Maresin 1 alleviates neuroinflammation and cognitive decline in a mouse model of cecal ligation and puncture

Abstract

Objective

Inflammation in the central nervous system plays a crucial role in the occurrence and development of sepsis-associated encephalopathy. This study aims to explore the effects of maresin 1 (MaR1), an anti-inflammatory and pro-resolving lipid mediator, on sepsis-induced neuroinflammation and cognitive impairment.

Methods

Mice were randomly assigned to 4 groups: A sham group (sham operation+vehicle), a cecal ligation and puncture (CLP) group (CLP operation+vehicle), a MaR1-LD group (CLP operation+1 ng MaR1), and a MaR1-HD group (CLP operation+10 ng MaR1). MaR1 or vehicle was intraperitoneally administered starting 1 h before CLP operation, then every other day for 7 days. Survival rates were monitored, and serum inflammatory cytokines [tumor necrosis factor alpha (TNF-α), interleukin (IL)-1β, and IL-6] were measured 24 h after operation using enzyme-linked immunosorbent assay (ELISA). Cognitive function was assessed 7 days after operation using the Morris water maze (MWM) test and novel object recognition (NOR) task. The mRNA expression of TNF-α, IL-1β, IL-6, inducible nitric oxide synthase ( iNOS), IL-4, IL-10, and arginase 1 ( Arg1) in cortical and hippocampal tissues was determined by real-time reverse transcription PCR (RT-PCR). Western blotting was used to determine the protein expression of iNOS, Arg1, signal transducer and activator of transcription 6 (STAT6), peroxisome proliferator-activated receptor gamma (PPARγ), and phosphorylated STAT6 (p-STAT6) in hippocampal tissue. Microglia activation was visualized via immunofluorescence. Mice were also treated with the PPARγ antagonist GW9662 to confirm the involvement of this pathway in MaR1’s effects.

Results

CLP increased serum levels of TNF-α, IL-1β, and IL-6, and reduced body weight and survival rates (all P<0.05). Both 1 ng and 10 ng doses of MaR1 significantly reduced serum TNF-α, IL-1β, and IL-6 levels, improved body weight, and increased survival rates (all P<0.05). No significant difference in efficacy was observed between the 2 doses (all P>0.05). MWM test and NOR task indicated that CLP impaired spatial learning, which MaR1 mitigated. However, GW9662 partially reversed MaR1’s protective effects. Real-time RT-PCR results demonstrated that, compared to the sham group, mRNA expression of TNF-α, IL-1β, and iNOS significantly increased in hippocampal tissues following CLP (all P<0.05), while IL-4, IL-10, and Arg1 showed a slight decrease, though the differences were not statistically significant (all P>0.05). Compared to the CLP group, both 1 ng and 10 ng MaR1 decreased TNF-α, IL-1β, and iNOS mRNA expression in hippocampal tissues and increased IL-4, IL-10, and Arg1 mRNA expression (all P<0.05). Immunofluorescence results indicated a significant increase in Iba1-positive microglia in the hippocampus after CLP compared to the sham group ( P<0.05). Administration of 1 ng and 10 ng MaR1 reduced the percentage area of Iba1-positive cells in the hippocampus compared to the CLP group (both P<0.05). Western blotting results showed that, compared to the CLP group, both 1 ng and 10 ng MaR1 down-regulated the iNOS expression, while up-regulated the expression of Arg1, PPARγ, and p-STAT6 (all P<0.05). However, the inclusion of GW9662 counteracted the MaR1-induced upregulation of Arg1 and PPARγ compared to the MaR1-LD group (all P<0.05).

Conclusion

MaR1 inhibits the classical activation of hippocampal microglia, promotes alternative activation, reduces sepsis-induced neuroinflammation, and improves cognitive decline.

