 19.5 | 19 | PTPN11 NM_002834.3:c.922A>G:p.Asn308Asp (46%) |
FGFR1 NM_023110.2:c.1638C>T: p.Asn546Lys (32%) PIK3R1 NM_181523.2:c.1353_1358delATATAA:p.Glu451_Asn453delinsAsp (34%) PIK3R1 NM_181523.3: c.1359_1367delCACTCAGTT: p.Thr454_Phe456del (7%) PIK3R1 NM_181523.2:c.2083G>A: p.Val695Met (43%) |
Rosette-forming glioneuronal tumor (class score: 0.99998) |
| Individual 3 (glioneuronal neoplasm with worrisome molecular features, NEC) | F | 9 | 9 | PTPN11 NM_002834.3:c.209A>G: p.Lys70Arg (45%) |
KRAS NM_004985.5:c.35G>A: p.Gly12Asp (13%) Loss of chromosome arm 1p Gain of chromosome arm 1q 4q12 amplification (PDGFRA, KIT, KDR, CHIC2, and FIP1L1) |
Meningioma, benign, (class score: 0.35455); clinically reported as no match |
| Individual 4 (low-grade glioneuronal tumor, NEC) | M | 18.9 | 18 | PTPN11 NM_002834.3:c.922A>G: p.Asn308Asp (50%) |
FGFR1 NM_023110.2:c.1638C>A: p.Asn546Lys (26%) PIK3CA NM_006218.2:c.3140A>G: p.His1047Arg (25%) PIK3CA NM_006218.2:c.3139C>T: p.His1047Tyr (5%) |
N/A |
| Individual 5 (DNET) | M | 1.5 | 16 |
PTPN11 NM_002834.3:c.174C>A: p.Asn58Lys (43%) EGFR NM_005228.3:c.1591C>T:p.Arg531Ter (47%) |
FGFR1 NM_023110.2:c.1638C>A p.Asn546Lys (10%) | No match |
DNET, dysembryoplastic neuroepithelial tumor; NEC, not elsewhere classified; RGNT, rosette-forming glioneuronal tumor.