Abstract
Chlorogenic acid (CGA) is a polyphenol substance contained in many plants, which has good antioxidant activity. This experiment aimed to explore the protective effects of CGA on hydrogen peroxide (H2O2)-induced inflammatory response, apoptosis, and antioxidant capacity of bovine intestinal epithelial cells (BIECs-21) under oxidative stress and its mechanism. The results showed that compared with cells treated with H2O2 alone, CGA pretreatment could improve the viability of BIECs-21. Importantly, Chlorogenic acid pretreatment significantly reduced the formation of malondialdehyde (MDA), lowered reactive oxygen species (ROS) levels, and enhanced the activities of superoxide dismutase (SOD) and glutathione peroxidase (GSH-PX) (P<0.05). In addition, CGA can also improve the intestinal barrier by increasing the abundance of tight junction proteins claudin-1 and occludin. Meanwhile, CGA can reduce the gene expression levels of pro-inflammatory factors Interleukin-6 (IL-6) and Interleukin-8 (IL-8), increase the expression of anti-inflammatory factor Interleukin-10 (IL-10), promote the expression of the nuclear factor-related factor 2 (Nrf2) signaling pathway, enhance cell antioxidant capacity, and inhibit Nuclear Factor Kappa B (NF-κB) the activation of the signaling pathway reducing the inflammatory response, thereby alleviating inflammation and oxidative stress damage.
Keywords: antioxidant, cell, chlorogenic acid, inflammation, oxidative stress
Oxidative stress (OS) refers to the disruption in the equilibrium between the production of reactive oxygen species (ROS) and the defense mechanisms provided by antioxidants [44]. This imbalance is commonly associated with abnormal elevations in the levels of free radicals within the body [48]. ROS, being the primary free radicals found in the body [8], can initiate a cascade of chemical reactions, including the destruction of hydrogen bonds, aggregation of biological proteins, impairment of mitochondrial function, and lipid peroxidation [1, 23]. These reactions are related Furthermore, ROS also activate various signaling pathways associated with OS [54], which directly contribute to tissue damage and the onset of diseases [31]. In practical production settings, such as intensive farming environments, inadequate transportation, and unscientific feeding management, oxidative harm to animals can occur, posing a substantial risk to animal production and health [34].
The intestinal epithelium serves as the primary location for nutrient absorption and acts as the initial physical defense against foreign substances and pathogenic microorganisms [3]. The intestinal epithelium is comprised predominantly of intestinal epithelial cells, which serve as both a physical barrier against external substances and a key mediator in preventing mucosal oxidative stress and inflammatory reactions, which play a crucial role in various physiological functions [52]. It is important to highlight that intestinal epithelial cells are particularly vulnerable to the detrimental impacts of oxidative stress. Given the inherent nature of the intestinal epithelium, it is constantly exposed to exogenous pathogens, including harmful pathogenic microorganisms [5]. Once stimulated by pathogens, intestinal epithelial cells initiate a cascade of responses, culminating in an elevation of ROS levels [41]. The excessive generation of ROS can induce oxidative harm to intestinal epithelial cells, augment intestinal permeability [45], compromise the integrity of intestinal epithelial cells, and result in intestinal epithelial dysfunction. Consequently, this will adversely impact animal digestion and absorption, growth and development, and resistance to pathogen invasion, concomitant with a decline in the body’s immune system [2]. Hence, preserving the integrity of intestinal epithelial cells is crucial for maintaining optimal physiological functions and overall health.
Traditional Chinese medicine has been utilized for an extensive duration, exhibiting a diverse array of applications, minimal toxicity, and restricted occurrence of unfavorable reactions. In contemporary times, there has been a growing fascination with the advantageous attributes of botanical plants and herbs. Within this realm, polyphenols have garnered considerable attention owing to their antioxidative properties [19]. Chlorogenic Acid (CGA) is the most abundant polyphenolic compound found in nature, and is ubiquitously present in coffee, apple, blueberry, and eggplant, among other foods [12, 29, 39, 47]. Several studies have demonstrated that CGA is antioxidant, anti-inflammatory, immune-stimulating, and antibacterial [7]. These effects have been shown to positively impact growth performance, immunity, and intestinal barrier function [9]. Additionally, studies have demonstrated that pretreatment with CGA can improve the activities of antioxidant enzymes superoxide dismutase (SOD) and glutathione peroxidase (GSH-PX), thereby reducing H2O2-induced intestinal damage in mice [53]. CGA effectively mitigates oxidative damage by inhibiting the production of free radicals and promoting the activity of antioxidant enzymes. Consequently, broilers’ production performance and meat quality are improved, reducing oxidative damage [50]. Furthermore, Pan’s study reveals that administering CGA through in-ovo feeding can alleviate heat stress-induced oxidative damage in the intestinal tissue of broilers by enhancing their antioxidant defense capacity [29]. Multiple studies have confirmed that CGA enhances the activity of antioxidant enzymes and inhibits the production of intestinal inflammatory cytokines. Moreover, mouse studies have shown that CGA decreases H2O2-induced oxidative stress [36].
In this study, we established a cellular oxidative stress model using H2O2, and conducted an investigation on the impact of CGA on oxidative damage induced by H2O2 in bovine intestinal epithelial cells [35]. The findings of this study will contribute to the advancement of CGA as a potential therapeutic agent for mitigating various injuries or diseases caused by oxidative stress.
MATERIALS AND METHODS
Reagents
Chlorogenic acid (purity ≥98%) was purchased from Changsha Staherb Natural Ingredients Co., Ltd. Fetal bovine serum (FBS) was purchased from Cegrogen Biotech Gmbh (Cegrogen Biotech Gmbh, Ebsdorfergrund, Germany). Dulbecco’s Modified Eagle Medium (DMEM) and 0.25% trypsin were purchased from Servicebio (Servicebio Chemical, Wuhan, China).
Cell culture
The experiment used bovine intestinal epithelial cells from a stable cell line Bovine intestinal epithelial cells (BIECs-21) established and preserved in our laboratory (the China General Microbiological Culture Collection Center; CCMCC No. 45029), cultured in DMEM medium containing 10% fetal bovine serum and 1% penicillin-streptomycin, and maintained at 37°C with a 5% CO2 atmosphere. Cells were processed as follows: Control group (CON), CGA group (CGA), H2O2 group (H2O2), and CGA+H2O2 group (CGA+H2O2). Specifically, control cells were cultivated in DMEM containing 10% FBS (CON). H2O2 was administered alone to cells in the H2O2 treatment group (H2O2), while cells in the CGA treatment group were subjected to the ideal CGA concentration (CGA). The CGA+H2O2 treatment group (CGA+H2O2) treated cells with optimum concentrations of CGA and H2O2 together.
