Abstract
Irritable bowel syndrome (IBS) is a common functional bowel disorder characterized by abdominal pain and visceral hypersensitivity. Reducing visceral hypersensitivity is the key to effectively relieving abdominal pain in IBS. Increasing evidence has confirmed that the thalamic nucleus reuniens (Re) and 5-hydroxytryptamine (5-HT) neurotransmitter system play an important role in the development of colorectal visceral pain, whereas the exact mechanisms remain largely unclear. In this study, we found that high expression of the 5-HT2B receptors in the Re glutamatergic neurons promoted colorectal visceral pain. Specifically, we found that neonatal maternal deprivation (NMD) mice exhibited visceral hyperalgesia and enhanced spontaneous synaptic transmission in the Re brain region. Colorectal distension (CRD) stimulation induced a large amount of c-Fos expression in the Re brain region of NMD mice, predominantly in glutamatergic neurons. Furthermore, optogenetic manipulation of glutamatergic neuronal activity in the Re altered colorectal visceral pain responses in CON and NMD mice. In addition, we demonstrated that 5-HT2B receptor expression on the Re glutamatergic neurons was upregulated and ultimately promoted colorectal visceral pain in NMD mice. These findings suggest a critical role of the 5HT2B receptors on the Re glutamatergic neurons in the regulation of colorectal visceral pain.
Keywords: Colorectal visceral pain, Thalamic nucleus reuniens, Neonatal maternal deprivation, Glutamatergic neurons, 5-HT2B receptors
Introduction
IBS is a functional gastrointestinal disorder characterized by chronic visceral pain. About 20% of the global population suffers from IBS [1]. Visceral pain signals reinforce certain neural circuits through peripheral and central sensitization, culminating in chronic visceral hypersensitivity [2, 3]. Despite some advances, the treatment of chronic visceral pain remains a major challenge for patients with IBS. As a result, there is an urgent need for researchers and clinicians to figure out its pathogenesis. Neonatal maternal deprivation (NMD) is a well-established animal model that induces chronic visceral hypersensitivity in rodents [4–6]. This study aims to investigate the central neural mechanisms underlying NMD-induced chronic visceral hypersensitivity in mice.
The thalamic nucleus reuniens (Re) is a key part of the midline thalamic nuclei. It has been reported that Re is involved not only in pain but also in fear, anxiety, depression, inflammation, and so on [7–9]. Peripheral nociceptive signals are transmitted to the central nervous system (CNS) via the dorsal root ganglia and the spinal cord, and the thalamus relays these signals to the cortex for pain perception. It has been reported that cortical nucleus groups such as the anterior cingulate (ACC), insula cortices (IC), and prefrontal cortex (PFC) play important roles in chronic visceral pain [10, 11]. Efferent projections of the Re are observed in many brain regions, including ACC, inferior limbic (IL) and anterior limbic (PL), medial orbital cortex (MO), and ventral orbital cortex (VO), while the Re also receives projections from other brain regions, such as ACC, mPFC, IC, CA1 region of hippocampus (HIP), zona incerta (ZI), periaqueductal gray matter (PAG), and ventral tegmental area (VTA) [12, 13]. Therefore, the Re may be a key brain region for pain signal relay from peripheral to cortex, and a very important pathway hub for descending transmission from central to peripheral in response to pain. However, studies on the involvements of the Re in visceral pain are very limited, so the mechanism of its modulation on chronic visceral pain still needs to be investigated.
The Re receives projections from serotonergic neurons in pain-related brain regions such as the dorsal raphe nucleus (DRN) and raphe magnus (RM) [14–16]. 5-HT is an important neurotransmitter in the body, involved in many physiological and pathological processes, and plays a crucial role in the processing and regulation of chronic pain in the CNS [17]. It has been consistently shown that the brain expresses 7 families of 5-HT receptors (5-HT1-7), including 14 subtypes in total [18]. Most 5-HT receptors exist in the brain and peripheral tissues, except for 5-HT1E, 5-HT2C, and 5-HT6 receptors, which have limited expression in the central nervous system. The 5-HT2 receptors family consists of the 5-HT2A, 5-HT2B, and 5-HT2C receptors subtypes.
Increased excitatory postsynaptic currents in neurons mediated by 5-HT2 receptors have often been observed in brain slices, possibly because increased glutamate neurotransmitter release directly or indirectly mediates potassium channel closure and depolarization [19, 20]. Activation of the 5-HT2B receptors enhanced the excitability of spinal dorsal horn neurons in the neuropathic pain model [21]. Moreover, the activation of 5-HT2B receptors promotes contraction of the intestinal smooth muscle [22]. Therefore, inhibiting 5-HT2B may reduce excessive intestinal contractions, subsequently relieving visceral pain caused by intestinal spasms. The function of the 5-HT2B receptors in the brain remains largely unexplored.
In this study, we identified the Re as a key player in colorectal visceral pain in mice. Our findings revealed that Re glutamatergic neurons were activated during colorectal visceral pain processing and that manipulation of Re glutamatergic neurons altered chronic visceral pain behavior in mice. Furthermore, we demonstrated that increased 5-HT neurotransmission in the Re and expression of 5HT2B receptors in glutamatergic neurons mediated the development of colorectal visceral pain. These findings will provide a new therapeutic target for the treatment of IBS.
Materials and Methods
Animals
All experiments were approved by the Soochow University Institutional Animal Care and Use Committee. All animals were housed at Suzhou University Experimental Animal Center, with a 12 h light-dark cycle, free access to food and water, a constant temperature of 23–25°C, and a relative humidity of 40%–60%. All methods employed in the study strictly adhered to the guidelines established by the International Association for the Study of Pain. Mice were randomly assigned to experimental and control groups.
Neonatal Maternal Deprivation
The male pups were separated from their mothers for 3 h every day, from day 2 to day 15 after birth, by transferring into a clean mold box with an electric blanket. The mothers were left in the original cages when separated. A partition was placed in the mold box to ensure each pup was placed in a separate compartment. The pups isolated from the mother during the neonatal period were model group mice (NMD). Male offspring mice aged 6–12 weeks were selected for subsequent experiments [23, 24].