Sepsis-associated encephalopathy (SAE) is a condition characterized by diffuse cerebral dysfunction resulted from sepsis, without direct involvement of the central nervous system (CNS) infection or other forms of encephalopathy ^{[ 1]}. It represents a risk factor leading to long-term disability and mortality ^{[ 2]}. In a sepsis murine model, surviving mice exhibited acute encephalopathy followed by long-term cognitive impairment ^{[ 3]}. The pathogenesis of SAE may be associated with neuroinflammation, blood-brain barrier disruption, abnormal blood flow regulation, neurotransmitter dysfunction, synaptic dysfunction, and mitochondrial dysfunction ^{[ 2, 4]}.

Microglia serve as the predominant immune cells within the brain parenchyma, and perform several crucial functions in the brain, including synaptic formation, immune function, regulation of neuronal apoptosis, and communication with astrocytes to modulate these functions ^{[ 5]}. In various microenvironments, microglia undergo different activation states, such as the pro-inflammatory classical activation (M1), the anti-inflammatory alternative activation (M2), and other phenotypic variations ^{[ 6]}. Neuroinflammation caused by excessive classical activation and inadequate alternative activation of microglial cells is recognized as a pivotal factor of SAE ^{[ 7]}. Over-activation of M1 microglia can induce neurological dysfunction and memory loss in septic patients by releasing pro-inflammatory cytokines and expressing relevant enzymes. The inhibition of classical activation and promotion of alternative activation have been demonstrated to effectively treat and prevent psychiatric and neurological diseases by reducing neuroinflammation ^{[ 8- 9]}. Hence, the reduction of neuroinflammation via regulating of microglial activation is considered a promising strategy in SAE.

Recent studies ^{[ 6, 10]} have highlighted the roles of specialized pro-resolving lipid mediators (SPMs) in the termination of inflammation and promotion of its resolution. Several series of SPMs have been identified: lipoxins, resolvins, protectins, and maresins ^{[ 6, 10]}. Maresins are lipid mediators derived from the transformation of docosahexaenoic acid (DHA) by macrophages under the action of lipoxygenase and cyclooxygenase. Previous study ^{[ 11]} has indicated that the synthesis of maresins peaks during the resolution phase of inflammation, suggesting their role in restoring internal homeostasis. Maresin 1 (MaR1) is the earliest identified chemical isomer of maresins. Researches have confirmed that MaR1 can reduce neutrophil infiltration, inhibit the expression of inflammatory mediators ^{[ 12]}, promote macrophage chemotaxis and phenotypic transformation, and enhance their phagocytic function ^{[ 13]}. Additionally, MaR1 stimulates tissue regeneration, controls pain ^{[ 14]}, and alleviates the intensity of the inflammatory response at multiple levels, facilitating inflammation resolution ^{[ 15]}.

Collectively, these findings suggest the possibility that MaR1 may potentially protect against sepsis-induced learning and memory impairment via anti-inflammatory mechanisms. In the present study, we tested this hypothesis by investigating whether MaR1 exhibits a protective effect against memory deficits and by examining the inhibitory effects of MaR1 on microglia activation and neuroinflammatory response.

1. Materials and methods

1.1. Animals

Male C57/BL6J mice (8-12 weeks old, weighing 22-30 g) were procured from the Experimental Animal Center of Central South University. They were housed at (23±2) ℃ under a 12/12-hour light/dark cycle with unrestricted access to food and water. All experimental procedures involving animals were approved by the Medical Ethics Committee of Xiangya Hospital, Central South University (approval number: 201603230) and strictly adhered to the Regulations for the Administration of Affairs Concerning Experimental Animals.

1.2. Animal model and drug treatment

Sepsis is often accompanied by a systemic inflammatory response or even leads to death. To ascertain whether MaR1 affected the inflammatory response and mortality rate in sepsis in vivo, we employed the cecal ligation and puncture (CLP)-induced septic mouse model.Mice were anesthetized via isoflurane inhalation. A 1.5 cm midline incision was made in the abdomen to expose the cecum. The exposed cecum was ligated with 4-0 sutures below the ileocecal valve (5 mm from the cecal tip). Subsequently, a 22G needle was used to puncture the cecum, and a small volume of feces was gently expelled. After returning the cecum to the abdominal cavity, the abdomen was closed in sequence. Mice were promptly resuscitated by hypodermic injection of normal saline (20 mL/kg), placed on a heated blanket, and returned to their original cage upon awakening from anesthesia.