Oxidative stress and CGA treatment
BIECs-21 were cultured in 96-well plates for CGA or H2O2 treatment. To establish an in vitro oxidative stress model, BIECs-21 were treated with H2O2. The cytotoxicity of H2O2 was evaluated using the Cell Counting Kit-8 (CCK-8) assay (Solarbio, Beijing, China). In 96-well culture plates, BIECs-21 were plated at 1 × 104 cells per well, and 100 μL of complete culture medium was added to the culture overnight. Having treated cells with H2O2 at final concentrations of 0, 200, 400, 600, 800, and 1,000 μM for 4 hr, incubated cells with CCK-8 working solution for 4 hr at 37°C. The microplate reader (Thermo Fisher Science Inc., Waltham, MA, USA) was used to measure the absorbance at 450 nm. Based on the 60% inhibitory concentration, we calculated the optimal H2O2 concentration for screening oxidative stress in BIECs-21. Cells were pretreated with 0, 5, 10, 15, 20, and 25 µg/mL CGA for 12 hr after reaching 80% confluence in 96-well plates. CCK-8 solution was used to incubate cells, and 450 nm absorbance was measured with a microplate reader to determine viability. Viability (%)=[(A sample–A blank) / (A control−A blank)] ×100%.
Determination of SOD, GSH-PX, MDA and ROS
Measurement of intracellular oxidation status was quantified using commercially available detection kits (Nanjing Jiancheng, Nanjing, China) for SOD, glutathione peroxidase (GSH-PX), and malondialdehyde (MDA). Intracellular ROS levels were detected using Reactive Oxygen Species Assay Kit (Solarbio). Following experimental treatment, measure the content of antioxidant enzymes in cells as directed by the reagent kit’s instructions. Subsequently, samples were collected and the intracellular levels of antioxidant-related enzymes were determined using a Microplate reader.
RNA extraction and QPCR
BIECs-21 were inoculated in 6-well plates (2 mL/well) at 2 × 105 cells/mL per well and adhered for 24 hr. After four treatments (CON, H2O2, CGA, CGA+H2O2), following the manufacturer’s instructions, Total RNA was extracted from the cells using the Trizol reagent (Solarbio). The purity and concentration of all RNA samples were assessed using a Nanodrop ND-2000 spectrophotometer (Thermo Fisher Scientific), at 260 and 280 nm. A 1% agarose gel was used to verify the integrity of total RNA. RNA was converted into complementary DNA (cDNA) by utilizing the HiScript III RT SuperMix 100 for qPCR (+gDNA wiper) kit from (Vazyme, Nanjing, China). PerfectStart Green qPCR SuperMix (TransGen Biotech, Beijing, China) was utilized to detect the expression levels of genes. The PCR conditions were as follows: 94°C for 30 sec, followed by 45 cycles of 94°C for 5 sec, 60°C for 15 sec, and 72°C for 10 sec, with a final hold at 4°C. The housekeeping gene, β-actin gene was employed to standardize the expression of target genes. Table 1 contains the primer sequences and corresponding product sizes of the PCR. The relative expression was determined using the comparative cycle threshold (2−∆∆Ct) method.
Table 1. Primer sequences and amplicon sizes for qRT-PCR.
| Gene | Accession number | Primer sequence (5´→3´) | Lengh (bp) |
|---|---|---|---|
| Nrf2 | NM-001011678.2 | F: AGCCTCAAAGCACCGTCC | 87 |
| R: ATCAAATCCATGTCCTGCTGGG | |||
| SOD1 | NM-174615.2 | F: CACCATCCACTTCGAGGCAA | 126 |
| R: GCACTGGTACAGCCTTGTGT | |||
| NQO1 | NM-001034535.1 | F: CTCTGGCCAATTCAGAGTGG | 87 |
| R: GGGAGTGTGCCCAATGCTAT | |||
| HO-1 | NM-001014912.1 | F: ATCGACCCCACACCTACACA | 189 |
| R: GACGCCATCACCAGCTTAAAAC | |||
| Claudin-1 | NM-001001854.2 | F: TGCCTTGATGGTGATTGG | 93 |
| R: TTCTGTGCCTCGTCGTCTTC | |||
| Occludin | NM-001082433 | F: TATGGAACCTTAATGGGAGC | 221 |
| R: GATATGCCTGACCTTACAACG | |||
| NF-κB | BC-133594.1 | F: GAGGACATTCAGAGGGCAGG | 192 |
| R: CGGCTTTGATGGGTCATCCT | |||
| IL-6 | NM-173923.2 | F: TTCACAAGCGCCTTCACTCC | 165 |
| R: GCGCTTAATGAGAGCTTCGG | |||
| IL-8 | JN-559767.1 | F: CGAGGTCTGCTTAAACCC | 197 |
| R: CCCACACAGTACATGAGGC | |||
| IL-10 | NM-174088.1 | F: TGCCACAGGCTGAGAAC | 134 |
| R: CACCGCCTTGCTCTTGT | |||
| Bax | NM-173894.1 | F: GGCCCTTTTGCTTCAGGGT | 181 |
| R: CACAGCTGCGATCATCCTCT | |||
| Bcl-2 | NM-001166486.1 | F: TGGCCTTCTTTGAGTTCGGAG | 164 |
| R: ATACAGCTCCACAAAGGCGTC | |||
| Cas-9 | NM-001205504.2 | F: AGAGACTCGAGGGAGTCAGG | 127 |
| R: CGGCTTTGATGGGTCATCC | |||
| Cas-3 | XM-019953295.1 | F: AGTCAGTCAGTTGGGCACTC | 146 |
| R: CACACCCGTAGCTGTGAAGA | |||
| β-actin | NM-173979.3 | F: CCGCAACCAGTTCGCCAT | 216 |
| R: AGGGTCAGGATGCCTCTCTT |
Apoptosis assay with Annexin V-FITC/PI by a fluorescence microscope
Cellular apoptosis was assessed by using fluorescein isothiocyanate (FITC) conjugated Annexin V with propidium iodide (PI) staining assay according to the manufacturer’s instructions. Cellular apoptosis was assessed using the fluorescein isothiocyanate conjugated Annexin V and propidium iodide staining assay, as instructed by the manufacturer. BIECs-21 cells (1 × 105cells/well) were seeded in 6-well plates for 24 hr. Then cells were pretreated with or without CGA for 12 hr, and subsequently treated with or without H2O2 (400 μM) for another 4 hr. Apoptosis was detected by a fluorescence microscope (Olympus, Tokyo, Japan), using an Annexin V- FITC/PI Apoptosis Kit (TransGen Biotech).
