Skip to main content
Viruses logoLink to Viruses
. 2024 Sep 14;16(9):1465. doi: 10.3390/v16091465

A Comparison of Sanger Sequencing and Amplicon-Based Next Generation Sequencing Approaches for the Detection of HIV-1 Drug Resistance Mutations

Camilla Biba 1,, Lia Fiaschi 1,, Ilenia Varasi 1, Chiara Paletti 1, Niccolò Bartolini 1, Maurizio Zazzi 1, Ilaria Vicenti 1,*, Francesco Saladini 1
Editor: Thomas Klimkait1
PMCID: PMC11437444  PMID: 39339940

Abstract

Background: Next-generation sequencing (NGS) kits are needed to finalise the transition from Sanger sequencing to NGS in HIV-1 genotypic drug resistance testing. Materials and Methods: We compared a homemade NGS amplicon-based protocol and the AD4SEQ HIV-1 Solution v2 (AD4SEQ) NGS kit from Arrow Diagnostics for identifying resistance-associated mutations (RAMs) above the 5% threshold in 28 plasma samples where Sanger sequencing previously detected at least one RAM. Results: The samples had a median 4.8 log [IQR 4.4–5.2] HIV-1 RNA copies/mL and were mostly subtype B (61%) and CRF02_AG (14%). Homemade NGS had a lower rate of samples with low-coverage regions (2/28) compared with AD4SEQ (13/28) (p < 0.001). Homemade NGS and AD4SEQ identified additional mutations with respect to Sanger sequencing in 13/28 and 9/28 samples, respectively. However, there were two and eight cases where mutations detected by Sanger sequencing were missed by homemade NGS and AD4SEQ-SmartVir, respectively. The discrepancies between NGS and Sanger sequencing resulted in a few minor differences in drug susceptibility interpretation, mostly for NNRTIs. Conclusions: Both the NGS systems identified additional mutations with respect to Sanger sequencing, and the agreement between them was fair. However, AD4SEQ should benefit from technical adjustments allowing higher sequence coverage.

Keywords: HIV genotype, drug resistance mutations, NGS, antiretroviral

1. Introduction

In recent years, advances in antiretroviral therapy (ART) have significantly improved the life expectancy for people living with HIV (PLWH). Indeed, several drugs targeting different steps of the HIV-1 replication cycle are now available, with improved convenience, reduced toxicity and higher genetic barrier, while several other investigational antiretrovirals have shown promising results in clinical trials [1]. Despite these improvements, all the currently available drugs, including those belonging to the newer classes, are at risk of losing their full efficacy due to emergence of resistance mutations, thus compromising the success of long-term therapy [2]. Indeed, real-world evidence shows that even the second-generation integrase inhibitor dolutegravir, which is recommended by the WHO as the preferred drug for first-line and second-line ART in all populations due to its high genetic barrier to resistance [3], can occasionally lead to the selection of resistance mutations within integrase, particularly in the presence of nucleoside reverse transcriptase inhibitor resistance [4]. For these reasons, the international guidelines recommend the execution of HIV-1 genotypic tests on viral RNA to evaluate transmitted and acquired drug resistance at HIV diagnosis and at treatment failure, respectively (EACS guidelines v12.0).

Dideoxynucleoside Sanger sequencing has been the standard method for HIV-1 drug resistance testing in clinical settings over the last two decades [5]. Despite widespread use and clinical effectiveness, Sanger sequencing identifies the predominant HIV-1 quasispecies but fails to detect mutations occurring at frequencies lower than 20–30% of the viral population [6]. This limitation has been overcome with the advent of next-generation sequencing (NGS). NGS can detect mutations that occur at frequencies lower than 5% with an accuracy greater than 99% [7]. NGS includes different applications that allow the sequencing of specific genomic fragments as well as of the whole virus genome [8]. Thus, most laboratories are transitioning from Sanger sequencing to NGS for HIV-1 genotypic drug resistance testing. While NGS platforms and chemistry are evolving at a fast pace, Illumina NGS technology, based on sequencing by synthesis, has gained widespread popularity due to low error rates [9] and high throughput with a relatively simple workflow at a reasonable cost [10]. However, until a few years ago, most NGS platforms were certified for research use only and thus were not suitable for clinical diagnostic applications. Recently, three NGS systems have been approved by the FDA for HIV-1 genotypic resistance testing in a diagnostic setting: the Sentosa® SQ HIV Genotyping Assay by Vela Diagnostics (The Kendall, Singapore), the DeepChek® Assay HIV-1 Full PR/RT/INT Drug Resistance system by ABL Diagnostics (Woippy, France) and the AD4SEQ HIV-1 Solution v2 by Arrow Diagnostics (Genoa, Italy). While the Sentosa® assay is based on Ion Torrent technology (PMID: 35269868), both the assays by Arrow Diagnostics and ABL Diagnostics are based on Illumina technology. The aim of this study was to compare the sensitivity of the latter two NGS methods in identifying resistance-associated mutations (RAMs) detected by Sanger sequencing in clinical HIV-1 samples.

2. Materials and Methods

2.1. Samples

Access to residual anonymised plasma samples derived from clinical practice was initially obtained through patients’ informed consent as approved by the local Ethics Committee at the University Hospital of Siena. A total of 28 HIV-1 viremic plasma samples with a previous Sanger sequencing-based genotypic resistance test performed at the Microbiology and Virology Unity of the University Hospital of Siena, Italy, were selected. All samples had at least one RAM to protease inhibitors (PIs), nucleoside and non-nucleoside reverse transcriptase inhibitors (NRTIs and NNRTIs) or integrase inhibitors (INIs). The viral load of each sample was available as quantified by the Cobas® 6800 system (Roche Diagnostic, Basel, Switzerland) for routine testing.