Firstly, mice were randomly assigned to 4 groups: A sham group (sham operation+vehicle), a CLP group (CLP operation+vehicle), a MaR1-LD group (CLP operation+1 ng MaR1), and a MaR1-HD group (CLP operation+10 ng MaR1). In the sham group, a similar abdominal incision exposed the cecum, but no ligation or perforation was conducted. MaR1 (Cayman Chemical, Ann Arbor, MI) or vehicle (saline containing ethanol) was administered intraperitoneally every other day for 7 days, starting 1 h before the CLP operation. Previous study ^{[ 3]} has indicated a high mortality rate in CLP mice within 7 days; hence, this study evaluated the effect of MaR1 on the survival rate of CLP mice within 7 days.

Previous studies ^{[ 6, 8]} have shown that using the peroxisome proliferator activated receptor gamma (PPARγ) antagonist GW9662 could block alternative activation. Therefore, we further treated mice with GW9662 to verify the role of alternative activation in the effects of MaR1. Given the previous results ^{[ 15]} showing no significant difference in the effects between low- and high-dose MaR1, we opted to use a lower effective dose for this portion of the study. Secondly, mice were randomly assigned to 4 groups: A sham group, a CLP group, a MaR1-LD group, and a MaR1-LD+GW9662 group. GW9962 (25 μg per mouse; Sigma Aldrich, St. Louis, MO, USA) was administered intraperitoneally 10 min before MaR1 treatment.

1.3. Behavioral tests

The manifestations of SAE are cognitive impairment and declined memory. Here, we used the Morris water maze (MWM) test and novel object recognition (NOR) task to assess the cognitive behavior of mice 7 days after CLP or sham operation ( n=6).

1.3.1. MWM

The MWM test was used to evaluate spatial learning, spatial memory, and cognitive flexibility in rodents. The MWM apparatus comprised a 120 cm diameter pool with a depth of 50 cm, maintaining a water temperature of 22 ℃. Milk powder was added in a ratio of 0.5%-1.5% to the water to create an opaque milky liquid. The maze was divided into 4 quadrants (first, second, third, and fourth), each marked with visual cues for orientation. An invisible platform was placed beneath the water surface in the target quadrant. Mice were released from different quadrants into the maze to locate the platforms. Upon finding the platform, mice were allowed to stay on it for 10 s. If a mouse failed to find the platform within 60 s, the researcher placed it on the platform for 10 s before removing it from the pool. Parameters such as swimming speed, escape latency, swim path length, and time spent in the platform quadrant were recorded by a camera and analyzed using the Morris Water Maze Video Analysis System (WMT-100S, Chengdu Taimeng Technology Co., Ltd., Chengdu, China). The MWM comprised learning and probe tests. In the learning tests, mice underwent 4 trials per day for 4 days, with each trial initiated by randomly placing an animal in one of the 4 quadrants. In the probe tests, the platform was removed, and each mouse was allowed to swim for 90 s. Parameters such as swim path length, original platform crossing times, and time spent in the trained quadrant were calculated. The test was conducted 24 h after training.

1.3.2. NOR task

The equipment required included an opaque plastic box of 40 cm×40 cm with objects of different colors and shapes but similar sizes. On the initial day of the task, mice were introduced to the empty box for 30 min to acclimate to the environment. Subsequently, on the second day, following a 5-minute acclimation in the empty field, 2 identical objects were positioned near the corner of the box with a 15 cm gap between them. Upon placing the objects, mice were introduced into the box for a 10-minute familiarization period, during which the time spent exploring each object was recorded. Effective exploration was defined as the mice directing their nose toward an object at a distance of <2 cm. Leaning on or sitting on an object and looking around were not considered exploratory behaviors. Following familiarization, mice were returned to their cages, and both the box and objects were cleaned with 70% ethanol. After a 24-hour interval, one of the objects was replaced with a new one. Mice were then placed in the box and allowed to explore freely for 5 min, and the exploration time was recorded. The time of exploring the old object was recorded as Tf₁, and the time of exploring the new object was recorded as Tn₁. The discrimination index (DI) was calculated using the following fomula: DI=(Tn₁-Tf₁)/(Tn₁+Tf₁).