Statistical analysis
The data are given as mean ± standard deviation. Differences between groups were evaluated by IBM SPSS 19.0 software and the results were visualized with GraphPad Prism 8.0. Multiple comparisons were performed using single-factor ANOVA followed by least significant difference (LSD) and Duncan’s multiple range test. Statistical significance was defined as P<0.05.
RESULTS
Effect of different concentrations of CGA or H2O2 on the viability of BIECs-21
To explore the optimal concentration of CGA or H2O2 for the growth of BIECs-21, different concentrations of CGA or H2O2 were used in the experiment. As shown in Fig. 1A, the concentration of CGA is 10 µg/mL, cell activity significantly increased, and this concentration was selected for subsequent experiments. Meanwhile, we used different concentrations of H2O2 to treat the cells and screened the appropriate concentration of hydrogen peroxide to establish the cell oxidative damage model. As shown in Fig. 1B, the activity of BIECs-21 cells significantly decreases with increasing H2O2 concentration, reaching 400 μM, the cell activity decreases to about 50%, which can be used to construct an oxidative stress model, and this concentration was chosen for subsequent experiments.
Fig. 1.
Effect of a range of concentrations on the viability of bovine intestinal epithelial cells. Viability was determined by Cell Counting Kit-8 assay after chlorogenic acid or hydrogen peroxide treatment. Data are mean ± SD (n=6), and different letters indicate significant differences (P<0.05).
Effect of different treatment groups on cell viability and morphology of BIECs-21
After treating the cells with or without H2O2, with or without CGA, the morphology of the cells was observed under the microscope and was seen to be H2O2 significantly increased the number of intracellular vacuoles, which was significantly attenuated by CGA pretreatment (Fig. 2A and 2C). CGA pretreatment significantly reduces ROS levels caused by hydrogen peroxide (Fig. 2D and 2E). Furthermore, we tested the effects of different treatments on cell viability in each group, When cells were treated with selected concentrations of CGA (10 μg/mL) and H2O2 (400 μmol/L), the H2O2 group significantly reduced cell activity, and compared to the H2O2 group, the CGA+ H2O2 group significantly increased comparative activity (Fig. 2B).
Fig. 2.
The effect of different treatment groups on the state of bovine intestinal epithelial cells. A: Cell morphology was observed by microscopy. (a, e) The morphology of bovine intestinal epithelial cells (BIECs-21) in the control group (CON); (b, f) The morphology of BIECs-21 in the hydrogen peroxide group (H2O2); (c, g) The morphology of BIECs-21 in the chlorogenic acid group (CGA); (d, h) The morphology of BIECs-21 in the chlorogenic acid and hydrogen peroxide (CGA+H2O2) group; B: Viability was determined by Cell Counting Kit-8 assay after H2O2 treatment; C: Morphometric analysis of intracellular vesicles was performed with 6 different areas of the cytoplasm of cells: D: Intracellular Reactive Oxygen Species (ROS) levels detected by a reagent kit. (a)=CON, (b)=H2O2, (c)=CGA, (d)=CGA+H2O2; E: The ROS levels in BIECs-21 cells with different treatment. BIECs-21 were divided into Con, H2O2, CGA, and CGA+H2O2 groups. CON, control, untreated cells; H2O2, cells are only treated with H2O2; CGA, chlorogenic acid, cells only treated with chlorogenic acid; CGA+H2O2, chlorogenic acid+ hydrogen peroxide, cells were pretreated with chlorogenic acid and then treated with H2O2; Compared with the control group, data are mean ± SD (n=6), and different letters indicate significant differences (P<0.05).
CGA Regulated the Cellular Redox State in H2O2 -Induced BIECs-21
We used oxidation kits and quantitative fluorescence techniques to detect the oxidative status of cells. Firstly, H2O2 attacks the cells, leading to a significant increase in MDA and a decrease in SOD and GSH-PX content; CGA alleviates this situation by decreasing MDA (P<0.05) and increasing SOD (P<0.05) and GSH-PX (P<0.05). (Fig. 3A–C). To more accurately determine the antioxidant status of cells, the mRNA expression levels of related antioxidant genes were further tested. Nrf2 mediation is a key regulatory factor for cellular oxidative stress, regulating downstream antioxidant enzymes such as SOD-1 and HO-1. As shown in the Fig. 3D, the mRNA expression level of Nrf2 in the hydrogen peroxide group was significantly reduced. In contrast, the CGA+H2O2 group significantly increased the expression of Nrf2, inhibiting the adverse effect of hydrogen peroxide on cell antioxidant gene expression. The gene expression levels of downstream genes SOD-1, HO-1, and NQO1 were detected, and the results showed that CGA can enhance the expression of antioxidant-related enzymes in BIECs-21 induced by hydrogen peroxide. Experiments have found that CGA can promote the activation of Nrf2 and increase the expression of HO-1, SOD-1and NQO1 (Fig. 3E–G).
Fig. 3.
Effect of chlorogenic acid regulated the cellular redox state in H2O2-induced bovine intestinal epithelial cells. SOD: superoxide dismutase (A); MDA: malondialdehyde (B); GSH-PX: glutathione peroxidase (C); Nrf2: nuclear factor-related factor 2 (D); HO-1: heme oxygenase-1 (E); SOD-1: superoxide dismutase-1 (F); NQO1: NAD (P) H: quinone oxidoreductase 1 (G). CON, control, untreated cells; H2O2, cells are only treated with H2O2; CGA, chlorogenic acid, cells only treated with chlorogenic acid; CGA+H2O2, chlorogenic acid+ hydrogen peroxide, cells were pretreated with CGA and then treated with H2O2; a, b, c Mean values with different letters on vertical bars indicate significant differences (P<0.05). Data are mean ± SD (n=3), and different letters indicate significant differences (P<0.05).