Extracellular Recording
For acute extracellular recording, a single electrode was implanted into the Re (AP: −0.7 mm, ML: −0.2 mm, DV: −4.25 mm). The mice were allowed to recover for 7 days before recordings. Recording electrodes were attached to a 16-channel head-stage, and neuronal signals were amplified, filtered at a bandwidth of 300–5000 Hz, and stored using AlphaLab SNR (Alpha Omega, Jerusalem, Israel). Neuronal firings in the Re were recorded in the CON group and NMD group (lasted for 20 s). The firing rates were calculated using Neuroexplorer 5 (Nex Technologies, USA).
Colorectal Visceral Pain Threshold Test
Colorectal visceral pain threshold was evaluated by CRD as previously described [24–26]. After the mice were anesthetized, the prepared balloon was slowly inserted 2 cm into the colorectum and secured to the tail [27]. The mice were restrained in a transparent resin box. While inflating the latex balloon, we recorded the pressure value at which the mouse's abdomen lifted off the tabletop as the colorectal visceral pain threshold [23]. All behavioral tests were conducted in a double-blinded manner.
Electromyography Recording
Mice were completely anesthetized with isoflurane and electrodes were implanted as previously described [24]. Briefly, mice were kept on a thermostatic electric blanket, and the abdominal skin was cut open to thread the electrodes through the muscles on both sides of the mid-abdomen. The electrodes were threaded subcutaneously and pulled out from their neck. Finally, the exposed wires were folded together and sealed with parafilm to prevent mouse biting. EMG responses to CRD of different pressures were measured after a 7-day recovery period. The EMG signals are amplified and filtered at 300 Hz, followed by digitization using Acknowledge software (Biopac Systems, Inc). Computer algorithms were employed to calculate the area under the curve (AUC) of EMG activity during each 20-second interval of CRD [24].
Immunofluorescence
After allowing mice to acclimate within transparent resin boxes for 1 h, CRD stimulation was given at 60 mmHg for 5 times, each lasting 20 s with a 4 min interval. 1.5 h after CRD stimulation, mice underwent cardiac perfusion to facilitate brain tissue collection, which was then fixed with 4% paraformaldehyde for 3 h. The brain tissue was sliced into 30 μm sections using a cryostat (Leica, CM3050 S, Germany). These slices were stored at −30°C for subsequent immunofluorescent staining. In the c-Fos assessment experiment involving local drug injection, NMD mice were administered RS-127445 (1 μL, 30 μmol/L) 1 h before CRD stimulation (20 s, 60 mmHg).
Initially, sections were incubated with 3% Triton X-100 and blocked with 10% donkey serum, prior to incubation with primary antibodies including mouse 5-HT2B (1:200, Santa Cruz Biotechnology), rabbit anti-c-Fos (1:200, Cell Signaling, USA), rabbit anti-Glutamate (1:200, Cell Signaling Technology, USA) overnight in the fridge. After washes with 1x PBS buffer, sections were incubated for 1 h with appropriate secondary antibodies including anti-rabbit Alexa Fluor 488 (1:500, Invitrogen, USA) or anti-mouse Alexa Fluor 555 (1:500, Invitrogen, USA). Following 1xPBS washing, sections were air-dried and mounted using a mounting medium containing DAPI (4′,6-diamidino-2-phenylindole). Finally, laser confocal microscopy was employed to capture images of interest.
Stereotaxic Injection
The mice were deeply anesthetized with isoflurane and fixed horizontally on a brain stereotaxic localizer, and the fur was cut to expose the skull (RWD, 71000-M, China). The bregma was used as the origin and then the cranial vertex plane to the horizontal position. The electrode tip was moved to the position of the Re, and the skull drill was used to drill holes in the skull (AP: −0.7 mm; ML: −0.2 mm; DV: −4.25 mm). 200 nL of the virus (rAAV2/9-VGluT2-hChR2-EYFP, rAAV2/9-VGluT2-eNpHR-EYFP or rAAV2/9-VGluT2-EGFP from Gene Biotechnology, China) was injected at a rate of 20 nL/min. The needle was kept in situ for 10-15min after each injection. After injection, a fiber optic cannula was inserted into the injection site and secured by dental adhesive. 3 weeks were given prior to testing to allow virus expression [28].
Local Drug Infusion
Cannulas were embedded in the Re 7 days prior to the injection of 5-HT2B receptors antagonist RS-127445 (3 μmol/L, 10 μmol/L, 30 μmol/L, 100 μmol/L, 1 μL) into the right Re at a flow rate of 0.2 μL/min. Similarly, vehicle solution (DMSO, 1 μL) was locally applied. The injector was slowly withdrawn for 1 min and the behavioral assays were performed roughly 15 min after the infusion. Unless otherwise stated, all drugs were purchased from MCE [29].
Optogenetics
The ceramic inserts (diameter: 200 μm, Newdoon, China) were implanted into the Re of anesthetized mice using a stereotaxic apparatus. These ceramic inserts were secured to the mice’s skull using dental cement. The implanted ceramic inserts were connected to a laser generator through optical fiber tubing. Blue light (473 nm, 2–5 mW, 20 ms pulses, 10 Hz) or yellow light (589 nm, 3–5 mW, constant) was controlled by STSI-Optogenetics-LED (Alpha Omega, Jerusalem, Israel). Following the conclusion of the experiments, all mice’s ceramic insertion points were inspected. If a mouse's insertion point was found to be outside of the Re, the corresponding data were discarded [16].
Brain Slice Electrophysiology
Mice were anesthetized and their brain tissue was rapidly obtained following cardiac perfusion with artificial cerebrospinal fluid (ACSF) (in mmol/L: 93 NMDG, 1.2 NaH2PO4, 30 NaHCO3, 20 HEPES, 2.5 KCl, 2 thiourea, 3 sodium pyruvate, 5 sodium ascorbate, 10 MgSO4, 12 NAC, 0.5 CaCl2, 25 glucose). Coronal slices of the brain tissue with a thickness of 300 μm were prepared using a vibrating microtome (Leica, VT1200S) and then incubated in ACSF at 32°C for 30 min. The slices were placed on a nylon mesh, ensuring continuous perfusion of the recording chamber with an oxygenated external solution (in mmol/L: 124 NaCl, 1.2 NaH2PO4, 2.5 KCl, 5 HEPES, 24 NaHCO3, 12.5 glucose, 2 MgSO4, 2 CaCl2) throughout the experiment. First, the target brain region was examined under a 5× microscope objective using a patch-clamp system and then transferred to the 40x water-immersion objective (Olympus, Japan) with a CCD camera, equipped with infrared-differential interference contrast (IR-DIC) and an infrared camera connected to the video monitor. An appropriate amount of electrode fluid was injected into the electrode and positive pressure was applied to observe the electrode resistance (4–8 MΩ). The glass electrode was slowly lowered to the brain slice below the recording solution surface, positive pressure was released in bath voltage clamp mode, and then negative pressure was given in cell mode to break the membrane of the cells for whole-cell patch clamp recordings. Action potentials (APs) and resting membrane potential (RP) were recorded during the current clamp. Spontaneous excitatory postsynaptic currents (sEPSC) were recorded at −70 mV [30, 31]. To record the glutamatergic neurons in the Re, a virus was injected into Re to specifically label glutamatergic neurons with an enhanced green fluorescent protein (EGFP, Fig. 5G).