2.2. HIV-1 RNA Extraction and Amplification

Viral RNA was extracted from 1 mL of plasma with the eMAG automated system (bioMérieux, Craponne, France). HIV-1 RNA extracts were reverse-transcribed with the ImProm-II Reverse Transcriptase (Promega, Madison, WI, USA). Two consecutive PCR reactions (outer and inner PCR, Table 1) were performed to amplify the reverse transcriptase (RT, amino acids 1-400), the whole protease (PR) and the whole integrase (IN) coding regions. The outer PCR included 5 µL of cDNA, 10 µL of 5× Colourless GoTaq® Flexi buffer (Promega, Madison, WI, USA), 2.5 mM MgCl2, 80 µM dNTPs, 3 pmol of primers (Table 1), 1 U of GoTaq® Flexi DNA Polymerase (Promega, Madison, WI, USA) and sterile DNAse-/RNAse-free water to a final volume of 50 µL. The thermal profile included a denaturation step of 4 min at 95 °C followed by 5 cycles of 56 °C for 30 s, 68 °C for 2 min and 95 °C for 40 s, 25 cycles of 54 °C for 30 s, 68 °C for 2 min and 95 °C for 40 s and then two final steps at 54 °C for 1 min and 68 °C for 8 min. A total of 2 µL of the outer PCR mixture was used as the template for the nested PCR including 6 µL of 5× Green GoTaq® Flexi Buffer, 2.5 mM MgCl2, 80 µM dNTPs, 3 pmol of primers (Table 1), 1 U of GoTaq® Flexi DNA Polymerase and sterile DNAse-/RNAse-free water to a final volume of 30 µL. The thermal profile included a denaturation step of 4 min at 95 °C, followed by 5 cycles of 56 °C for 30 s, 68 °C for 2 min and 95 °C for 40 s, 30 cycles of 54 °C for 30 s, 68 °C for 2 min and 95 °C for 40 s and then two final steps at 54 °C for 1 min and 68 °C for 8 min. A total of 5 µL of the inner PCR was loaded onto a 1.5% Seakem agarose gel and was run at 6 V/cm for 50 min, and the presence of expected bands was checked under a transilluminator after gel staining with GelRed dye solution (Biotium, Fremont, CA, USA). The amplicons obtained were used both for Sanger sequencing and for the homemade amplicon-based NGS protocol.

Table 1.

Primers used to amplify the protease, reverse transcriptase (amino acid 1–400) and integrase coding regions for Sanger sequencing and homemade NGS. _F, forward primer; _R, reverse primer; PR, protease; RT, reverse transcriptase; IN, integrase.

Primer Sequence (5′-3′) Target Region HIV-1 HXB2 Coordinates PCR Round
P534_F AAAARGGYTGTTGGAAATGTGG PR-RT 2018–2039 Outer
P1069_R TCCCAYTCAGGAATCCAGGT 3774–3793
P688_F CATGGGTACCAGCACACAAAGG IN 4150–4171 Outer
P689_R CCCAAATGCCAGTCTCTTTCTCCTG 5261–5285
P535_F GARAGRCAGGCTAATTTTTTAGGGA PR-RT 2071–2095 Inner
P1070_R AATCCAGGTRGCYTGCCAATA 3762–3782
P690_F AGGRATTGGAGGAAATGAACA IN 4169–4189 Inner
P691_R GGGATGTGTACTTCTGAACTTA 5192–5213

2.3. Sanger Sequencing

All sequencing reactions were performed on a 3500xL Dx Genetic Analyzer (Applied Biosystems, Waltham, MA, USA). PCR amplicons (PR-RT and IN) were diluted to a final concentration of 1–3 ng/µL; then, 10 µL was purified by adding 2 µL of ExoSAP-IT for PCR Product Clean-Up (Affymetrix, Santa Clara, CA, USA) at 37 °C for 15 min, followed by an inactivation step at 80 °C for 15 min. Each sequencing reaction included 3 µL of purified PCR product, 3.2 pmol of sequencing primer (Table 1), 2 µL of BigDye® Terminator v1.1 Ready Reaction Mix (Life Technologies, Waltham, MA, USA), 1 µL of 5× Sequencing Buffer and sterile DNAse-/RNAse-free water, giving a final volume of 10 µL. The thermal cycler profile for this reaction included an initial denaturation step at 94° for 4 min, followed by 25 cycles at 50 °C for 1 min, 68 °C for 4 min, and 94 °C for 1 min. Sequencing reactions were treated with the X-Terminator® Purification kit (Applied Biosystems, Waltham, MA, USA) in a 96-well plate as suggested by the manufacturer and loaded into a capillary electrophoresis sequencer. Chromatograms were assembled and edited with the DNAStar 7.1.0 SeqMan module to generate the FASTA files that were submitted to the Stanford online HIVdb system (https://hivdb.stanford.edu/; accessed on 1 August 2024) for the interpretation of RAMs.

2.4. Homemade Amplicon-Based NGS

Amplicons (Table 1) were obtained as described above for Sanger sequencing, purified with the Agencourt® AMPure® magnetic beads (Beckman Coulter, Brea, CA, USA), quantified with the Qubit fluorometer in dsDNA HS Buffer (Qiagen, Venlo, The Netherlands) and diluted to a final concentration of 0.8 ng/µL. PR-RT and IN amplicons derived from the same sample were pooled together for the subsequent steps. Tagmentation was performed with the Nextera® XT DNA Library Preparation Kit (Illumina, San Diego, CA, USA), according to the manufacturer’s instructions. Tagmented samples were indexed with IDT for Illumina DNA/RNA UD Indexes (Illumina, San Diego, CA, USA) and pooled together to obtain the library that was diluted to a final concentration of 9 pM. The library was then spiked-in with 10% 9 pM PhiX control library (Illumina, San Diego, CA, USA), loaded on a Nano MiSeq Reagent Kit v2 (2 × 250 bp paired-end reads, 8.5 Gb output, Illumina, San Diego, CA, USA) and run on an Illumina MiSeq instrument.