CGA-Regulated Barrier Function in H2O2-Induced BIECs-21
To evaluate the impact of CGA or H2O2 on the permeability of tight junctions, we analyzed the levels of tight junction proteins in BIECs-21. As shown in Fig. 4A and 4B, the findings revealed a significant reduction in the abundance of tight junction proteins and the gene expression of Claudin-1 and Occludin following H2O2 treatment, as compared to the control group (P<0.05). Conversely, compared to the H2O2 group, the CGA pre-treatment group showed increased expression of Occludin (P>0.05) and Claudin-1 (P<0.05).
Fig. 4.
Effect of chlorogenic acid (CGA) on H2O2 induced tight junction proteins in bovine intestinal epithelial cells. (A) The mRNA expression level of claudin-1. (B) The mRNA expression level of occludin. CON, control, untreated cells; H2O2, cells are only treated with H2O2; CGA, chlorogenic acid, cells only treated with chlorogenic acid; CGA+H2O2, chlorogenic acid+ hydrogen peroxide, cells were pretreated with CGA and then treated with H2O2; Data are mean ± SD (n=3), and different letters indicate significant differences (P<0.05).
CGA Alleviated H2O2-Induced Apoptosis in BIECs-21
Apoptosis was examined using Annexin V-FITC/PI Apoptosis Kit, green fluorescence indicated early apoptosis, and red fluorescence indicated mid-late apoptosis, as shown in Fig. 5A–C. Compared with the CON group, in the H2O2 group, there was a significant increase in green fluorescence; and in the CGA+H2O2 group, there was a significant decrease in the amount of green fluorescence. The expression of the apoptosis-associated genes, Caspase-3, Caspase-9, Bcl-2, and Bax, was evaluated by qRT-PCR to further understand the antiapoptotic effect of the CGA. The results showed that hydrogen peroxide significantly increased the expression of pro-apoptotic factors Caspase-9, and Bax, while the expression of antiapoptotic factor Bcl-2 was reduced (P<0.05). Compared with the hydrogen peroxide group, CGA pretreatment significantly reduced the mRNA expression level of pro-apoptotic factors (Fig. 5D–G). These results indicated that CGA pretreatment significantly ameliorated H2O2-induced apoptosis.
Fig. 5.
Effect of chlorogenic acid alleviated H2O2-induced apoptosis in bovine intestinal epithelial cells (BIECs-21). (A) Apoptosis was analyzed with Annexin V-FITC and PI staining, and observed under a fluorescent microscope. Scale bar=50 μm. (B) Statistics of Annexin V-FITC positive cells. (C) Statistics of PI positive cells. Relative mRNA levels of (D) Caspase-3 (Casp3), (E) Caspase-9 (Casp9), (F) Bcl-2 associated X protein (Bax) and (G) B-cell lymphoma-2 (Bcl-2) were detected by qRT-PCR. CON, control, untreated cells; H2O2, cells are only treated with H2O2; CGA, chlorogenic acid, cells only treated with chlorogenic acid; CGA+H2O2, chlorogenic acid+ hydrogen peroxide, cells were pretreated with CGA and then treated with H2O2; Data are mean ± SD (n=3), and different letters indicate significant differences (P<0.05).
CGA Regulated Nuclear Factor Kappa B Signaling Pathways in BIECs-21
To assess the impact of CGA on inflammatory cytokines, we analyzed the relative expression levels of the Nuclear Factor Kappa B (NF-κb) and Interleukin-10 (IL-10) genes, which are associated with inflammatory factors, in BIECs-21. The findings are presented in Fig. 6. In comparison to the control group, the presence of H2O2 increased in the expression of NF-κB and IL-6 (P<0.05), while IL-10 decreased (P>0.05). Conversely, when compared to the H2O2 group, CGA pre-treatment exhibited a downregulating effect on the expression of NF-κB (P>0.05) and an upregulating effect on the level of IL-10 (P<0.05).
Fig. 6.
The effect of chlorogenic acid (CGA) on H2O2-induced inflammatory factors in bovine intestinal epithelial cells (BIECs-21). NF-κB: Nuclear transcription Factor κB (A); IL-6: Interleukin-6 (B); IL-8: Interleukin-8 (C); IL-10: Interleukin-10 (D). CON, control, untreated cells; H2O2, cells are only treated with H2O2; CGA, chlorogenic acid, cells only treated with chlorogenic acid; CGA+H2O2, chlorogenic acid+ hydrogen peroxide, cells were pretreated with CGA and then treated with H2O2; Data are mean ± SD (n=3), and different letters indicate significant differences (P<0.05).
DISCUSSION
In the context of cattle production, multiple factors contribute to the occurrence of oxidative stress, including inadequate delivery care, abrupt weaning, suboptimal feeding environment, unscientific management practices, and aggressive transportation methods, among many others. These factors collectively induce oxidative stress in cattle, thereby compromising the integrity and functionality of their intestinal health. This is particularly critical in calves, as their nutritional requirements are substantial, and the proper digestion and absorption within their intestines are pivotal for facilitating their optimal growth and well-being. The oxidation-induced damage to the intestine can result in an overabundance of free radicals, leading to detrimental effects on intestinal epithelial cells, intestinal integrity, animal immune health production performance, and reproductive breeding, thereby diminishing economic benefits [27]. Consequently, it is crucial to minimize the occurrence of oxidative stress and uphold the integrity and proper functioning of the intestine for the prosperous advancement of animal husbandry.
CGA is a prevalent polyphenol compound found in numerous vegetables and fruits and holds great potential in combating oxidative stress [24]. Numerous studies have demonstrated the favorable antioxidant properties of CGA and its potential to mitigate oxidative stress-induced damage to intestinal epithelial cells [2, 11]. Investigations have suggested that the antioxidant activity of CGA is contingent upon its distinctive chemical structure [16]. Following the donation of hydrogen atoms, CGA undergoes oxidation, promptly reconstituting stable phenoxy groups through resonance, thereby diminishing the presence of free radicals [38]. However, the precise protective effect of CGA on BIECs-21 in oxidative stress environments, along with its underlying mechanism of action, remains unclear. Consequently, this study endeavors to investigate the impact and mechanism of CGA on H2O2-induced oxidative damage in BIECs-21. We used CCK-8 to screen for H2O2 concentrations that significantly impair the activity of BIECs-21, and established an oxidative stress model based on these concentrations. Subsequently, we found that CGA can significantly reduce the damaging effect of H2O2 and reduce intracellular ROS production. To further examine the influence of CGA on the oxidative state of BIECs-21, the levels of antioxidant enzymes in cell lysates were quantified.