Fig. 5.
Inhibition of 5-HT2B receptors relieved colorectal visceral pain in NMD mice. A Effects of different doses of 5-HT2B receptors inhibitors on colorectal visceral pain thresholds in NMD mice (NMD=6 mice, *P <0.05, ***P <0.001, two-way ANOVA). B Representative traces of EMG recordings in NMD mice. C RS-127445 inhibited EMG responses. (NMD, n = 6 mice, *P <0.05, ****P <0.0001, two-way ANOVA). D Schematic time course of RS-127445 injection and brain harvest on NMD mice. E Representative immunofluorescence of c-Fos (green). Scale bar, 50 μm. F Statistical graph of c-Fos immunofluorescence in NMD+CRD and NMD+CRD+RS-127445 groups (NMD+CRD, n = 5 slices; NMD+CRD+RS-127445, n = 6 slices, ****P <0.0001, two-sample t test). G Representative images of real-time recordings of glutaminergic neurons in the Re. Scale bar, 10 μm. H Representative trace of sEPSC before and after incubation of RS-127445 in Re neurons of NMD neurons. I, K Statistics analysis of sEPSC frequency and amplitude before and after incubation of RS-127445 in Re neurons (NMD, n = 12 cells; NMD+RS-127445, n = 12 cells, ***P <0.001, Student’s t-test).
Western Blotting
The Re sample was homogenized in tissue lysate according to the weight of the tissue [29, 32]. Ultrasonic crushing (PW = 5.0 W) was performed in the ice-water mixture until the sample became transparent. After crushing, the samples were placed on ice for 2 h and centrifuged at 15000 rpm at 4 °C for 30 min to absorb the supernatant. A BCA protein assay kit (Beyotime, China) was used to determine the protein concentration. The same amount of protein (30 μg) was subjected to 4% and 10% SDS-polyacrylamide gel electrophoresis (PAGE) and the protein bands were transferred to a nitrocellulose membrane (Merck Millipore, Germany). The membrane was incubated with the primary antibody (1:1000, anti-GAPDH; 1:50, anti-5HT2B) at 4 °C overnight. After TBST rinse and incubation with goat anti-Mouse IgG, enhanced luminescence (ECL, NCM biotech, China) and appropriate luminescence imaging system (Bio-Rad) were used to develop the image after washing the second antibody, and the gray values of protein bands were analyzed by ImageJ software. With GAPDH as a reference, the gray values of protein bands were standardized and then analyzed statistically [31].
Real-Time PCR
Real-time polymerase chain reaction (PCR) was used to detect the mRNA expression of the 5-HT2B receptors. The samples were mixed in the reverse transcription kit (Transgen Biotech, China) according to the manufacturer’s instructions. The extracted RNA was reverse-transcribed into cDNA using a PCR system. Then, the mRNA expressions of the 5-HT2B receptors were detected by the real-time quantitative PCR (qPCR) reaction. Relative mRNA expression was analyzed using the obtained Ct value. The sequences of the primers for 5-HT2B and GAPDH are shown below.
Primer sequences used in the present study | |
---|---|
Primers | Sequences (5′ to 3′) |
GAPDH-F | GAAGGTCGGTGTGAACGGAT |
GAPDH -R | AATCTCCACTTTGCCACTGC |
5-HT2B-F | ATGAAGCAGACTGTGGAGGG |
5-HT2B-R | TCCAGTGCAACAGCCAGAAT |
5-HT1A-F | TCCGCAAGACGGTCAAGAAG |
5-HT1A-R | CTGTCTCACCGCCCCATTAG |
5-HT1B-F | TGCTCCTCATCGCCCTCTAT |
5-HT1B-R | CCTAGCGGCCATGAGTTTCT |
5-HT1D-F | GCTCTCAGAATCTCGCTCGT |
5-HT1D-R | GGTGGTAAGGACGAAGGCAT |
5-HT1F-F | CTGTCTGGGCTGGCATTGAT |
5-HT1F-R | TGCAGCTTCCGAGTCACAAT |
5-HT2A-F | ACCATAGCCGCTTCAACTCC |
5-HT2A-R | CCGAAGACTGGGATTGGCAT |
5-HT3B-F | CTGGCCATCCTGTATCGCTT |
5-HT3B-R | AGGTGACGGTATAGAGCCCC |
5-HT5A-F | TTGGAACCTAACCGCAGCTT |
5-HT5A-R | ACCAGGCTCAGTGGCATA AC |
5-HT5B-F | CGCCGAGCAACAGTAACCTT |
5-HT5B-R | CAACAAAGCACAAACACGCC |
5-HT6-F | ACTTCTTCCTGGTGTCGCTC |
5-HT6-R | AGAGGTTGAGAATGGAGGCG |
Statistical Analyses
All data were presented as Mean ± SEM. Statistical analyses were conducted using GraphPad Prism 8.0.2. Prior to statistical analysis, normality checks were performed on all data. Significance was determined using a two-tailed Student's t-test or one-way analysis of variance (ANOVA), followed by the Tukey test for multiple comparisons, or two-way ANOVA followed by the Bonferroni test for multiple comparisons. Differences were considered significant when *P <0.05.