2.5. AD4SEQ HIV-1 Solution v2 Kit

The RNA extracts were obtained as described above and, according to the AD4SEQ HIV-1 Solution v2 protocol (Arrow Diagnostic, Genoa, Italy), samples with viremia above 20,000 HIV-1 RNA copies/mL were five-fold diluted in sterile DNase-/RNase-free water. Then, one-step RNA reverse transcription was performed, followed by amplification of the target regions in two separate PCRs, defined as Target PCR. Target PCR amplifies the following regions of the HIV-1 genome: PR (codons 1–99), RT (codons 1–440), IN (codons 1–289) and gp120 (codons 266–366). Once the reaction was completed, amplification products were visualised by electrophoresis. Then, for each sample, the two separated Target PCR reactions were combined in a single tube and purified with magnetic beads (Agentcourt® AMPure® magnetic beads, Beckman Coulter, Brea, CA, USA). Individual samples were indexed using the index adaptors provided by the kit (Index PCR), purified as described above, and amplification was checked again by electrophoresis. The concentration of each purified Index PCR was determined with the Qubit fluorometer in dsDNA HS Buffer (Qiagen, Venlo, The Netherlands), and the molarity of each sample was calculated using the following formula: sample concentration [nM] = (sample concentration [ng/µL] × 106)/(656.6 × AMPpb), where AMPbp is the average length of the amplicons in base pairs. After quantification, each sample was diluted to 20 pM, and 3 µL was pooled in the library. After purification, the library was diluted to a final concentration of 9 pM and spiked-in with 20% of 9 pM PhiX control library (Illumina, San Diego, CA, USA), loaded on a Nano MiSeq Reagent Kit v2 (2 × 250 bp paired-end reads, 8.5 Gb output, Illumina, San Diego, CA, USA) and run on an Illumina MiSeq instrument.

2.6. HIV-1 Subtyping and Drug Resistance Interpretation

The assignment of HIV-1 subtypes was performed by the COMET HIV-1 tool [11]. NGS data generated by AD4SEQ were analysed both with the dedicated SmartVir software version 1.0.6 provided by Arrow Diagnostics (AD4SEQ-Smartvir) and by the online HIVdb Drug Resistance Database system (AD4SEQ-HIVdb) (Stanford University; https://hivdb.stanford.edu/; accessed on 1 August 2024). NGS data generated by the homemade system were analysed only by HIVdb. The FASTA files obtained from Sanger sequencing were analysed directly, while the FASTQ files obtained from NGS were first converted to CodFreq files and then analysed to detect RAMs. The CodFreq files list the frequency of the mutations of each nucleotide triplet within the sequenced region. For the analysis of FASTQ files, the minimum read depth parameter was set at >100 reads per position with a mutation detection threshold of 5%, both for SmartVir and for HIVdb, independently of whether the position was associated with drug resistance or not. The Stanford HIVdb 9.6 algorithm was used to infer drug susceptibility from the RAMs identified by the two NGS systems and by Sanger sequencing. Mutations were defined as RAMs when associated with a score for at least one drug or included in a combination rule changing the score for at least one drug in the HIVdb 9.6 algorithm. Agreement among the RAMs identified by the different systems was qualitatively defined when identical RAMs were identified.

2.7. Statistical Analysis

Continuous variables were reported as median and interquartile ranges (IQRs). The difference in proportions was analysed by a chi-square test followed by a post hoc z test with the Bonferroni adjustment for multiple comparisons. The difference between numerical values obtained with paired samples were analysed by a Wilcoxon signed-rank test. All the analyses were performed using the SPSS version 20 package (IBM Corp., Armonk, NY, USA).

3. Results

3.1. Samples Included in This Study

All the 28 plasma samples included in this study (Table 2) had detectable viremia with a median viral load of 4.8 log [IQR 4.4–5.2] HIV-1 RNA copies/mL. Subtype B was identified in 17 (61%) cases and CRF02_AG in 4 (14%).

Table 2.

Subtype and viral load of the 28 plasma samples included this study.

Sample Subtype HIV-1 RNA
log10 Copies/mL
5826 B 4.3
5974 F1 4.9
5979 B 2.1
6003 CRF02_AG 3.1
6006 F1 6.0
6084 B 4.9
6092 B 4.9
6107 B 4.6
6216 B 4.8
6222 B 6.3
6322 A6 5.4
6363 B 4.8
6408 B 4.9
6436 CRF02_AG 4.8
6471 B 3.7
6493 CRF01_AE 5.1
6570 B 4.1
6592 C 4.5
6669 CRF02_AG 5.0
6695 B 4.7
6750 B 5.3
6762 B 3.1
6813 B 5.0
6817 B 5.4
6835 B 4.3
6880 F1 6.3
7312 G 4.8
7347 CRF02_AG 5.9

3.2. Comparison between Homemade NGS and AD4SEQ: Identification of Drug Resistance Mutations

The RAMs identified by the three different sequencing methods, i.e., Sanger sequencing as well as AD4SEQ (data processing by SmartVir) and homemade (data processing by HIVdb) NGS, are listed in Supplementary Table S1. RAMs to PIs, NRTIs, NNRTIs and INIs were detected in 7, 19, 22 and 7 samples, respectively, by at least one method (Table 3). Homemade NGS and AD4SEQ-SmartVir identified additional mutations with respect to Sanger sequencing in 13/28 and 9/28 samples, respectively.

Table 3.

Drug resistance mutations to (A) PIs (protease inhibitors), (B) NRTIs (nucleoside reverse transcriptase inhibitors) and NNRTI (non-NRTI) and (C) INI (integrase inhibitors) identified. The table lists the samples in which RAMs were detected by at least one of the three sequencing methods, highlighted in bold. The frequency of each mutation identified by NGS is shown in brackets.