It is widely recognized that animals possess diverse antioxidant enzymes capable of mitigating lipid peroxidation, eliminating or diminishing free radicals, safeguarding cellular structural integrity, impeding free radical infiltration, and fortifying disease resistance. Among these enzymes, SOD holds significant importance in mammals as it serves as the primary defense mechanism against oxygen-free radicals [20]. The functions of this enzyme include the clearance of superoxide anion free radicals, their conversion into H2O2, cellular protection against oxidative damage, and significant contributions to the maintenance of normal bodily functions. Another crucial antioxidant enzyme, GSH-PX, plays a role in the elimination of free radicals and the prevention of hydroxyl radical production. Additionally, GSH-PX degrades hydrogen peroxide, which is subsequently converted into water and oxygen by superoxide dismutase [51]. Our experimental findings suggest that CGA pretreatment can effectively enhance SOD activity when compared to the H2O2 group. In addition, it was detected that H2O2 exerted inhibitory effects on the activity of GSH-PX, whereas the CGA+H2O2 group exhibited a significant enhancement in GSH-PX activity. This finding suggests that CGA has the potential to augment the antioxidant damage capability of BIECs-21 by promoting the activity of antioxidant enzymes. MDA content is a direct indicator of cellular lipid peroxidation and can also indirectly indicate cell damage and ROS production. In this experiment, CGA pretreatment effectively decreased the levels of MDA, supporting the antioxidant properties of CGA. This indicates that CGA can enhance the activity of antioxidant enzymes, reduce the production of lipid peroxidation products, and thus enhance the resistance of BIECs-21 cells to H2O2-induced oxidative damage.
To further explore the intrinsic mechanism of the antioxidant effects of CGA, we examined the relative mRNA expression levels of relevant antioxidant genes. Nrf2 is a vital transcription factor responsible for regulating the expression of downstream antioxidant enzymes [10] . HO-1 is an endogenous cytoprotective enzyme that plays a critical role in oxidative stress and inflammation within cells [43]. NQO1 is a protein with multiple protective effects on cells, which can alleviate DNA damage and oxidative damage [4]. It plays a direct antioxidant role by using NADPH or NADH as a hydride donor and reducing the two electrons of a wide range of quinone arrays to corresponding hydroquinone [13]. The administration of CGA resulted in a significant increase in the intracellular abundance of Nrf2, SOD-1, HO-1, and NQO1 induced by H2O2. To summarize, the stimulation of the Nrf2 signaling pathway by CGA induces an upregulation in the mRNA expression of Nrf2, consequently leading to an enhanced expression of antioxidant enzymes downstream. Moreover, the unique molecular structure of CGA may potentially contribute to its capacity to ameliorate oxidative harm in bovine intestinal epithelial cells [9].
Oxidative stress directly or indirectly induces an inflammatory response [49]. NF-κB is a crucial transcription factor responsible for regulating inflammatory factors [40], and exhibits the ability to enhance the expression levels of diverse pro-inflammatory cytokines upon activation. Oxidative stress typically triggers inflammation, thereby exacerbating oxidative damage [26]. CGA inhibits the activation of the NF-κB pathway induced by LTA in bovine mammary epithelial cells, significantly downregulates the expression of TNF-α, IL-6, IL-1β, and can effectively alleviate the damage of inflammatory response to cells [46]. In vitro experiments demonstrated that CGA enhanced the activity of antioxidant enzymes in human lung cancer cells and blocked the activation of NF-κB and mitogen-activated protein kinase [42]. According to in vivo experiments, CGA mitigated LPS-induced breast injury in mice while decreasing TNF-α, IL-6, and IL-1β pro-inflammatory factors [33]. The present experiment established a cellular model of oxidative damage using H2O2. To examine the impact of CGA on the inflammatory response, the activity of pertinent inflammatory factors was assessed. The findings revealed that H2O2 augmented the production of pro-inflammatory factors IL-6 and IL-8, The activity of the anti-inflammatory factor IL-10 is substantially hindered, whereas in the CGA pretreatment group, CGA effectively inhibits pro-inflammatory factors and enhances the activity of anti-inflammatory factors. In the individual CGA group, IL-6 and IL-8 cytokine expression levels were significantly elevated, which may be due to CGA promoting a pre-protective effect of BIECs-21 cells against inflammation, to quickly resist inflammation and maintain normal cell operation at the first moment of inflammation. Tamoxifen induces in rat liver and kidney TNF-β and TNF-α the level increases, while IL-10 decreases, while CGA reduces IL-10 and TNF-α levels and upregulates IL-10 [15]. Palócz’s research findings indicate that CGA has the potential to mitigate inflammatory responses and cellular oxidative damage by reducing IPEC-J2 cells’ inflammasome production of IL-6 and IL-8 [28]. Additionally, other studies have demonstrated that CGA can decrease the production of pro-inflammatory factors, enhance the activity of T-AOC, and alleviate oxidative damage in the duodenum in chicks caused by acute heat stress [6]. These findings suggest that CGA effectively alleviates cellular oxidative damage and mitigates the detrimental effects of hydrogen peroxide on the intestinal epithelium by reducing the release of inflammatory factors [21].
It is widely recognized that the integrity of the intestinal barrier is crucial for maintaining host health [14], while oxidative stress will lead to an abnormal increase of free radicals, damage tissues, and destroy cell integrity [17, 37]. Once the integrity of intestinal epithelial cells is damaged, the permeability of intestinal epithelium will increase, which will increase the risk of pathogenic microorganisms entering, increasing the risk of inflammation, destroying the intestinal dynamic equilibrium, and causing harm to the health of the body [30]. Intestinal epithelial integrity mainly depends on tight junction proteins, including Claudin-1, Occludin, and ZO-1 [25]. Therefore, we evaluated the effect of CGA on intestinal epithelial tight junction proteins under oxidative stress. The findings indicate that the group pretreated with CGA exhibited significant adjustments in the gene expression levels of Claudin-1 and Occludin compared to the oxidative stress group. Ruan et al. demonstrated that CGA administration reduced intestinal permeability induced by lipopolysaccharide in weaned rats and increased the expression of tight junction proteins [32]. These results suggest that CGA has the potential to enhance the expression of tight junction proteins, safeguard the integrity of the intestinal epithelium, and consequently mitigate oxidative damage.