Results
The Re Contributed to Visceral Hypersensitivity in NMD Mice
We first evaluated the effect of maternal deprivation (as illustrated in Fig. 1A) on colorectal visceral pain hyperalgesia. These NMD mice were tested for colorectal visceral pain at 6 weeks of age. Abdominal wall electromyography (EMG) (Fig. 1B) showed that the AUC of EMG induced by CRD was enhanced in NMD mice (Fig. 1C, D), suggesting visceral hyperalgesia in NMD mice compared to CON mice. Next, c-Fos staining was used to explore which brain regions were activated by CRD (Fig. 1E). We found a large amount of c-Fos expression in the Re after CRD, and more importantly, the c-Fos expression in the NMD+CRD group was much more than that in the CON+CRD group (Fig. 1F, G). The results suggest that enhanced activation of neurons in the Re may contribute to visceral hyperalgesia in NMD mice. In addition, we performed an in vivo single-channel extracellular recordings (EC) test on the Re cells (Fig. 1H). Statistical analysis showed that the average discharge rate of Re cells in the NMD group was significantly higher than that in the CON group (Fig. 1I, J). Furthermore, the results of EMG recordings and EC recordings were positively correlated (Fig. 1K). These results confirmed our hypothesis that Re is involved in chronic visceral hypersensitivity in NMD mice.
Fig. 1.
The Re was involved in colorectal visceral pain in NMD mice. A Experimental protocol for NMD model preparation. B Schematic of EMG recording. C Representative traces of EMG recording of the CON and NMD groups (CON, n = 6 mice; NMD, n = 6 mice, *P <0.05, **P <0.01, two-way ANOVA). D The bar graph shows the AUC of EMG recordings at the same distending pressure. E The experimental protocol of CRD stimulation. F Representative c-Fos immunofluorescence induced by CRD stimulation. Scale bar, 50 μm. G NMD enhanced c-Fos expression in response to CRD stimulation at the Re region (CON, n = 7 slices; NMD, n = 9 slices; CON+CRD, n = 7 slices; NMD+CRD, n = 5 slices, *P <0.05, **P<0.01, ****P <0.0001, one-way ANOVA). H Schematic diagram of EC recordings. I Representative traces of EC recording. J NMD increased Re neural firing (CON, n = 4 mice; NMD, n = 6 mice, *P <0.05, **P <0.01, two-way ANOVA). K Correlation analysis shows a positive correlation between EMG and extracellular recordings at 20 and 60 mmHg CRD stimulation.
NMD Increased Neuronal Excitability and Synaptic Transmission in the Re
In order to more comprehensively verify the involvement of Re in colorectal visceral pain, the whole-cell patch-clamp technique was used to assess the excitability of Re region neurons in CON and NMD mice (Fig. 2A). There was no significant difference in the resting membrane potential (RP) of the Re neurons in CON and NMD mice (Fig. 2C). The action potential (AP) thresholds of the Re neurons in NMD mice were significantly lower than in the CON group (Fig. 2D). In addition, the frequency of AP in Re neurons of NMD mice was significantly increased by 80 pA, 120 pA, and 160 pA current stimulation compared with CON mice (Fig. 2B). The above results suggest that the excitability of neurons in Re of NMD mice is significantly elevated, which may contribute to the development of visceral hypersensitivity in NMD mice.
Fig. 2.
NMD increased neuronal excitability and synaptic transmission in the Re. A Representative traces of the current-evoked action potentials in Re brain slices of mice in the CON and NMD groups. B NMD increased the current-evoked action potentials in brain slices of NMD mice (CON, n = 18 cells; NMD: n = 17 cells, **P <0.01, two-way ANOVA). C, D Comparison of RP and AP threshold between CON and NMD mice (CON, n = 18 cells; NMD: n = 17 cells, *P <0.05, Student’s t-test). E Representative traces of sEPSC. F, H Statistics analysis of sEPSC frequency and amplitude in brain slices of mice in the CON and NMD groups (CON, n = 18 cells; NMD: n = 17 cells, *P <0.05, Student’s t-test).
Next, we used the whole-cell patch clamp voltage-clamp technique to record spontaneous excitatory postsynaptic currents (sEPSC) of neurons in the Re of CON and NMD mice. The sEPSC model shows enhanced excitatory synaptic transmission of neurons in the Re of NMD mice (Fig. 2E). Compared with the CON group, the sEPSC frequency of neurons in Re of NMD mice was significantly enhanced (Fig. 2F), while there was no significant change in sEPSC amplitude (Fig. 2H), indicating increased release of presynaptic excitatory neurotransmitter. The above results suggest that NMD induces visceral hypersensitivity in mice by enhancing presynaptic excitatory neurotransmitter release in the Re region.
Glutamatergic Neurons in the Re Contributed to Visceral Hyperalgesia in NMD Mice
Next, we explored the neuron types of the Re neurons activated by CRD. In NMD mice, c-Fos-positive Re neurons were co-labeled with the marker of glutamatergic neurons (Fig. 3A). We found that about 80% of the CRD-activated neurons were glutamatergic neurons (Fig. 3B). It suggests that glutamatergic neurons of Re are involved in colorectal visceral pain in NMD mice. Subsequently, we manipulated the activity of glutamatergic neurons through optogenetics to examine the role of glutamatergic neurons in Re in the regulation of colorectal visceral pain. In NMD mice, inhibiting the activity of glutamatergic neurons in Re with yellow light (580 nm) effectively relieved colorectal visceral pain during CRD stimulation (Fig. 3E, F). In CON mice, activation of glutamatergic neurons with blue light (473 nm) significantly promoted colorectal visceral pain (Fig. 3G, H). The above results suggest that activation of glutamatergic neurons in Re promotes colorectal visceral pain in NMD mice.
Fig. 3.
Excitatory glutamatergic neurons in the Re participated in colorectal visceral pain of NMD mice. A Representative images of c-Fos+ cells (green) and glutamatergic neurons (red) co-expression in the Re. Scale bar, 50 μm. B The percentage of c-Fos+ neurons that are glutamatergic (n = 8 slices). C, D Schematic of optogenetic experiments of CON and NMD mice. Scale bar, 20 μm. E Representative traces of EMG recordings in NMD mice. F Optogenetic inhibition of Re neurons inhibited colorectal visceral pain responses (eNpHR, CON, n = 9 mice; NMD, n = 9 mice, **P <0.01, two-way ANOVA). G Representative traces of EMG recordings in CON mice. H Optogenetic activation of Re neurons enhanced colorectal visceral pain responses (hChR2, CON, n = 6 mice; NMD, n = 6 mice, *P <0.05, **P <0.01, two-way ANOVA).