(A)
Sample Sequencing System and Data Processing Method PIs
5826 Sanger-HIVdb V32I, L33F, M46I, I47V, I54M, Q58E, T74TP
Homemade NGS-HIVdb V32I (99%), L33F (99%), M46I (99%), I47V (99%), I50V (29%), I54M (99%), Q58E (99%), T74P (27%)
AD4SEQ-SmartVir V32I (99%), L33F (99%), M46I (99%), I47V (99%), I50V (24%), I54M (99%), Q58E (99%), T74P (45%)
5979 Sanger-HIVdb L33F, I84V
Homemade NGS-HIVdb L33F (98%), I54T (10%), I84V (98%)
AD4SEQ-SmartVir L33F (98%), I84V (98%)
6084 Sanger-HIVdb L10F, M46I, T74P
Homemade NGS-HIVdb L10F (98%), M46I (99%), T74P (64%)
AD4SEQ-SmartVir L10F (98%), M46I (98%), T74P (69%)
6092 Sanger-HIVdb L90M
Homemade NGS-HIVdb L90M (98%)
AD4SEQ-SmartVir L90M (99%)
6408 Sanger-HIVdb L33F, M46L, L90M
Homemade NGS-HIVdb L33F (99%), M46L (99%), L90M (98%)
AD4SEQ-SmartVir L33F (98%), M46L (97%), L90M (99%)
6570 Sanger-HIVdb None
Homemade NGS-HIVdb K20T (14%)
AD4SEQ-SmartVir K20T (9.6%)
6813 Sanger-HIVdb Q58E
Homemade NGS-HIVdb Q58E (99%), G73S (7.3%)
AD4SEQ-SmartVir Q58E (98%)
(B)
Sample Sequencing System and Data Processing Method NRTIs NNRTIs
5826 Sanger-HIVdb K70T, M184V None
Homemade NGS-HIVdb K70T (78%), V75I (6.5%), M184V (96%) None
AD4SEQ-SmartVir K70T (70%), M184V (99%) None
5974 Sanger-HIVdb S68G K103N, N348I
Homemade NGS-HIVdb S68G (99%), K219Q (7.1%) K103N (99%), V106I (10%), N348I (99%)
AD4SEQ-SmartVir None K103N (99%), N348I (99%)
5979 Sanger-HIVdb M41L, D67N, T215Y K103N, Y181I
Homemade NGS-HIVdb M41L (99%), D67N (95%), T215Y (91%) K103N (97%), Y181I (97%)
AD4SEQ-SmartVir D67N (98%), T215Y (88%) K103N (99%), Y181I (90%)
6003 Sanger-HIVdb S68G, M184V K103N, K238N
Homemade NGS-HIVdb S68G (99%), M184V (99%) K103N (98%), K238N (99%)
AD4SEQ-SmartVir M184V (98%) K103N (95%), K238N (96%)
6006 Sanger-HIVdb S68G K103N, N348I
Homemade NGS-HIVdb S68G (99%) K103N (98%), N348I (98%)
AD4SEQ-SmartVir None K103N (99%), N348I (99%)
6084 Sanger-HIVdb D67N, T215C None
Homemade NGS-HIVdb D67N (92%), T215C (97%) None
AD4SEQ-SmartVir D67N (98%), T215C (97%) None
6092 Sanger-HIVdb M41ML, M184V, T215TNSY None
Homemade NGS-HIVdb M41L (28%), M184V (97%), T215Y (23%) None
AD4SEQ-SmartVir M41L (36%), M184V (97%), T215Y (13%) None
6107 Sanger-HIVdb K219N Y181C
Homemade NGS-HIVdb K219N (99%) Y181C (98%)
AD4SEQ-SmartVir K219N (98%) Y181C (99%)
6216 Sanger-HIVdb M41L, T215D None
Homemade NGS-HIVdb M41L (97%), T215D (98%) None
AD4SEQ-SmartVir M41L (94%), T215D (90%) None
6222 Sanger-HIVdb None V106I, G190A
Homemade NGS-HIVdb None V106I (91%), G190A (99%)
AD4SEQ-SmartVir None V106I (92%), G190A (98%)
6322 Sanger-HIVdb None E138A, G190GS
Homemade NGS-HIVdb None E138A (90%), G190S (41%)
AD4SEQ-SmartVir None E138A (89%), G190S (38%)
6363 Sanger-HIVdb M184V V106A, F227L
Homemade NGS-HIVdb M184V (92%) V106A (97%), F227L (93%)
AD4SEQ-SmartVir M184V (98%) V106A (97%), F227L (97%)
6408 Sanger-HIVdb T215V None
Homemade NGS-HIVdb T215V (95%) None
AD4SEQ-SmartVir T215V (98%) None
6436 Sanger-HIVdb S68G K103N
Homemade NGS-HIVdb S68G (85%) K103N (98%), K238T (7.8%), N348I (6.8%)
AD4SEQ-SmartVir None K103N (99%)
6471 Sanger-HIVdb M41L, D67N, M184V, L210W, T215Y, K219KE L100I, K103N, N348I
Homemade NGS-HIVdb M41L (98%), M184V (98%), L210W (98%), T215Y (95%) L100I (96%), K103N (98%), N348I (98%)
AD4SEQ-SmartVir M41L (98%), D67N (19%), M184V (91%), L210W (98%), T215Y (92%), K219E (9%) L100I (99%), K103N (97%), N348I (99%)
6493 Sanger-HIVdb D67G, S68G, K70R, M184V, T215I, K219E K103N, V108I, K238T, N348I
Homemade NGS-HIVdb D67G (99%), S68G (97%), K70R (98%), M184V (98%), T215I (87%), K219E (78%) K103N (98%), V108I (98%), V179D (7%), Y181C (34%), K238T (98%), N348I (98%)
AD4SEQ-SmartVir D67G (98%), K70R (99%), M184V (92%), K219E (87%) K103N (98%), V108I (99%), Y181C (26%), K238T (97%), N348I (99%)
6570 Sanger-HIVdb M41L, M184MV None
Homemade NGS-HIVdb M41L (44%), M184V (43%) None
AD4SEQ-SmartVir M41L (66%), M184V (70%) None
6592 Sanger-HIVdb None E138EK
Homemade NGS-HIVdb None K101E (40%), E138K (23%)
AD4SEQ-SmartVir None K101E (13%), E138K (29%)
6669 Sanger-HIVdb None K103KN, V106M
Homemade NGS-HIVdb None K103N (75%), V106M (24%)
AD4SEQ-SmartVir None K103N (45%), V106M (54%), Y181C (7%)
6695 Sanger-HIVdb None A98G
Homemade NGS-HIVdb None A98G (99%)
AD4SEQ-SmartVir None A98G (90%)
6750 Sanger-HIVdb V75M E138A
Homemade NGS-HIVdb V75M (96%) E138A (99%)
AD4SEQ-SmartVir V75M (95%) E138A (97%)
6762 Sanger-HIVdb D67N, K219Q K103N, V179T, Y181C, H221Y
Homemade NGS-HIVdb D67N (90%), K219Q (98%) K103N (99%), V179T (T 76%), Y181C (98%), H221Y (99%)
AD4SEQ-SmartVir D67N (92%), K219Q (98%) K103N (99%), V179T (T 76%), Y181C (98%), H221Y (98%)
6813 Sanger-HIVdb None E138A, G190A, M230L
Homemade NGS-HIVdb None E138A (99%), G190A (99%), M230L (98%)
AD4SEQ-SmartVir None K103N (7%), E138A (92%), G190A (95%), M230L (96%)
6817 Sanger-HIVdb None K103KN, V179T
Homemade NGS-HIVdb None K103N (67%), V106I (5.4%), V179T (99%)
AD4SEQ-SmartVir None K103N (69%)
6835 Sanger-HIVdb L210W, T215S None
Homemade NGS-HIVdb M41L (30%), L210W (99%), T215DS (D: 19%, S 79%) None
AD4SEQ-SmartVir M41L (19%), L210W (98%), T215DS (D: 25%, S: 72%) None
6880 Sanger-HIVdb None E138G
Homemade NGS-HIVdb None E138G (96%)
AD4SEQ-SmartVir None E138G (97%)
7312 Sanger-HIVdb D67Δ, T69G, K219Q A98G, V106I
Homemade NGS-HIVdb D67ΔN (Δ: 8.9%, N: 53%), S68G (52%), T69Δ (93%), K219Q (96%) A98G (99%), V106I (94%), Y181C (55%)
AD4SEQ-SmartVir D67NE (N: 8%, E: 88%), T69NG (N: 6%, G: 89%), K219Q (96%) A98G (97%), V106I (98%), Y181C (66%)
7347 Sanger-HIVdb None K101E, Y181C, N348I
Homemade NGS-HIVdb None K101E (99%), V106I (16%), Y181C (99%), N348I (99%)
AD4SEQ-SmartVir None K101E (99%), V106I (15%), Y181C (96%), N348I (96%)
(C)
Sample Sequencing System and Data Processing Method INIs
5979 Sanger-HIVdb T97A, E138K, G140S, Q148H
Homemade NGS-HIVdb T97A (100%), E138K (99%), G140S (99%), Q148H (99%)
AD4SEQ-SmartVir T97A (94%), E138K (94%), G140S (93%), Q148H (94%)
6003 Sanger-HIVdb R263K
Homemade NGS-HIVdb R263K (96%)
AD4SEQ-SmartVir R263K (98%)
6669 Sanger-HIVdb None
Homemade NGS-HIVdb E157Q (7.1%)
AD4SEQ-SmartVir E157Q (11%)
6813 Sanger-HIVdb L74M, G140S, Q148K
Homemade NGS-HIVdb L74M (98%) G140S (99%), Q148K (98%)
AD4SEQ-SmartVir L74M (97%), G140S (97%), Q148K (98%)
6835 Sanger-HIVdb None
Homemade NGS-HIVdb None
AD4SEQ-SmartVir L74M (10%)
6880 Sanger-HIVdb Q95QK
Homemade NGS-HIVdb Q95K (35%)
AD4SEQ-SmartVir Q95K (36%)
7347 Sanger-HIVdb None
Homemade NGS-HIVdb T97A (6%)
AD4SEQ-SmartVir None

