Skip to main content
. 2024 Jun 29;16(3):422–431. doi: 10.1007/s12560-024-09602-6

Table 2.

Primers and probes used for ddPCR

Virus Sequence (5′–3′) PCR reaction profile Reference
MS2 TGCTCGCGGATACCCG 25 °C, 3 min; 47 °C, 60 min; 95 °C, 10 min; 40 cycles of 95 °C, 30 s; 55 °C, 1 min with ramp rate of 2 °C s-1; 98 °C, 10 min; held at 4 °C Trojnar et al. (2020)
AACTTGCGTTCTCGAGCGAT
[FAM]ACCTCGGGTTTCCGTCTTGCTCGT[BHQ1]
Phi6 TGGCGGCGGTCAAGAGC 25 °C, 3 min; 50 °C, 60 min; 95 °C, 10 min; 40 cycles of 95 °C, 30 s; 60 °C, 1 min with ramp rate of 2 °C s-1; 98 °C, 10 min; held at 4 °C Flood et al. (2021)
GGATGATTCTCCAGAAGCTGCTG
[FAM]CGGTCGTCGCAGGTCTGACACTCGC[BHQ1]
Coronavirus OC43 CGATGAGGCTATTCCGACTAGGT 25 °C, 3 min; 50 °C, 1 h; 95 °C, 10 min; 40 cycles of 95 °C, 30 s; 55 °C, 1 min with ramp rate of 2 °C s-1; 98 °C, 10 min; held at 4 °C Pecson et al. (2021)
CCTTCCTGAGCCTTCAATATAGTAACC
[FAM]TCCGCCTGGCACGGTACTCCCT[BHQ1]
Adenovirus GGACGCCTCGGAGTACCTGAG 95 °C, 10 min; 39 cycles of 94 °C, 30 s; 55 °C, 1 min with ramp rate of 2 °C s-1; 98 °C, 10 min; held at 4 °C Jothikumar et al. (2005)
ACIGTGGGGTTTCTGAACTTGTT
[FAM]CTGGTGCAGTTCGCCCGTGCCA[BHQ1]
CDV CTGTCRGTAATCGAGRATTCGA 25 °C, 3 min; 42 °C, 1 h; 95 °C, 10 min; 40 cycles of 95 °C, 30 s; 55 °C, 1 min with ramp rate of 2 °C s-1; 98 °C, 10 min; then held at 4 °C Halecker et al. (2021)
GCCGAAAGAATATCCCCAGTTAG
[FAM]ATCTTCGCCAGARTCYTCAGTGCT[BHQ1]