1.4. Enzyme-linked immunosorbent assay

For enzyme-linked immunosorbent assay (ELISA) detection, serum was collected 24 h after CLP treatment. The tumor necrosis factor (TNF)-α, interleukin (IL)-1β, and IL-6 contents were quantified using ELISA kits (Boster Biological Technology, Wuhan, China) according to the manufacturer’s instructions. The samples were measured in duplicate, and readings from each sample were normalized to the protein concentration.

1.5. RNA extraction and real-time reverse transcription PCR

To further evaluate the effects of MaR1 on neuroinflammation and microglia activation in septic mice, we euthanized the mice 7 days after CLP or sham operation and collected cortical and hippocampal tissues to assess the mRNA expression of TNF-α, IL-1β, IL-6 inducible nitric oxide synthase ( iNOS), IL-4, IL-10, Arginase 1 ( Arg1). Total RNA was isolated from the cortex and hippocampus brain tissues using TransZol Up (TransGen Biotech, Beijing, China). The All-in-One First-Strand cDNA Synthesis Kit (TransGen Biotech Beijing, China) and Hieff® real-time RT-PCR SYBR® Green Master Mix (Low Rox Plus; Yeasen, Shanghai, China) were used to quantify the amounts of mRNA and circRNA. The All-in-One ^TM miRNA First-Strand cDNA Synthesis Kit (GeneCopoeia, USA) and All-in-One ^TM miRNA real-time RT-PCR Detection Kit (GeneCopoeia, USA) were used to quantify the amount of mature miRNA. GAPDH was used to normalize values, and the relative levels of mRNA were analyzed using the 2 ^-ΔΔCt method. Nucleus-cytoplasm separation assay was performed using NE-PER Nuclear and Cytoplasmic Extraction Reagents (Thermo Fisher, USA). The primer sequences are listed in Table 1.

Table 1.

Primer sequences

Gene	Forward	Reverse
TNF-α	CCGATGGGTTGTACCTTGTC	TGGAAGACTCCTCCCAGGTA
IL-1β	GCCACCTTTTGACAGTGATGAG	AAGGTCCACGGGAAAGACAC
IL-6	TGCAAGAGACTTCCATCCAG	TCCACGATTTCCCAGAGAAC
iNOS	AAGCCCCGCTACTACTCCAT	AGCTGGAAGCCACTGACACT
IL-4	TCAACCCCCAGCTAGTTGTC	CTTGGAAGCCCTACAGACGA
IL-10	GTAGAAGTGATGCCCCAGGC	GAGAAATCGATGACAGCGCC
Arg1	AAGAATGGAAGAGTCAGTGTGG	GGGAGTGTTGATGTCAGTGTG
GAPDH	AGCCCAAGATGCCCTTCAGT	CCGTGTTCCTACCCCCAATG

1.6. Western blotting

Western blotting was used to determined the protein expression of iNOS (microglial classical activation marker) and Arg1 (microglial alternative activation marker) in hippocampal tissue. A significant body of research ^{[ 6, 10- 11]} has already investigated the role and mechanisms of SPMs in the classical activation of microglial cells. Our research focused on further exploring the potential mechanisms by which MaR1 promotes alternative activation. Considering the critical role of the signal transducer and activator of transcription 6 (STAT6) and PPARγ signaling pathways in alternative activation, we examined the protein expression of STAT6 and PPARγ as well as the level of phosphorylated STAT6 (p-STAT6) by Western blotting.