5-HT2B Receptors Expression in Re Glutamatergic Neurons and 5-HT Release in the Re were Increased
To further verify the molecular mechanism by which glutamatergic neurons in Re regulate colorectal visceral pain behaviors, the expression of 5-HT receptors was next evaluated. Among the subtypes examined, the mRNA level of 5-HT2B receptors in the Re of NMD mice was significantly increased (Fig. 4A) and Western Blot further confirmed this result (Fig. 4B). To examine which type of neurons express the 5-HT2B receptor, we co-labeled 5HT2B and glutamate by immunofluorescence and found that about 80% of 5-HT2B positive cells were glutaminergic neurons (Fig. 4C, D). The density of 5-HT2B positive neurons in NMD mice was much higher than that in CON mice (Fig. 4E), whereas the number of glutamate-positive neurons had no significant change (Fig. 4E). In addition, approximately 90% of c-Fos+ neurons were also positive for 5-HT2B (Fig. 4F, G), while around 85% of 5-HT2B+ neurons were c-Fos+ (Fig. 4H). This indicates a substantial co-labeling between c-Fos and 5-HT2B.
Fig. 4.
5-HT2B and 5HT in the Re were increased in NMD mice. A mRNA expression levels of different 5-HT receptor subtypes in Re (CON, n = 4 mice; NMD, n = 4 mice, *P <0.05, two-way RM ANOVA). B The protein level of the 5-HT2B receptors in Re was significantly higher in NMD mice compared with CON mice (CON, n = 4 mice; NMD, n = 4 mice, **P <0.01, Student’s t-test). C Representative images of 5-HT2B reporters (green) and glutamatergic neurons (red) co-expression in the Re of NMD and CON mice. Scale bar, 50 μm. D Percentage of 5-HT2B+ neurons that are glutamatergic neurons in CON and NMD mice (CON, n = 4 slices; NMD, n = 4 slices). E The density of glutamatergic neurons and the number of 5-HT2B+ neurons in CON and NMD groups (CON, n = 4 mice; NMD, n = 4 mice, **P <0.01, Student’s t-test). F Representative images of 5-HT2B reporters (green) and c-Fos (red) co-expression in the Re of NMD mice. Scale bar, 50 μm. G Percentage of c-Fos+ neurons that are 5-HT2B+ neurons (n = 8 slices). H Percentage of 5-HT2B+ neurons that are c-Fos+ neurons (n = 8 slices). I Schematic of 5-HT probe injection. Typical images of 5-HT probe injection sites within the Re. J Thermograms and event-related line plots of 5-HT changes in CON and NMD mice during 60 mmHg CRD pressure stimulation. K Statistical histograms of the area under the curve (AUC) of 5-HT release in CON and NMD mice during CRD pressure stimulation at 60 mmHg (CON, n = 6 mice; NMD, n = 6 mice, *P <0.05, **P <0.01, Student’s t-test). L Statistical histograms of peak 5-HT release in CON and NMD mice during CRD pressure stimulation at 60 mmHg (CON, n = 6 mice; NMD, n = 6 mice, *P <0.05, **P <0.01, Student’s t-test).
5-HT is an important neurotransmitter associated with pain. We used a probe specific for 5-HT to detect 5-HT release in the Re (Fig. 4I). Upon administration of CRD, both CON and NMD mice showed increased release of 5-HT in the Re (Fig. 4J). Statistical analysis showed that the AUC and peak values of the NMD group were significantly higher than those of the CON group (Fig. 4K, L), suggesting a higher release of 5-HT in NMD mice. These results suggested that the expression of 5-HT2B receptors on Re glutamatergic neurons and 5-HT release in the Re were up-regulated in NMD mice.
Specific Inhibition of 5-HT2B Alleviated Colorectal Visceral Pain in NMD Mice
To further investigate the role of 5-HT2B in colorectal visceral pain in NMD mice, we microinjected 1 μL DMSO and different doses (3 μmol/L, 10 μmol/L, 30 μmol/L, 100 μmol/L) of 5-HT2B receptors antagonist RS-127445 into the Re of NMD mice, respectively, and examined the colorectal visceral pain threshold of the mice at different time course (0.25 h, 1 h, 2 h, 4 h, 6 h, 8 h). Doses of 3 μmol/L and 10 μmol/L exerted analgesic effects 1 h to 6 h after administration, and 30 μmol/L and 100 μmol/L exerted analgesic effects 0.25 h to 6 h after administration (Fig. 5A). Therefore, a dose of 30 μmol/L was selected for the following study. Furthermore, we assessed colorectal visceral pain by EMG recording (Fig. 5B). Inhibition of 5-HT2B significantly reduced the AUC of EMG during CRD (Fig. 5C), that is, relieved colorectal visceral pain in NMD mice, indicating 5-HT2B as a molecule accounting for colorectal visceral pain in NMD mice.
In addition, we explored the effect of the 5-HT2B antagonist (RS-127445) on c-Fos expression in NMD mice (Fig. 5D). CRD-induced c-Fos expression was significantly reduced in the group injected with RS-127445 in the Re (Fig. 5E, F). To clarify whether RS-127445 affects synaptic transmission of glutaminergic neurons in the Re, we recorded sEPSC of glutamatergic neurons from Re brain slices before and after incubation with RS-127445 by whole-cell patch clamp technique (Fig. 5G, H). The sEPSC frequency of glutamatergic neurons in Re of NMD mice was significantly reduced after incubation with RS-127445 (Fig. 5I), but the amplitude did not change (Fig. 5K), suggesting that the 5-HT2B receptors contributed to visceral hyperalgesia in NMD mice (Fig. 6).
Fig. 6.
Schematic model of 5-HT2B receptors-mediated colorectal visceral pain in Re glutamatergic neurons. A Schematic of the NMD Mouse Model Establishment Method. B Compared to CON mice, CRD induces increased firing of Re glutamatergic neurons in NMD mice, along with higher levels of 5-HT release, increased expression of 5-HT2B receptors, and enhanced visceral pain responses in NMD mice.