Agreement between the NGS methods and Sanger sequencing for PIs was observed in 24/28 cases (85.7%). In two cases (samples 5826 and 6570), both NGS methods detected additional RAMs with respect to Sanger sequencing. In two samples (5979 and 6813), homemade NGS was more sensitive in detecting additional RAMs with respect to Sanger sequencing and AD4SEQ-SmartVir.

With NRTIs, complete agreement among the NGS methods and Sanger sequencing was observed in only 18/28 (64.3%) cases. In three cases (samples 5826, 5974 and 7312), homemade NGS detected additional mutations with respect to AD4SEQ-SmartVir and Sanger sequencing, while in one case (sample 7312), AD4SEQ-SmartVir detected an additional mutation with respect to homemade NGS and Sanger sequencing. However, in five cases (samples 5979, 6003, 6006, 6436 and 6493), Sanger sequencing and homemade NGS gave comparable results, and AD4SEQ-SmartVir failed to recognise some drug resistance mutations. Differently from Sanger sequencing and AD4SEQ-SmartVir, homemade NGS failed to identify mutations D67N and K219E in sample 156471. Agreement between the NGS methods with respect to Sanger sequencing was observed only in one case (sample 6835). A strong discordance among the three methods was observed in sample 7312. Indeed, Sanger sequencing detected the D67N, T69G and K219Q mutations, homemade NGS detected the additional mutation S68G and a deletion at position 69, while AD4SEQ-SmartVir detected a combination of mutations at position D67(N/E) and the T69NG mutation.

With NNRTIs, similar to NRTIs, 19/28 (67.9%) cases showed complete agreement across the NGS methods and Sanger sequencing. In four cases (samples 155974, 156436, 156493 and 156817), homemade NGS detected additional mutations with respect to AD4SEQ-SmartVir and Sanger sequencing, while in two cases (samples 6669 and 6813), AD4SEQ-SmartVir detected additional mutations with respect to homemade NGS and Sanger sequencing. Additional mutations detected by both NGS methods but not by Sanger sequencing were observed in three cases (samples 6592, 7312 and 7347).