The hippocampus was homogenized and lysed with radioimmune precipitation assay (RIPA) buffer for total proteins supplemented with a protease inhibitor cocktail and phosphatase inhibitors (Roche Molecular Biochemicals, Inc., Germany). Equal amounts of tissue extracts were electrophoresed on sodium dodecyl sulfate-polyacrylamide gels and then transferred onto a polyvinylidene difluoride membrane (Millipore, Germany). The transformed membrane was blocked with 5% non-fat dry milk in Tris-buffered saline containing 0.05% Tween-20 (TBST) for 1 h and incubated with primary antibodies overnight at 4 ℃. The primary antibodies against iNOS (1꞉1 000, ab178945, Abcam, UK), Arg1 (1꞉1 000, ab91279, Abcam, UK), STAT6 (1꞉1 000, ab32520, Abcam, UK), p-STAT6 (1꞉1 000, #56554, Cell Signaling Technology, USA), PPARγ (1꞉500, ab45036, Abcam, UK), and GAPDH (1:5 000, YN5585, Immunoway, USA) were used. The membrane was washed 3 times with TBST for 10 min and incubated with peroxidase affinipure goat anti-rabbit IgG (1꞉5 000, SA00001-2, Proteintech, USA) at room temperature for 1 h. Finally, the proteins were detected using ECL (Thermo Fisher Scientific, USA). The intensity of protein bands after western blotting was measured using the ImageJ software (version 1.45s; National Institutes of Health, USA) and normalized against proper loading controls.

1.7. Immunofluorescence and microscopy

We conducted immunofluorescence experiments on mouse hippocampal slices. Frozen sections of mouse hippocampal tissue were prepared, and 5% bovine serum albumin was used for blocking. The primary antibody against anti-ionized calcium-binding adapter molecule 1 (Iba-1, 1꞉200, ab178846, Abcam, UK) was then applied to the sections, which were laid flat in a humidified chamber and incubated overnight at 4 ℃. After washing 3 times for 5 min each in phosphate-buffered saline, the sections were probed with the respective secondary fluorescence antibodies to release signals. The slides were mounted with mounting medium and imaged under a Leica DMI4000 fluorescence microscope equipped with a DFC365FX camera Leica, German.

1.8. Statistical analysis

Data were expressed as mean±standard deviation of the indicated number of independent experiments. Statistical significance between multiple groups was analyzed using one-way ANOVA. The least significant difference (LSD) post hoc test was used for multiple comparisons. Analysis of the MWM acquisition testing variables was performed using a two-way repeated-measures ANOVA. Kaplan-Meier survival curves and log-rank analyses were used to compare survival outcomes between different groups. Statistical analysis was performed using GraphPad Prism 9.0 (GraphPad Software, Inc., USA). Statistical significance was set at P<0.05.

2. Results

2.1. MaR1 improves the survival rate and reduces systemic inflammatory response　in CLP-induced septic mice

No difference was observed in baseline body weight among the 4 groups ( n=15 in the sham group, n=20 in other groups, P>0.05; Figure 1A), and the survival rate in the CLP group was approximately 50% ( Figure 1B). Compared with the CLP group, the survival rate significantly increased in the MaR1-LD and MaR1-HD groups ( n=15 in sham group, n=20 in other groups; Figure 1B), with the surviving mice also exhibiting lower decreases in body weight (both P<0.01, Figure 1C).

Figure 1. MaR1 improves the survival rate in CLP-induced septic mice and reduces systemic inflammatory response Mice underwent sham or CLP operations and were then administrated MaR1 or vehicle intraperitoneally every other day, starting 1 h before CLP. A: Preoperative weight of mice in each group ( n=15 for sham group, n=20 for other groups); B: Daily monitoring of mortality rates in each group for 7 days after operation ( n=15 for sham group, n=20 for other groups); C: Proportion of body weight loss in surviving mice 7 days after operation; D-F: Serum concentrations of TNF-α (D), IL-1β (E), and IL-6 (F) in mice 24 h after sham or CLP operations ( n=6). Data are expressed as mean±standard deviation. MaR1: Maresin 1; CLP: Cecal ligation and puncture; LD: Low dose; HD: High dose; TNF-α: Tumor necrosis factor-α; IL: Interleukin.