Discussion
Colorectal visceral pain is one of the most common symptoms of gastrointestinal diseases. One of the possible causes of colorectal visceral pain is the excessive excitation of central neurons that receive synaptic input from visceral organs, resulting in aberrant downward modulation of pain transmission. Current treatments for patients with colorectal visceral pain, such as IBS, are far from satisfactory [33], and the precise mechanism behind the central nervous system's regulation of colorectal visceral pain remains to be elucidated. Experiences of trauma and neglect early in life permanently affect the function of the hypothalamic axis and are closely associated with colorectal visceral pain [34–40]. Therefore, we used the male NMD model to simulate human visceral pain and study the neural mechanism of colorectal visceral pain. The reason for not selecting female mice in the present study is that the secretion of estrogen in female mice may influence the perception of pain [41–43]. There are some studies indicating that the pain sensation in male and female mice may be regulated by different neurotransmitter systems, potentially necessitating distinct pharmacological approaches to treat pain in both sexes [44]. The regulation of pain by 5-HT receptors may exhibit gender differences [43], as reports indicate that the impact of serotonin neurotransmitters on pain in male mice is greater than in females [44]. Moreover, in a mouse model of acute thermal nociception, inhibiting 5-HT2A receptors enhanced the potency of opioid drugs in male mice but not in females [45]. Examples like these lead us to speculate that the role of 5-HT2B in Re may differ between male and female mice.
Previous studies have shown that the Re is related to pain, including participating in the analgesic effect of ketoprofen and opioid receptor 1 [46, 47], and it has been proved that the spinal cord is closely involved in the input and processing of pain. Typically, the thalamus serves as the first relay station for spinal cord input through the spinothalamic tract. Re nucleus is an integral component of the thalamus [48], suggesting that Re plays a very important role in pain. Re is associated with nociceptive perception and has also been shown to be activated in pain fMRI studies [47]. Our results showed that activation of Re neurons contributed to colorectal visceral pain in NMD mice. In our study, CRD induced a massive activation of glutamatergic neurons in Re leading to nociceptive hypersensitivity in NMD mice. Since not all of the Re glutaminergic neurons were activated after CRD stimulation, it is difficult to exclude the effect on behavior after other excitatory neurons are activated or inhibited in the optogenetic experiments. In this study, the majority of glutamatergic neurons in the Re activated by CRD stimulation were associated with visceral pain. The approximately 20% of glutamatergic neurons that remained unactivated may not participate in regulating visceral pain. Thus, even modulating this 20% of unactivated glutamatergic neurons may not affect our results. Admittedly, the reviewer raised an interesting question that deserves further exploration in future studies. In addition, electrophysiological results revealed that the excitability and synaptic transmission in the Re neurons were significantly higher than that in CON mice, which also indicated that Re was involved in colorectal visceral pain in NMD mice. Previous studies in our laboratory have proved that brain nuclei such as ACC, IC, and BLA are involved in colorectal visceral pain in NMD [23, 30, 31]. Future studies should investigate the connections between these brain regions and the Re to provide potential new targets for treating colorectal visceral pain.
5-HT, a monoamine neurotransmitter, has an important modulatory role in pain perception. We found a significant increase in 5-HT neurotransmission in Re during CRD. The 5-HT receptor is essential for chronic pain in the CNS [49, 50]. In fact, studies have proved that the 5-HT2B receptor is involved in the central and peripheral regulation of colorectal visceral pain [51–53], but relevant studies are limited to the pharmacological level. It is not completely understood whether the level of 5-HT2B receptor expression in the brain changes in NMD or how it regulates colorectal visceral pain. In this study, we confirmed that mRNA levels and protein levels of 5-HT2B receptors were significantly increased in glutamatergic neurons in the Re. Next, inhibition of 5-HT2B in Re not only reduced the expression of c-Fos but also alleviated colorectal visceral pain. Also, inhibition of 5-HT2B in isolated brain slices decreased synaptic transmission frequency in Re. The specific mechanism underlying this result remains unclear. It is possible that there may be a form of indirect regulation. In a recently published study, the postsynaptic glutamate receptor mGlu5 affected presynaptic glutamate release and sEPSC frequency but not sEPSC amplitude by targeting mir-501-3p, a microRNA that regulates the release of presynaptic glutamate [54]. Therefore, we speculate that the postsynaptic 5-HT2B receptors may modulate sEPSC frequency by indirectly regulating the release of presynaptic 5-HT in our study. These data suggest that NMD induces upregulation of 5-HT2B receptors in glutamatergic neurons in the Re, increasing synaptic transmission frequency and, ultimately visceral hypersensitivity in NMD mice.
In conclusion, our study demonstrated that up-regulation of 5-HT2B receptor expression on the Re glutamatergic neurons mediates colorectal visceral pain in NMD mice. The study elucidated, for the first time, the involvement of the Re glutamatergic neurons in colorectal visceral pain and updated the role of brain 5-HT2B receptors in colorectal visceral pain. The 5-HT2B receptor antagonist RS-127445 has a relieving effect on early-life stress-induced visceral hypersensitivity, which would provide new strategies for targeting Re as well as 5-HT2B receptors for the treatment of colorectal visceral pain.
Acknowledgements
This work was supported by grants from the National Natural Science Foundation of China (81920108016 and 32230041), the Priority Academic Program Development of Jiangsu Higher Education Institutions of China, and the Chinese Red Cross Foundation National Brain Nutrition Research Fund. In addition, we would like to thank Dr. Yang Yu for helping to edit the manuscript.
Conflict of interest
The authors declare no conflicts of interest.
Footnotes
Di Li, Han Du and Shu-Ting Qu contributed equally to this work.
Contributor Information
Qian Wang, Email: q_wang0302@suda.edu.cn.
Guang-Yin Xu, Email: guangyinxu@suda.edu.cn.