For INIs, complete agreement among all methods was observed in 25/28 cases (89.3%). In one case (sample 6669), both NGS methods were in agreement and detected the minority RAM E157Q with respect to Sanger sequencing. Homemade NGS was more sensitive in detecting the additional minority RAM T97A with respect to Sanger sequencing and AD4SEQ-SmartVir in sample 7347, but AD4SEQ-SmartVir was more sensitive than homemade NGS with sample 6835, detecting L74M.

In conclusion, AD4SEQ-SmartVir did not identify one or more RAMs detected by at least one of the other two systems in 2 (7.1%), 8 (28.5%), 4 (14.3%) and 1 (3.6%) samples for PIs, NRTIs, NNRTIs and INIs, respectively, while homemade NGS did not identify one or more RAMs in 0, 2 (7.1%), 2 (7.1%) and 1 (3.6%) samples detected by at least one of the other two systems for PIs, NRTIs, NNRTIs and INIs, respectively. Differently from HIVdb, AD4SEQ-SmartVir did not report the mutation S68G and failed to detect mutations identified by Sanger sequencing and homemade NGS with a frequency >20% in three cases. By contrast, homemade NGS-HIVdb gave a slightly different identification of RAMs at two amino acid positions that were detected as predominant by Sanger sequencing or with frequency >20% by AD4SEQ-SmartVir in sample 7312.

3.3. Comparison of SmartVir and HIVdb NGS Data Processing

Notably, SmartVir and HIVdb generated different outputs for read depth, i.e., median read depth vs. max. and min. coverage, respectively (Supplementary Table S2). Other parameters, such as the sequenced regions with a coverage depth of <100 reads per base, were instead reported by both interpretation systems (Table 4). To compare the two NGS data processing methods, we analysed the FASTQ files obtained by AD4SEQ both with Smartvir (AD4SEQ-Smartvir) and with HIVdb (AD4SEQ-HIVdb). Homemade NGS generated low-coverage data in 2/28 samples, both subtype B, in the initial part of the integrase encoding region (Table 4). A coverage depth <100 was more frequent both with AD4SEQ-HIVdb (17/28 cases) and with AD4SEQ-SmartVir (13/28) with respect to homemade NGS (2/28) (p < 0.001) while the difference between AD4SEQ-HIVdb and AD4SEQ-SmartVir was not statistically significant. The median read depth obtained with homemade NGS and with AD4SEQ-HIVdb was comparable (2189 [IQR 1842–7809] reads vs. 4634 [3056–6427] reads, p = 0.151). With AD4SEQ-SmartVir, the lower coverage affected seven B and six non-B subtypes, mainly at RT codons 14–49 and 260–319 and IN codons 1–75 and 201–288.

Table 4.

Regions with a coverage depth of <100 reads per base according to the NGS system and the data processing method. There were no low-coverage regions within the protease coding regions.

Sample NGS System and Data Processing Method Region and Relative Amino Acids with Coverage < 100×
5826 AD4SEQ-SmartVir RT 14–49
AD4SEQ-HIVdb RT 14–49
Homemade NGS-HIVdb IN 1–25
5974 AD4SEQ-SmartVir IN 201–284
AD4SEQ-HIVdb IN 201–288
Homemade NGS-HIVdb None
5979 AD4SEQ-SmartVir RT 14–49, 223–235/IN 1–75, 201–284
AD4SEQ-HIVdb RT 14–49, 223–235/IN 1–75, 201–288
Homemade NGS-HIVdb None
6003 AD4SEQ-SmartVir RT 260–275
AD4SEQ-HIVdb RT 260–319
Homemade NGS-HIVdb None
6084 AD4SEQ-SmartVir None
AD4SEQ-HIVdb IN 201–209
Homemade NGS-HIVdb None
6107 AD4SEQ-SmartVir IN 1–10, 66–75, 159–171
AD4SEQ-HIVdb IN 1–11, 66–75
Homemade NGS-HIVdb None
6216 AD4SEQ-SmartVir RT 260–319
AD4SEQ-HIVdb RT 260–319
Homemade NGS-HIVdb IN 1–39
6222 AD4SEQ-SmartVir IN 1–75
AD4SEQ-HIVdb IN 1–75
Homemade NGS-HIVdb None
6363 AD4SEQ-SmartVir RT 260–275; IN 201–284
AD4SEQ-HIVdb IN 201–288
Homemade NGS-HIVdb None
6408 AD4SEQ-SmartVir None
AD4SEQ-HIVdb IN 201–288
Homemade NGS-HIVdb None
6436 AD4SEQ-SmartVir None
AD4SEQ-HIVdb RT 260–319, 359
Homemade NGS-HIVdb None
6471 AD4SEQ-SmartVir RT 260–319
AD4SEQ-HIVdb RT 260–319
Homemade NGS-HIVdb None
6493 AD4SEQ-SmartVir RT 260–319
AD4SEQ-HIVdb RT 260–319
Homemade NGS-HIVdb None
6592 AD4SEQ-SmartVir IN 1–31, 66–75
AD4SEQ-HIVdb IN 1–75
Homemade NGS-HIVdb None
6880 AD4SEQ-SmartVir IN 74–75
AD4SEQ-HIVdb IN 73–75
Homemade NGS-HIVdb None
7312 AD4SEQ-SmartVir RT 14–49
AD4SEQ-HIVdb RT 14–49
Homemade NGS-HIVdb None
7347 AD4SEQ-SmartVir None
AD4SEQ-HIVdb RT 35–49
Homemade NGS-HIVdb None

RT, reverse transcriptase; IN, integrase.

Disagreement between RAMs detected by SmartVir and HIVdb when processing AD4SEQ FastQ files was observed in 10 samples (35.7%; Table 5). HIVdb detected one additional PI RAM in one case (3.6%). For NRTIs, 1 mutation (3.6%) was detected by SmartVir and not by HIVdb, 8 mutations (28.6%) were detected by HIVdb and not by Smartvir, including S68G in 6/8 cases. For NNRTIs, two mutations (10.7%) at position V179 were detected by HIVdb but not by SmartVir.