Considering that systemic inflammatory response in septic mice peaks on the first day, we assessed the serum levels of inflammatory factors in mice 24 h after undergoing CLP operation. The serum levels of TNF-α, IL-1β, and IL-6 were significantly elevated in the CLP group, and this elevation was inhibited after MaR1 treatment ( n=6, all P<0.01; Figure 1D- 1F). No significant differences were observed in serum levels of inflammatory factors between the MaR1-LD and MaR1-HD groups (all P>0.05, Figure 1D- 1F).

2.2. MaR1 attenuates learning and memory impairment in CLP-induced septic mice

Following 4 consecutive days of training, the cognitive abilities of mice to reach the target platform improved throughout the training tests, indicating a learning process in the test. Trajectory motion images of mice in the 4 groups derived from the probe test was shown in Figure 2A. Compared with the sham group, the CLP group exhibited a longer escape latency and fewer platform crossing times, whereas MaR1-treated mice showed a shorter escape latency and more platform crossing times (Figure 2B- 2C). In the NOR task, the discrimination ratios presented a declining trend in the CLP group and an improving trend in the MaR1 groups, but the differences were not statistically significant ( Figure 2D).

Figure 2. MaR1 attenuates learning and memory impairment in CLP-induced septic mice.

A: Trajectory motion images of mice derived from the probe test. B: Escape latency during the acquisition training phase is depicted in the in the MWM on day 1-4, 7 days after CLP operation ( n=6). ** P<0.01 vs the sham group; †† P<0.01, ††† P<0.01 vs the CLP group. C: Platform crossing times during the probe tests ( n=6). D: Discrimination index of novel object recognition task ( n=6). Data are expressed as mean±standard deviation. MaR1: Maresin 1; CLP: Cecal ligation and puncture; LD: Low dose; HD: High dose; MWM: Morris water maze.

2.3. MaR1 alleviates neuroinflammation and regulates microglial cells activation in the hippocampus rather than in the cortex of septic mice

In the hippocampal tissue, the levels of pro-inflammatory factors TNF-α, IL-1β, and microglial classical activation marker iNOS exhibited a sharp increase 7 days after CLP (all P<0.05, Figure 3A). Additionally, IL-6 level was slightly elevated. The levels of anti-inflammatory factors IL-4 and IL-10 and microglial alternative activation marker Arg1 were slightly decreased in the CLP group, but the differences were not statistically significant (all P>0.05, Figure 3A). MaR1 could counteract the increased levels of inflammatory mediators and classical activation of microglial cells induced by CLP while stimulating the expression of anti-inflammatory mediators and alternative activation of microglial cells ( Figure 3A). Despite these changes being prominent in the hippocampus, similar phenomena were not observed in cortical tissue ( Figure 3B).

Figure 3. MaR1 alleviates neuroinflammation and microglia activation in the hippocampus rather than in the cortex of septic mice The hippocampal and cortical tissues were harvested on day 7 for analysis. A: Relative mRNA expression of inflammation- and microglia activation-related proteins in the hippocampus ( n=4). B: Relative mRNA expression of inflammation- and microglia activation-related proteins in the cortex ( n=4). C: Immunofluorescence staining for microglia in the hippocampus (×200) and quantification of Iba-1 positive cells in hippocampus of the 4 groups ( n=4). Iba-1 was used to label microglial cells (red) and DAPI was used to label cell nuclei (blue). Data are expressed as mean±standard deviation. MaR1: Maresin 1; CLP: Cecal ligation and puncture; LD: Low dose; HD: High dose; TNF-α: Tumor necrosis factor-α; IL: Interleukin; iNOS: Inducible nitric oxide synthase; Arg1: Arginase 1. * P<0.05, ** P<0.01, *** P<0.001, ns P>0.05.