References
- 1.Cassar GE, Youssef GJ, Knowles S, Moulding R, Austin DW. Health-related quality of life in irritable bowel syndrome: A systematic review and meta-analysis. Gastroenterol Nurs 2020, 43: E102–E122. [DOI] [PubMed] [Google Scholar]
- 2.Price DD, Zhou Q, Moshiree B, Robinson ME, Verne GN. Peripheral and central contributions to hyperalgesia in irritable bowel syndrome. J Pain 2006, 7: 529–535. [DOI] [PubMed] [Google Scholar]
- 3.Lv MD, Wei YX, Chen JP, Cao MY, Wang QL, Hu S. Melatonin attenuated chronic visceral pain by reducing Nav1.8 expression and nociceptive neuronal sensitization. Mol Pain 2023, 19: 17448069231170072. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Romeo RD, Mueller A, Sisti HM, Ogawa S, McEwen BS, Brake WG. Anxiety and fear behaviors in adult male and female C57BL/6 mice are modulated by maternal separation. Horm Behav 2003, 43: 561–567. [DOI] [PubMed] [Google Scholar]
- 5.Millstein RA, Holmes A. Effects of repeated maternal separation on anxiety- and depression-related phenotypes in different mouse strains. Neurosci Biobehav Rev 2007, 31: 3–17. [DOI] [PubMed] [Google Scholar]
- 6.Hu S, Sun Q, Du WJ, Song J, Li X, Zhang PA. Adult stress promotes purinergic signaling to induce visceral pain in rats with neonatal maternal deprivation. Neurosci Bull 2020, 36: 1271–1280. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Dos Santos Júnior ED, Da Silva AV, Da Silva KRT, Haemmerle CAS, Batagello DS, Da Silva JM, et al. The centrally projecting Edinger-Westphal nucleus—I: Efferents in the rat brain. J Chem Neuroanat 2015, 68: 22–38. [DOI] [PubMed] [Google Scholar]
- 8.Ramanathan KR, Jin J, Giustino TF, Payne MR, Maren S. Prefrontal projections to the thalamic nucleus reuniens mediate fear extinction. Nat Commun 2018, 9: 4527. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Kafetzopoulos V, Kokras N, Sotiropoulos I, Oliveira JF, Leite-Almeida H, Vasalou A, et al. The nucleus reuniens: A key node in the neurocircuitry of stress and depression. Mol Psychiatry 2018, 23: 579–586. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Bushnell MC, Ceko M, Low LA. Cognitive and emotional control of pain and its disruption in chronic pain. Nat Rev Neurosci 2013, 14: 502–511. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Xiao X, Ding M, Zhang YQ. Role of the anterior cingulate cortex in translational pain research. Neurosci Bull 2021, 37: 405–422. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Krout KE, Belzer RE, Loewy AD. Brainstem projections to midline and intralaminar thalamic nuclei of the rat. J Comp Neurol 2002, 448: 53–101. [DOI] [PubMed] [Google Scholar]
- 13.Vertes RP, Linley SB, Hoover WB. Pattern of distribution of serotonergic fibers to the thalamus of the rat. Brain Struct Funct 2010, 215: 1–28. [DOI] [PubMed] [Google Scholar]
- 14.Hoover WB, Vertes RP. Anatomical analysis of afferent projections to the medial prefrontal cortex in the rat. Brain Struct Funct 2007, 212: 149–179. [DOI] [PubMed] [Google Scholar]
- 15.Scheel N, Wulff P, de Mooij-van Malsen JG. Afferent connections of the thalamic nucleus reuniens in the mouse. J Comp Neurol 2020, 528: 1189–1202. [DOI] [PubMed] [Google Scholar]
- 16.Zhou W, Jin Y, Meng Q, Zhu X, Bai T, Tian Y, et al. A neural circuit for comorbid depressive symptoms in chronic pain. Nat Neurosci 2019, 22: 1649–1658. [DOI] [PubMed] [Google Scholar]
- 17.Hao S, Shi W, Liu W, Chen QY, Zhuo M. Multiple modulatory roles of serotonin in chronic pain and injury-related anxiety. Front Synaptic Neurosci 2023, 15: 1122381. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Sharp T, Barnes NM. Central 5-HT receptors and their function; present and future. Neuropharmacology 2020, 177: 108155. [DOI] [PubMed] [Google Scholar]
- 19.Lambe EK, Aghajanian GK. Electrophysiology of 5-HT2A receptors and relevance for hallucinogen and atypical antipsychotic drug actions. Serotonin Recept 2006, 403-417.
- 20.Marek GJ (2010) Electrophysiology of serotonin receptors. Handbook of Behavioral Neuroscience, Elsevier, Amsterdam, pp 163–182. [Google Scholar]
- 21.Aira Z, Buesa I, García Del Caño G, Bilbao J, Doñate F, Zimmermann M, et al. Transient, 5-HT2B receptor-mediated facilitation in neuropathic pain: Up-regulation of PKCγ and engagement of the NMDA receptor in dorsal horn neurons. Pain 2013, 154: 1865–1877. [DOI] [PubMed] [Google Scholar]
- 22.Borman RA, Burleigh DE. 5-HT1D and 5-HT2B receptors mediate contraction of smooth muscle in human small intestine. Ann N Y Acad Sci 1997, 812: 222–223. [DOI] [PubMed] [Google Scholar]
- 23.Xu QY, Zhang HL, Du H, Li YC, Ji FH, Li R, et al. Identification of a glutamatergic claustrum-anterior cingulate cortex circuit for visceral pain processing. J Neurosci 2022, 42: 8154–8168. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Li YC, Wang Q, Li MG, Hu SF, Xu GY. A paraventricular hypothalamic nucleus input to ventral of lateral septal nucleus controls chronic visceral pain. Pain 2023, 164: 625–637. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Wang HJ, Xu X, Zhang PA, Li M, Zhou YL, Xu YC, et al. Epigenetic upregulation of acid-sensing ion channel 1 contributes to gastric hypersensitivity in adult offspring rats with prenatal maternal stress. Pain 2020, 161: 989–1004. [DOI] [PubMed] [Google Scholar]