Table 5.

Discordant identification of drug resistance mutations between SmartVir and HIVdb interpretation tools from FASTQ files generated by the AD4SEQ sequencing method. Mutations in bold are those identified by only one interpretation tool. The frequency of each mutation is shown in brackets. There were no discordant cases with integrase inhibitor resistance mutations.

Sample Data Processing Method PIs NRTIs NNRTIs
5974 SmartVir None None K103N (99%), N348I (99%)
HIVdb None S68G (98%) K103N (99%), N348I (99%)
6003 SmartVir None M184V (98%) K103N (95%), K238N (96%)
HIVdb None S68G (91%), M184V (98%) K103N (93%), K238N (96%)
6006 SmartVir None None K103N (99%), N348I (99%)
HIVdb None S68G (98%) K103N (99%), N348I (99%)
6436 SmartVir None None K103N (99%)
HIVdb None S68G (81%) K103N (99%)
6471 SmartVir None M41L (98%), D67N (19%), M184V (91%), L210W (98%), T215Y (92%), K219E (9%) L100I (99%), K103N (97%), N348I (99%)
HIVdb None M41L (99%), E44A (15%), D67N (19%), M184V (92%), L210W (97%), T215Y (95%), K219E (11%) L100I (99%), K103N (97%), N348I (100%)
6493 SmartVir None D67G (98%), K70R (99%), M184V (92%), T215I (94%), K219E (87%) K103N (98%), V108I (99%), Y181C (26%), K238T (97%), N348I (99%)
HIVdb None D67G (97%), S68G (98%), K70R (99%), M184V (93%), T215I (96%), K219E (89%) K103N (99%), V108I (98%), Y181C (25%), K238T (94%), N348I (100%)
6817 SmartVir None None K103N (69%)
HIVdb None None K103N (69%), V179T (94%)
6835 SmartVir None M41L (19%), L210W (98%), T215DS (D: 25%, S: 72%) None
HIVdb M46I (5%) M41L (19%), L210W (99%), T215DS (D: 25%, S: 73%) None
6880 SmartVir None None E138G (97%)
HIVdb None None E138G (96%), V179T (6%)
7312 SmartVir None D67NE (N: 8%, E: 89%), T69NG (N: 6%, G: 89%), K219Q (96%) A98G (97%), V106I (98%), Y181C (66%)
HIVdb None D67ΔN (Δ: 8%, N: 51%), S68G (8%), T69NG (N: 6%, G:88%), K219Q (98%) A98G (97%), V106I (98%), Y181C (68%)

PIs, protease inhibitors; NRTIs, nucleoside reverse transcriptase inhibitors; NNRTI, non-NRTI.

3.4. Prediction of Drug Susceptibility

Table 6 shows the impact of the RAMs not detected uniformly by the four methods (Sanger sequencing, homemade NGS, AD4SEQ-Smartvir and AD4SEQ-HIVdb) on the prediction of drug susceptibility. Globally, drug susceptibility predictions were fully concordant in 20/28 (71.4%) samples for all the drugs considered, including PIs (Atazanavir, ATV; Lopinavir, LPV; and Darunavir, DRV), NRTIs (Abacavir, ABC; Tenofovir Alafenamide, TAF; and Lamivudine/Emtricitabine, 3TC/FTC), NNRTIs (Doravirine, DOR; Rilpivirine, RPV; Etravirine, ETR; Efavirenz, EFV; and Nevirapine, NVP) and INIs (Dolutegravir, DTG; Bictegravir, BIC; and Cabotegravir, CAB).

Table 6.

Discordant cases of predicted drug susceptibility according to the sequencing system and to the data processing method.

Sample Sequencing System and Data Processing Method PIs NRTIs NNRTIs INIs
ATV LPV DRV ABC TAF 3TC/FTC DOR RPV ETR EFV NVP DTG BIC CAB
5979 Sanger-HIVdb R I LLR I I S PLLR R R R R R R R
Homemade NGS-HIVdb R I LLR I I S PLLR R R R R R R R
AD4SEQ-SmartVir R I LLR LLR LLR S PLLR R R R R R R R
AD4SEQ-HIVdb R I LLR LLR LLR S PLLR R R R R R R R
6471 Sanger Sequencing S S S R R R I R I R R S S S
Homemade NGS S S S R I R I R I R R S S S
AD4SEQ-SmartVir S S S R R R I R I R R S S S
AD4SEQ-HIVdb S S S R R R I R I R R S S S
6493 Sanger Sequencing S S S I LLR R PLLR S S R R S S S
Homemade NGS S S S I LLR R I I I R R S S S
AD4SEQ-SmartVir S S S I LLR R I I I R R S S S
AD4SEQ-HIVdb S S S I LLR R I I I R R S S S
6592 Sanger Sequencing S S S S S S S I PLLR PLLR PLLR S S S
Homemade NGS S S S S S S LLR R LLR LLR I S S S
AD4SEQ-SmartVir S S S S S S LLR R LLR LLR I S S S
AD4SEQ-HIVdb S S S S S S LLR R LLR LLR I S S S
6669 Sanger Sequencing S S S S S S I S S R R S S S
Homemade NGS S S S S S S I S S R R S S S
AD4SEQ-SmartVir S S S S S S I I I R R S S S
AD4SEQ-HIVdb S S S S S S I I I R R S S S
6835 Sanger Sequencing S S S S S S S S S S S S S S
Homemade NGS S S S LLR LLR S S S S S S S S S
AD4SEQ-SmartVir S S S LLR LLR S S S S S S S S PLLR
AD4SEQ-HIVdb PLLR PLLR S LLR LLR S S S S S S S S PLLR
7312 Sanger Sequencing S S S I I LLR LLR LLR LLR LLR I S S S
Homemade NGS S S S I I I I R I I R S S S
AD4SEQ-SmartVir S S S LLR LLR S I R I I R S S S
AD4SEQ-HIVdb S S S I I LLR I R I I R S S S
7347 Sanger Sequencing S S S S S S LLR R I I R S S S
Homemade NGS S S S S S S I R I I R S S S
AD4SEQ-SmartVir S S S S S S I R I I R S S S
AD4SEQ-HIVdb S S S S S S I R I I R S S S