Subsequently, we observed the activation of microglial cells in the hippocampal tissue, with Iba-1 being utilized to identify microglial cells ( n=4). Representative micrographs and quantification of Iba-1 positive cells in hippocampus of the 4 groups were showed in Figure 3C. In hippocampus, the percentage area of Iba-1-positive stained cells in the CLP group was higher than that in the sham group ( P<0.05, Figure 3C). After MaR1 treatment, although there was an increase in the alternative activation of microglial cells, the percentage area of total Iba-1-positive stained cells in the MaR1-LD and MaR1-HD groups was lower than that in the CLP group (both P<0.05, Figure 3C), which suggested an overall decrease in microglial cells activation, possibly due to a reduction in classical activation.

Consistent with its mRNA expression, the protein expression of iNOS significantly increased after CLP ( P<0.001), whereas it decreased following MaR1 treatment ( P<0.001, Figure 4A and 4B). Conversely, the protein expression of Arg1 significantly increased after MaR1 treatment ( P<0.05,Figure 4A and 4C). These findings further suggest that, compared with the CLP group, treatment with MaR1 led to a reduction in classical activation and an increase in alternative activation of microglial cells within the hippocampus.

Figure 4. MaR1 regulates microglia activation in the hippocampus of septic mice A-C: Western blotting and densitometry data analyses of microglia classical activation marker iNOS (A and B) and alternative activation marker Arg1 (A and C, n=4). D-G: Western blotting and densitometry data analyses of microglia alternative activation-related pathway proteins STAT6 (D and E), p-STAT6 (D and F), and PPARγ (D and G, n=3). Data are expressed as mean±standard deviation. MaR1: Maresin 1; iNOS: Inducible nitric oxide synthase; Arg1: Arginase 1;STAT6: Signal transducer and activator of transcription 6; p-STAT6: phosphorylated STAT6; PPARγ: Peroxisome proliferator-activated receptor gamma. * P<0.05, ** P<0.01, *** P<0.001, ns P>0.05.

Administration of MaR1 promoted the protein expression of PPARγ and the p-STAT6 (Figure 4D- 4G), suggesting the activation of STAT6 and PPARγ signaling pathways.

2.4. Blocking alternative activation of microglial cells antagonizes the effects of MaR1

GW9662 inhibited the upregulation of PPARγ and Arg1 after MaR1 treatment ( Figure 5A). We finally assessed the MWM test of the mice (Figure 5B and 5C), and the results showed compared with the MaR1-LD group, the MaR1-LD+GW9662 group exhibited a longer escape latency and fewer platform crossing times (all P<0.05), suggested that GW9662 counteracted the protective effect of MaR1 on cognitive function in septic mice.

Figure 5. Blocking alternative activation of microglial cells antagonizes the effects of MaR1 A: Western blotting and densitometry data analyses of PPARγ and Arg1 ( n=3). B: Spatial learning in the MWM on days 1-4, 7 days after CLP operation. Escape latency during the acquisition training phase is shown in the maze ( n=5). **P<0.01 vs the sham group; †† P<0.01, ††† P<0.001 vs the CLP group; ‡‡ P<0.01 vs the MaR1-LD group. C: Platform crossing times during the probe tests ( n=5). Data are expressed as mean±standard deviation. MaR1: Maresin 1; CLP: Cecal ligation and puncture; LD: Low dose; HD: High dose; iNOS: Inducible nitric oxide synthase; Arg1: Arginase 1; STAT6: Signal transducer and activator of transcription 6; p-STAT6: phosphorylated STAT6; PPARγ: Peroxisome proliferator-activated receptor gamma.

3. Discussion

Our study revealed the protective effect of MaR1 on septic nervous system injury. We found that MaR1 improved cognitive function, reversed the imbalance between classical and alternative activation of microglial cells induced by sepsis, and significantly reduced neuroinflammation.