- 26.Wu YY, Zhang HL, Lu X, Du H, Li YC, Zhang PA, et al. Targeting GATA1 and p2x7r locus binding in spinal astrocytes suppresses chronic visceral pain by promoting DNA demethylation. Neurosci Bull 2022, 38: 359–372. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Huang ST, Chen BB, Song ZJ, Tang HL, Hua R, Zhang YM. Unraveling the role of Epac1-SOCS3 signaling in the development of neonatal-CRD-induced visceral hypersensitivity in rats. CNS Neurosci Ther 2022, 28: 1393–1408. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Wang D, Wang X, Liu P, Jing S, Du H, Zhang L, et al. Serotonergic afferents from the dorsal raphe decrease the excitability of pyramidal neurons in the anterior piriform cortex. Proc Natl Acad Sci U S A 2020, 117: 3239–3247. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Li X, Xu YC, Tian YQ, Zhang PA, Hu SF, Wang LH, et al. Downregulation of GRK6 in arcuate nucleus promotes chronic visceral hypersensitivity via NF-κB upregulation in adult rats with neonatal maternal deprivation. Mol Pain 2020, 16: 1744806920930858. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Zhang PA, Zhu HY, Xu QY, Du WJ, Hu S, Xu GY. Sensitization of P2X3 receptors in insular cortex contributes to visceral pain of adult rats with neonatal maternal deprivation. Mol Pain 2018, 14: 1744806918764731. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Zhang PA, Xu QY, Xue L, Zheng H, Yan J, Xiao Y, et al. Neonatal maternal deprivation enhances presynaptic P2X7 receptor transmission in insular cortex in an adult rat model of visceral hypersensitivity. CNS Neurosci Ther 2017, 23: 145–154. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Xiao Y, Chen X, Zhang PA, Xu Q, Zheng H, Xu GY. TRPV1-mediated presynaptic transmission in basolateral amygdala contributes to visceral hypersensitivity in adult rats with neonatal maternal deprivation. Sci Rep 2016, 6: 29026. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Paine P. Review article: Current and future treatment approaches for pain in IBS. Aliment Pharmacol Ther 2021, 54: S75–S88. [DOI] [PubMed] [Google Scholar]
- 34.Videlock EJ, Adeyemo M, Licudine A, Hirano M, Ohning G, Mayer M, et al. Childhood trauma is associated with hypothalamic-pituitary-adrenal axis responsiveness in irritable bowel syndrome. Gastroenterology 2009, 137: 1954–1962. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Anand KJ. Clinical importance of pain and stress in preterm neonates. Biol Neonate 1998, 73: 1–9. [DOI] [PubMed] [Google Scholar]
- 36.Heim C, Ehlert U, Hanker JP, Hellhammer DH. Abuse-related posttraumatic stress disorder and alterations of the hypothalamic-pituitary-adrenal axis in women with chronic pelvic pain. Psychosom Med 1998, 60: 309–318. [DOI] [PubMed] [Google Scholar]
- 37.Heim C, Newport DJ, Bonsall R, Miller AH, Nemeroff CB. Altered pituitary-adrenal axis responses to provocative challenge tests in adult survivors of childhood abuse. Am J Psychiatry 2001, 158: 575–581. [DOI] [PubMed] [Google Scholar]
- 38.Rao U, Hammen C, Ortiz LR, Chen LA, Poland RE. Effects of early and recent adverse experiences on adrenal response to psychosocial stress in depressed adolescents. Biol Psychiatry 2008, 64: 521–526. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Tyrka AR, Wier L, Price LH, Ross N, Anderson GM, Wilkinson CW, et al. Childhood parental loss and adult hypothalamic-pituitary-adrenal function. Biol Psychiatry 2008, 63: 1147–1154. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Mayson BE, Teichman JMH. The relationship between sexual abuse and interstitial cystitis/painful bladder syndrome. Curr Urol Rep 2009, 10: 441–447. [DOI] [PubMed] [Google Scholar]
- 41.Amandusson Å, Blomqvist A. Estrogenic influences in pain processing. Front Neuroendocrinol 2013, 34: 329–349. [DOI] [PubMed] [Google Scholar]
- 42.Sun LH, Zhang WX, Xu Q, Wu H, Jiao CC, Chen XZ. Estrogen modulation of visceral pain. J Zhejiang Univ Sci B 2019, 20: 628–636. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Paredes S, Cantillo S, Candido KD, Knezevic NN. An association of serotonin with pain disorders and its modulation by estrogens. Int J Mol Sci 2019, 20: 5729. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Mifflin KA, Benson C, Thorburn KC, Baker GB, Kerr BJ. Manipulation of neurotransmitter levels has differential effects on formalin-evoked nociceptive behavior in male and female mice. J Pain 2016, 17: 483–498. [DOI] [PubMed] [Google Scholar]
- 45.Sierra S, Muchhala KH, Jessup DK, Contreras KM, Shah UH, Stevens DL, et al. Sex-specific role for serotonin 5-HT2A receptor in modulation of opioid-induced antinociception and reward in mice. Neuropharmacology 2022, 209: 108988. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.de Beaurepaire R, Suaudeau C, Chait A, Cimetière C. Anatomical mapping of brain sites involved in the antinociceptive effects of ketoprofen. Brain Res 1990, 536: 201–206. [DOI] [PubMed] [Google Scholar]
- 47.Florin S, Meunier JC, Costentin J. Autoradiographic localization of[3H]nociceptin binding sites in the rat brain. Brain Res 2000, 880: 11–16. [DOI] [PubMed] [Google Scholar]
- 48.Craig AD. Distribution of trigeminothalamic and spinothalamic lamina I terminations in the cat. Somatosens Mot Res 2003, 20: 209–222. [DOI] [PubMed] [Google Scholar]
- 49.Anand P, Aziz Q, Willert R, van Oudenhove L. Peripheral and central mechanisms of visceral sensitization in man. Neurogastroenterol Motil 2007, 19: 29–46. [DOI] [PubMed] [Google Scholar]
- 50.Su J, Tanaka Y, Muratsubaki T, Kano M, Kanazawa M, Fukudo S. Injection of corticotropin-releasing hormone into the amygdala aggravates visceral nociception and induces noradrenaline release in rats. Neurogastroenterol Motil 2015, 27: 30–39. [DOI] [PubMed] [Google Scholar]
- 51.Pineda-Farias JB, Velázquez-Lagunas I, Barragán-Iglesias P, Cervantes-Durán C, Granados-Soto V. 5-HT2B receptor antagonists reduce nerve injury-induced tactile allodynia and expression of 5-HT2B receptors. Drug Dev Res 2015, 76: 31–39. [DOI] [PubMed] [Google Scholar]
- 52.Urtikova N, Berson N, Van Steenwinckel J, Doly S, Truchetto J, Maroteaux L, et al. Antinociceptive effect of peripheral serotonin 5-HT2B receptor activation on neuropathic pain. Pain 2012, 153: 1320–1331. [DOI] [PubMed] [Google Scholar]
- 53.Segelcke D, Messlinger K. Putative role of 5-HT2B receptors in migraine pathophysiology. Cephalalgia 2017, 37: 365–371. [DOI] [PubMed] [Google Scholar]
- 54.Liang W, Hou Y, Huang W, Wang Y, Jiang T, Huang X, et al. Loss of schizophrenia-related miR-501-3p in mice impairs sociability and memory by enhancing mGluR5-mediated glutamatergic transmission. Sci Adv 2022, 8: eabn7357. [DOI] [PMC free article] [PubMed] [Google Scholar]