Table 1.
Mus musculus Primers used for qPCR of in vivo liver tissue samples.
| Gene | Forward (5′ → 3′) | Reverse (5′ → 3′) | Function |
|---|---|---|---|
| β2m | AAGTATACTCACGCCACCCA | CAGGCGTATGTATCAGTCTC | Housekeeping gene |
| Sirt1 | CAGTGAGAAAATGCTGGCCTA | TTGGTGGTACAAACAGGTATTGA | Energy sensor activated by high NAD+/NADH ratio; associates with PPARα to stimulate fatty acid oxidation |
| Akt2 | GAGGACCTTCCATGTAGACT | CTCAGATGTGGAAGAGTCAC | Serine/threonine kinase that regulates glucose uptake by insulin |
| Glut2 | GGTCAGAACTACCTCTCTTTG | GTGTGTGTGGAATTGTCCTC | Plasma membrane glucose sensor that promotes glucose secretion during gluconeogenesis |
| Srebp1c | AAGACATGCTCCAGCTCATC | TACGCACGTCGAACGAAACT | Transcription factor activated by insulin; induces de novo lipogenesis |
| Pparg | GTCAGTGTCGGTTTCAG | CAGATCAGCAGACTCTGGGT | Nuclear receptor that promotes lipid uptake |
| Acc | GTCCCCAGGGATGAACCAATA | GCCATGCTCAACCAAAGTAGC | Enzyme; converts acetyl-CoA to malonyl CoA, generates fatty acids (FA); malonyl CoA inhibits beta oxidation by preventing FA from associating with carnitine which hampers them from travelling to the mitochondria |
| Scd1 | GAGGCCTGTACGGGATCATA | TGAGAGAAGAAGAAGCCACGG | Enzyme activated by Srebp1c, converts saturated FA to monounsaturated FA which can be synthesized into triglycerides |
| Pparα | GGGAAAGACCAGCAACC | TGGAAGAATCGGACCTCTGC | Transcription factor that activates genes involved with mitochondrial beta-oxidation |
| Cpt1 | CTCAGTGGGAGCGACTCTTCA | GGCCTCTGTGGTACACGACAA | Enzyme that creates carnitine so fatty acids can enter mitochondria to produce ATP; inhibited by malonyl CoA |
| Mttp | CTCTTGGCAGTGCTTTTTCTCT | GAGCTTGTATAGCCGCTCATT | Transfers triglycerides onto Apob100 in the endoplasmic reticulum |
| Apob | CGTGGGCTCCAGCATTCTA | TCACCAGTCATTTCTGCCTTTG | Apolipoprotein responsible for binding lipids and shuttling VLDL to the Golgi |
| Sar1a | GGGCCGTTGTAAGCATCAATA | TTCCAGATTTCTTGTAGAGTCCTAGGA | COPII coat protein that enables VLDL transport to the Golgi apparatus |
| Sar1b | GCTAAAAAGGCAGGGCTATGG | GGCCGCTGCTAATCGATGTA | COPII coat protein that enables VLDL transport to the Golgi apparatus |
| Sec22b | CATTGATAGCCGTGCTCGGAG | CGCATCTTCAAGTACTTCGCATC | Component of VTV that enables ER to Golgi delivery of VLDL |
| Apoa1 | CCACACCCTTCAGGATGAAAG | TGGCTCCCTGTCAGGAAGAC | Major component of HDL; moves HDL to liver for reverse cholesterol transport |
| Apoa4 | CAGCTGACCCCATACATCCAG | TCATCGAGGTGTGCAGGTTG | Component of HDL that mediates reverse cholesterol transport |
| Lxr | TGCCATCAGCATCTTCTCTG | GGCTCACCAGCTTCATTAGC | Nuclear receptor that functions as a cholesterol sensor and activates ATP-binding cassette transporters |
| Abcg5 | ATCCAACACCTCTATGCTAAATCAC | TACATTATTGGACCAGTTCAGTCAC | Activated by LXR and stimulates cholesterol efflux; transports cholesterol into the bile |
| Cyp7a1 | CCAGGGAGATGCTCTGTGTTC | ACCCAGACAGCGCTCTTTGAT | Enzyme that modulates cholesterol catabolism by generating bile acids |