Severe oxidative stress usually induces apoptosis [18, 22]. To further confirm the impact of CGA on apoptosis of BIECs-21 under oxidative stress, we assessed the levels of apoptosis factors in BIECs-21. The findings revealed that under H2O2 induction, the relative expression levels of pro-apoptotic factors Caspase-3, Caspase-9, and Bax mRNA were significantly elevated, after adding CGA, the level of proapoptotic factors showed a decrease. CGA significantly reduced the levels of Caspase-9 and Bax, while increasing the expression of antiapoptotic factor Bcl-2.
This experiment showed that CGA has anti-inflammatory and antioxidant effects, and has some alleviating effects on hydrogen peroxide-induced cellular damage (Fig. 7). This provides some reference for adding CGA to feed to promote healthy animal growth and reduce oxidative damage. However, there may be differences between in vitro and in vivo, and further in vivo experiments are needed to explore the appropriate amount of CGA added to feed.
Fig. 7.
The mechanism of chlorogenic acid (CGA) weakening oxidative stress-induced inflammation and injury in bovine intestinal epithelial cells (by Figdraw).
CONFLICT OF INTEREST
The authors declare no conflict of interest.
Acknowledgments
This research was funded by the National Natural Science Foundation of China (31872537), National Key Research and Development Program of China (2022YFE0111100 and 2017YFE0129900), Program for International S&T Cooperation Projects of Henan (232102521012), the Key Scientific Research Foundation of the Higher Education Institutions of Henan Province (22A230001) and Science Foundation for Expat Scientist Studio for Animal Stress and Health Breeding of Henan Province (Grant Number GZS2021006).
REFERENCES
- 1.Abelaira HM, Veron DC, de Moura AB, Carlessi AS, Borba LA, Botelho MEM, Andrade NM, Martinello NS, Zabot GC, Joaquim L, Biehl E, Bonfante S, Budni J, Petronilho F, Quevedo J, Réus GZ. 2021. Sex differences on the behavior and oxidative stress after ketamine treatment in adult rats subjected to early life stress. Brain Res Bull 172: 129–138. doi: 10.1016/j.brainresbull.2021.04.021 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Awad WA, Hess C, Hess M. 2017. Enteric pathogens and their toxin-induced disruption of the intestinal barrier through alteration of tight junctions in chickens. Toxins (Basel) 9: 60. doi: 10.3390/toxins9020060 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Bhattacharyya A, Chattopadhyay R, Mitra S, Crowe SE. 2014. Oxidative stress: an essential factor in the pathogenesis of gastrointestinal mucosal diseases. Physiol Rev 94: 329–354. doi: 10.1152/physrev.00040.2012 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Cenci A, Macchia I, La Sorsa V, Sbarigia C, Di Donna V, Pietraforte D. 2022. Mechanisms of action of ozone therapy in emerging viral diseases: immunomodulatory effects and therapeutic advantages with reference to SARS-CoV-2. Front Microbiol 13: 871645. doi: 10.3389/fmicb.2022.871645 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Chairatana P, Nolan EM. 2017. Defensins, lectins, mucins, and secretory immunoglobulin A: microbe-binding biomolecules that contribute to mucosal immunity in the human gut. Crit Rev Biochem Mol Biol 52: 45–56. doi: 10.1080/10409238.2016.1243654 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Chen F, Zhang H, Zhao N, Yang X, Du E, Huang S, Guo W, Zhang W, Wei J. 2021. Effect of chlorogenic acid on intestinal inflammation, antioxidant status, and microbial community of young hens challenged with acute heat stress. Anim Sci J 92: e13619. doi: 10.1111/asj.13619 [DOI] [PubMed] [Google Scholar]
- 7.Chen J, Li Y, Yu B, Chen D, Mao X, Zheng P, Luo J, He J. 2018. Dietary chlorogenic acid improves growth performance of weaned pigs through maintaining antioxidant capacity and intestinal digestion and absorption function. J Anim Sci 96: 1108–1118. doi: 10.1093/jas/skx078 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Chen J, Luo Y, Li Y, Chen D, Yu B, He J. 2021. Chlorogenic acid attenuates oxidative stress-induced intestinal epithelium injury by co-regulating the PI3K/Akt and IκBα/NF-κB signaling. Antioxidants 10: 1915. doi: 10.3390/antiox10121915 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Chen J, Yu B, Chen D, Huang Z, Mao X, Zheng P, Yu J, Luo J, He J. 2018. Chlorogenic acid improves intestinal barrier functions by suppressing mucosa inflammation and improving antioxidant capacity in weaned pigs. J Nutr Biochem 59: 84–92. doi: 10.1016/j.jnutbio.2018.06.005 [DOI] [PubMed] [Google Scholar]
- 10.Cheng L, Jin Z, Zhao R, Ren K, Deng C, Yu S. 2015. Resveratrol attenuates inflammation and oxidative stress induced by myocardial ischemia-reperfusion injury: role of Nrf2/ARE pathway. Int J Clin Exp Med 8: 10420–10428. [PMC free article] [PubMed] [Google Scholar]
- 11.Cui K, Wang Q, Wang S, Diao Q, Zhang N. 2019. The facilitating effect of tartary buckwheat flavonoids and lactobacillus plantarum on the growth performance, nutrient digestibility, antioxidant capacity, and fecal microbiota of weaned piglets. Animals (Basel) 9: 986. doi: 10.3390/ani9110986 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.da Silveira TFF, Meinhart AD, de Souza TCL, Cunha ECE, de Moraes MR, Filho JT, Godoy HT. 2017. Optimization of the preparation conditions of yerba mate tea beverage to maximize chlorogenic acids extraction. Plant Foods Hum Nutr 72: 219–223. doi: 10.1007/s11130-017-0613-6 [DOI] [PubMed] [Google Scholar]