SAE is a severe CNS complication of sepsis that is clinically manifested by diffuse brain dysfunction accompanied by varying degrees of neurological symptoms ^{[ 1, 2, 16]}. The severity of SAE ranges from mild delirium to coma, with some studies indicating a correlation between brain injury and long-term psychological or cognitive impairment in SAE ^{[ 2, 16]}. CLP is a widely employed animal model for sepsis, and numerous studies ^{[ 3, 17- 18]} have demonstrated its association with cognitive impairment. Consistent with previous research findings, we observed a systemic inflammatory response, weight loss, and mortality in mice following CLP operation, and the surviving mice exhibited impaired learning and memory. MaR1 is a novel anti-inflammatory and pro-resolving lipid mediator demonstrated to possess organ-protective effects in sepsis animal models ^{[ 19- 21]}. Considering the significance of SAE and the protective role of MaR1, elucidating the role of MaR1 in SAE is essential. In our study, MaR1 treatment improved learning and memory ability. Previous studies ^{[ 13, 19]} have found dose-dependent protective effects of MaR1 in vivo, but our results showed no significant differences in efficacy between the 2 selected doses. Perhaps the discrepancy lies in the fact that previous studies focused on doses ranging from 0.1 to 1 ng, and to further explore the effects of higher doses of MaR1, we selected doses of 1 and 10 ng. While in vitro studies, Wei, et al ^{[ 22]} also suggest that MaR1’s promotion of neurite length and number exhibits a ceiling effect. Taking these results into account, 1 ng is possibly the optimal research dose.

Microglia are crucial regulatory factors in the inflammatory response of the CNS that are activated in response to environmental influences. They play a significant role in the occurrence and outcomes of SAE ^{[ 5, 7]}. Microglia can be activated in at least two ways: classical and alternative activation ^{[ 6]}. IL-1β, IL-6, TNF-α, and IFN-γ are associated with classical activation and mediate inflammatory responses, whereas IL-4, IL-10, and Arg1 are associated with selective activation and play a role in promoting inflammation resolution ^{[ 23]}. CLP induces an increase in classical activation of microglia, which is a phenomenon previously confirmed in the literature and once again validated in our study ^{[ 24]}. Furthermore, our study indicates that MaR1 treatment promotes the transition of microglia from the classical activation to alternative activation, thereby alleviating neuroinflammation and facilitating its resolution.

A significant amount of research exists on the role and mechanisms of classical activation in SAE ^{[ 3, 25]}; however, research on the role of alternative activation in SAE is limited. PPARγ, a widely expressed nuclear transcriptional factor with protective features, is a crucial pathway for the alternative activation of microglia and macrophage, and its inhibitor GW9662 can suppress IL-4-induced microglial alternative activation ^{[ 5, 26- 27].} In our research, we further explored the mechanisms of PPARγ and alternative activation in SAE and the protective effects of MaR1. After administering of MaR1, an increase in PPARγ expression and activation of relevant signaling pathways were observed. Furthermore, intraperitoneal injection of the PPARγ inhibitor GW9662 partially attenuated the protective effects of MaR1. These results collectively suggest that MaR1 alleviates SAE by weakening classical activation and promoting alternative activation of microglia.

Nevertheless, our study has certain limitations. First, we did not explore the changes in endogenous MaR1 levels during the sepsis process. Second, we did not extensively focus on the damage to other organs because we aimed to concentrate primarily on sepsis-induced brain pathology. Lastly, further research is needed to elucidate how MaR1 regulates microglial polarization. We will continue to investigate this issue in future studies.

In summary, MaR1 demonstrates a protective effect on the CNS in the context of sepsis, improving cognition, regulating microglial differentiation, reducing the release of inflammatory factors, and promoting the resolution of neuroinflammation. These findings may offer new perspectives for the treatment of SAE.

Funding Statement

This work was supported by the National Natural Science Foundation (81601728, 31500726) and the Natural Science Foundation of Hunan Province (2021JJ41002), China.

Conflict of Interest

The authors declare that they have no conflicts of interest to disclose.

AUTHORS’CONTRIBUTIONS

LI Longyan Research design, experimental operation, data collecting and analysis, and paper writing; XING Manyu and WANG Lu Experimental operation and data collecting; ZHAO Yixia Research design, paper supervision and revision. The final version of the manuscript has been approved and read by all authors.

Note

http://xbyxb.csu.edu.cn/xbwk/fileup/PDF/202406890.pdf