- 13.Dinkova-Kostova AT, Talalay P. 2010. NAD(P)H:quinone acceptor oxidoreductase 1 (NQO1), a multifunctional antioxidant enzyme and exceptionally versatile cytoprotector. Arch Biochem Biophys 501: 116–123. doi: 10.1016/j.abb.2010.03.019 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Duttaroy AK. 2021. Role of gut microbiota and their metabolites on atherosclerosis, hypertension and human blood platelet function: a review. Nutrients 13: 144. doi: 10.3390/nu13010144 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.E Owumi S, K Olusola J, O Arunsi U, K Oyelere A. 2021. Chlorogenic acid abates oxido-inflammatory and apoptotic responses in the liver and kidney of Tamoxifen-treated rats. Toxicol Res (Camb) 10: 345–353. doi: 10.1093/toxres/tfab002 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.El-Fadaly AA, Younis IY, Abdelhameed MF, Ahmed YH, Ragab TIM, El Gendy AEG, Farag MA, Elshamy AI, Elgamal AM. 2023. Protective action mechanisms of Launaea mucronata extract and its nano-formulation against nephrotoxicity in rats as revealed via biochemical, histopathological, and UPLC-QTOF-MS/MS analyses. Metabolites 13: 786. doi: 10.3390/metabo13070786 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Ha TS, Park HY, Seong SB, Ahn HY. 2016. Puromycin aminonucleoside increases podocyte permeability by modulating ZO-1 in an oxidative stress-dependent manner. Exp Cell Res 340: 139–149. doi: 10.1016/j.yexcr.2015.12.001 [DOI] [PubMed] [Google Scholar]
- 18.Habotta OA, Wang X, Othman H, Aljali AA, Gewaily M, Dawood M, Khafaga A, Zaineldin AI, Singla RK, Shen B, Ghamry HI, Elhussieny E, El-Mleeh A, Ibrahim SF, Abdeen A. 2022. Selenium-enriched yeast modulates the metal bioaccumulation, oxidant status, and inflammation in copper-stressed broiler chickens. Front Pharmacol 13: 1026199. doi: 10.3389/fphar.2022.1026199 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Kefi BB, Nefzi K, Koumba S, M’Hamdi N, Martin P. 2023. Application of doehlert experimental design for optimization of a new-based hydrophilic interaction solid-phase extraction of phenolic acids from olive oils. Molecules 28: 1073. doi: 10.3390/molecules28031073 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Li N, Wen L, Li T, Yang H, Qiao M, Wang T, Song L, Huang X, Li M, Bukyei E, Wang F. 2022. Alleviating effects of black soybean peptide on oxidative stress injury induced by lead in PC12 cells via Keap1/Nrf2/TXNIP signaling pathway. Nutrients 14: 3102. doi: 10.3390/nu14153102 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Liang N, Kitts DD. 2015. Role of chlorogenic acids in controlling oxidative and inflammatory stress conditions. Nutrients 8: 16. doi: 10.3390/nu8010016 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Liu L, Wu C, Chen D, Yu B, Huang Z, Luo Y, Zheng P, Mao X, Yu J, Luo J, Yan H, He J. 2020. Selenium-enriched yeast alleviates oxidative stress-induced intestinal mucosa disruption in weaned pigs. Oxid Med Cell Longev 2020: 5490743. doi: 10.1155/2020/5490743 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Liu M, Dai Y, Song C, Wang J, Liu Y, Wang Q. 2022. Structural characterization of a pleurotus sajor-caju polysaccharide and its neuroprotection related to the inhibition of oxidative stress. Nutrients 14: 4047. doi: 10.3390/nu14194047 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Lu H, Tian Z, Cui Y, Liu Z, Ma X. 2020. Chlorogenic acid: a comprehensive review of the dietary sources, processing effects, bioavailability, beneficial properties, mechanisms of action, and future directions. Compr Rev Food Sci Food Saf 19: 3130–3158. doi: 10.1111/1541-4337.12620 [DOI] [PubMed] [Google Scholar]
- 25.Meng Y, Zhang L, Li P, Yu J, Mu G, Li X, Tuo Y. 2022. Saccharomyces cerevisiae I4 showed alleviating effects on dextran sulfate sodium-induced colitis of Balb/c mice. Foods 11: 1436. doi: 10.3390/foods11101436 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Oraphruek P, Chusak C, Ngamukote S, Sawaswong V, Chanchaem P, Payungporn S, Suantawee T, Adisakwattana S. 2023. Effect of a multispecies synbiotic supplementation on body composition, antioxidant status, and gut microbiomes in overweight and obese subjects: a randomized, double-blind, placebo-controlled study. Nutrients 15: 1863. doi: 10.3390/nu15081863 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Oz HS, Chen TS, Nagasawa H. 2007. Comparative efficacies of 2 cysteine prodrugs and a glutathione delivery agent in a colitis model. Transl Res 150: 122–129. doi: 10.1016/j.trsl.2006.12.010 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Palócz O, Pászti-Gere E, Gálfi P, Farkas O. 2016. Chlorogenic acid combined with lactobacillus plantarum 2142 reduced LPS-induced intestinal inflammation and oxidative stress in IPEC-J2 cells. PLoS One 11: e0166642. doi: 10.1371/journal.pone.0166642 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Pan Y, Lin H, Jiao H, Zhao J, Wang X. 2023. Effects of in ovo feeding of chlorogenic acid on antioxidant capacity of postnatal broilers. Front Physiol 14: 1091520. doi: 10.3389/fphys.2023.1091520 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Pan Y, Ning Y, Hu J, Wang Z, Chen X, Zhao X. 2021. The preventive effect of Lactobacillus plantarum ZS62 on DSS-induced IBD by regulating oxidative stress and the immune response. Oxid Med Cell Longev 2021: 9416794. doi: 10.1155/2021/9416794 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Patel RS, Ghasemzadeh N, Eapen DJ, Sher S, Arshad S, Ko YA, Veledar E, Samady H, Zafari AM, Sperling L, Vaccarino V, Jones DP, Quyyumi AA. 2016. Novel biomarker of oxidative stress is associated with risk of death in patients with coronary artery disease. Circulation 133: 361–369. doi: 10.1161/CIRCULATIONAHA.115.019790 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Ruan Z, Liu S, Zhou Y, Mi S, Liu G, Wu X, Yao K, Assaad H, Deng Z, Hou Y, Wu G, Yin Y. 2014. Chlorogenic acid decreases intestinal permeability and increases expression of intestinal tight junction proteins in weaned rats challenged with LPS. PLoS One 9: e97815. doi: 10.1371/journal.pone.0097815 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Ruifeng G, Yunhe F, Zhengkai W, Ershun Z, Yimeng L, Minjun Y, Xiaojing S, Zhengtao Y, Naisheng Z. 2014. Chlorogenic acid attenuates lipopolysaccharide-induced mice mastitis by suppressing TLR4-mediated NF-κB signaling pathway. Eur J Pharmacol 729: 54–58. doi: 10.1016/j.ejphar.2014.01.015 [DOI] [PubMed] [Google Scholar]
- 34.Shang R, Chen L, Xin Y, Wang G, Li R, Li S, Li L. 2022. Evaluation of rosmarinic acid on broiler growth performance, serum biochemistry, liver antioxidant activity, and muscle tissue composition. Animals (Basel) 12: 3313. doi: 10.3390/ani12233313 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Shao D, Gao Z, Zhao Y, Fan M, Zhao X, Wei Q, Pan M, Ma B. 2023. Sulforaphane suppresses H2O2-induced oxidative stress and apoptosis via the activation of AMPK/NFE2L2 signaling pathway in goat mammary epithelial cells. Int J Mol Sci 24: 1070. doi: 10.3390/ijms24021070 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Shin HS, Satsu H, Bae MJ, Zhao Z, Ogiwara H, Totsuka M, Shimizu M. 2015. Anti-inflammatory effect of chlorogenic acid on the IL-8 production in Caco-2 cells and the dextran sulphate sodium-induced colitis symptoms in C57BL/6 mice. Food Chem 168: 167–175. doi: 10.1016/j.foodchem.2014.06.100 [DOI] [PubMed] [Google Scholar]
- 37.Su J, Wang Q, Li Z, Feng Y, Li Y, Yang S, Feng Y. 2021. Different metabolites in the roots, seeds, and leaves of acanthopanax senticosus and their role in alleviating oxidative stress. J Anal Methods Chem 2021: 6628880. doi: 10.1155/2021/6628880 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Sun J, Li Q, Li J, Liu J, Xu F. 2022. Nutritional composition and antioxidant properties of the fruit of Berberis heteropoda Schrenk. PLoS One 17: e0262622. doi: 10.1371/journal.pone.0262622 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Suzuki A, Yamamoto N, Jokura H, Yamamoto M, Fujii A, Tokimitsu I, Saito I. 2006. Chlorogenic acid attenuates hypertension and improves endothelial function in spontaneously hypertensive rats. J Hypertens 24: 1065–1073. doi: 10.1097/01.hjh.0000226196.67052.c0 [DOI] [PubMed] [Google Scholar]
- 40.Tang YL, Sim TS, Tan KS. 2022. Oral streptococci subvert the host innate immune response through hydrogen peroxide. Sci Rep 12: 656. doi: 10.1038/s41598-021-04562-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Tangestani Fard M, Stough C. 2019. A review and hypothesized model of the mechanisms that underpin the relationship between inflammation and cognition in the elderly. Front Aging Neurosci 11: 56. doi: 10.3389/fnagi.2019.00056 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Tsai CM, Yen GC, Sun FM, Yang SF, Weng CJ. 2013. Assessment of the anti-invasion potential and mechanism of select cinnamic acid derivatives on human lung adenocarcinoma cells. Mol Pharm 10: 1890–1900. doi: 10.1021/mp3006648 [DOI] [PubMed] [Google Scholar]
- 43.Wang H, Cheng Q, Bao L, Li M, Chang K, Yi X. 2023. Cytoprotective role of heme oxygenase-1 in cancer chemoresistance: focus on antioxidant, antiapoptotic, and pro-autophagy properties. Antioxidants 12: 1217. doi: 10.3390/antiox12061217 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Wang MX, Zhao J, Zhang H, Li K, Niu LZ, Wang YP, Zheng YJ. 2020. Potential protective and therapeutic roles of the Nrf2 pathway in ocular diseases: an update. Oxid Med Cell Longev 2020: 9410952. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Xie J, Tian S, Liu J, Huang S, Yang M, Yang X, Xu R, Lin J, Han L, Zhang D. 2023. Combination therapy with indigo and indirubin for ulcerative colitis via reinforcing intestinal barrier function. Oxid Med Cell Longev 2023: 2894695. doi: 10.1155/2023/2894695 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Xu P, Xu X, Fotina H, Fotina T. 2023. Anti-inflammatory effects of chlorogenic acid from Taraxacum officinale on LTA-stimulated bovine mammary epithelial cells via the TLR2/NF-κB pathway. PLoS One 18: e0282343. doi: 10.1371/journal.pone.0282343 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Yan K, Cui M, Zhao S, Chen X, Tang X. 1563. 2016. Salinity stress is beneficial to the accumulation of chlorogenic acids in honeysuckle (Lonicera japonica Thunb). Front Plant Sci 18: 7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Zhang X, Zhao W, Li B, Li W, Zhang C, Hou X, Jiang J, Dong Y. 2018. Ratiometric fluorescent probes for capturing endogenous hypochlorous acid in the lungs of mice. Chem Sci (Camb) 9: 8207–8212. doi: 10.1039/C8SC03226B [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Zhang Z, Zhang H, Chen R, Wang Z. 2018. Oral supplementation with ursolic acid ameliorates sepsis-induced acute kidney injury in a mouse model by inhibiting oxidative stress and inflammatory responses. Mol Med Rep 17: 7142–7148. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Zhao JS, Deng W, Liu HW. 2019. Effects of chlorogenic acid-enriched extract from Eucommia ulmoides leaf on performance, meat quality, oxidative stability, and fatty acid profile of meat in heat-stressed broilers. Poult Sci 98: 3040–3049. doi: 10.3382/ps/pez081 [DOI] [PubMed] [Google Scholar]
- 51.Zhao Y, Wang Q, Wang Y, Li J, Lu G, Liu Z. 2019. Glutamine protects against oxidative stress injury through inhibiting the activation of PI3K/Akt signaling pathway in parkinsonian cell model. Environ Health Prev Med 24: 4. doi: 10.1186/s12199-018-0757-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Zhou N, Tian Y, Wu H, Cao Y, Li R, Zou K, Xu W, Lu L. 2022. Protective effect of resveratrol on immortalized duck intestinal epithelial cells exposed to H2O2. Molecules 27: 3542. doi: 10.3390/molecules27113542 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Zhou Y, Zhou L, Ruan Z, Mi S, Jiang M, Li X, Wu X, Deng Z, Yin Y. 2016. Chlorogenic acid ameliorates intestinal mitochondrial injury by increasing antioxidant effects and activity of respiratory complexes. Biosci Biotechnol Biochem 80: 962–971. doi: 10.1080/09168451.2015.1127130 [DOI] [PubMed] [Google Scholar]
- 54.Zou Z, Liu B, Zeng L, Yang X, Huang R, Wu C, Zhu H, Gao Y, Yuan D, Yu J. 2019. Cx43 inhibition attenuates sepsis-induced intestinal injury via downregulating ROS transfer and the activation of the JNK1/Sirt1/FoxO3a signaling pathway. Mediators Inflamm 2019: 7854389. doi: 10.1155/2019/7854389 [DOI] [PMC free article] [PubMed] [Google Scholar]