PIs, protease inhibitors; NRTIs, nucleoside reverse transcriptase inhibitors; NNRTI, non-NRTI; INIs, integrase inhibitors; ATV, atazanavir; LPV, lopinavir; DRV, darunavir; ABC, abacavir; TAF, tenofovir alafenamide; 3TC, lamivudine; FTC, emtricitabine; DOR, doravirine; RPV, rilpivirine; ETR, etravirine; EFV, efavirenz; NVP, nevirapine; DTG, dolutegravir; BIC, bictegravir; CAB, cabotegravir; S, full susceptibility (green); PLLR, potential low-level resistance (yellow); LLR, low-level resistance (light orange); I, intermediate resistance (orange); R, high-level resistance (red).

Homemade NGS gave discordant results with respect to AD4SEQ-SmartVir in three samples for NRTIs (5979, 6471 and 7312) and in one sample each for NNRTIs (1669) and for INIs (6835). AD4SEQ-SmartVir and AD4SEQ-HIVdb gave discordant results in one sample each for PI (ATV and LPV for 6835) and for NRTIs (ABC, TAF and 3TC/FTC for 7312).

Considering Sanger sequencing as a reference, homemade NGS was in agreement with Sanger sequencing for susceptibility predictions against all INIs and PIs but gave discordant predictions in 4/84 (4.7%) cases for NRTIs (6471 and 7312 for one drug and 6835 for two drugs) and in 14/140 (10.0%) cases for NNRTIs (6592 and 7312 for five drugs, 6493 for three drugs and 7347 for one drug). AD4SEQ-Smartvir was discordant with Sanger sequencing in 5/84 (6.0%) cases for NRTIs (5979 for two drugs and 7312 for three drugs), in 16/140 (11.4%) cases for NNRTIs (6592 and 7312 for five drugs, 6493 for three drugs, 6669 for two drugs and 7347 for one drug) and in 1/84 (1.2%) cases for INIs (6835). AD4SEQ-HIVdb gave discordant susceptibility predictions in 1/84 (1.2%) cases for PIs and INIs (6835 in both cases), in 2/84 (2.4%) cases for NRTIs (5979 for two drugs) and in 16/140 (11.4%) samples for NNRTIs (6592 and 7312 for five drugs, 6493 for three drugs, 6669 for two drugs and 7347 for one drug). Notably, most of the discrepancies between either NGS method and Sanger sequencing were explained by a lack of detection of minority RAMs (<20%) by Sanger sequencing, namely, in 11 (39%), 7 (25%) and 9 (32%) out of 28 cases with homemade NGS, AD4SEQ-Smartvir and AD4SEQ-HIVdb, respectively.

4. Discussion

NGS has redefined genome sequencing techniques, and HIV-1 genotyping has been an early NGS application in the field of infectious diseases with the aim of identifying minority RAMs that cannot be detected by Sanger sequencing [12]. Since NGS is more diversified and complex than Sanger sequencing, standardisation plays a key role in the transition from Sanger sequencing to NGS in clinical settings. Indeed, recent progress in HIV-1 NGS has led to the CE-IVD certification of some commercial systems, including the Sentosa® SQ HIV Genotyping Assay developed by Vela Diagnostics, the AD4SEQ HIV-1 Solution v2 developed by Arrow Diagnostics and the DeepChek® Assay HIV-1 Full PR/RT/INT Drug Resistance developed by ABL Diagnostics.

Due to the limits of the Sentosa® SQ HIV kit—based on the Ion Torrent platform that is more error prone and expensive than the small footprint Illumina platforms [13]—and the slow introduction of the DeepChek® HIV Assay in Italy, the AD4SEQ HIV-1 Solution v2 is currently the most widely used in Italy. However, to our knowledge, there are no published studies evaluating the AD4SEQ HIV-1 Solution v2 kit in comparison with other NGS-based HIV-1 genotyping techniques or with the reference Sanger sequencing. In this work, we compared Sanger sequencing, AD4SEQ and a homemade amplicon-based NGS protocol to analyse a panel of 28 plasma samples derived from routine analysis. For both NGS methods, we used an Illumina MiSeq platform. The NGS reads generated by the homemade and AD4SEQ systems were processed by the Stanford HIVdb online tool for sequence reads and by the SmartVir system bundled with AD4SEQ, respectively. In addition, AD4SEQ NGS reads were also processed by HIVdb to compare the output of HIVdb and SmartVir on the same raw data (AD4SEQ-HIVdb vs. AD4SEQ-SmartVir). For both the NGS systems and Sanger sequencing, the RAMs detected were interpreted by the HIVdb 9.6 algorithm.

Overall, the Sanger sequencing and NGS results were more concordant for PI and INI than for NRTI and NNRTI RAMs. A higher proportion of additional PI and NRTI RAMs was detected by homemade NGS compared with AD4SEQ-SmartVir. Notably, in 17.8% of the samples, AD4SEQ-Smartvir failed to detect resistance mutations against NRTIs which were also detected by Sanger sequencing. The most frequently missed mutation was S68G in the RT coding region. This mutation was also detected when the AD4SEQ data were analysed with the Stanford HIVdb system, indicating that some settings in the SmartVir pipeline likely led to the exclusion of this polymorphic mutation. Indeed, comparing the two NGS data processing systems on AD4SEQ sequences, AD4SEQ-HIVdb and AD4SEQ-SmartVir missed 3.6% vs. 15.5% of the RAMs detected by the other system, respectively. However, the lower rate of RAM detection by AD4SEQ cannot be attributed solely to the interpretation system. Indeed, a lower coverage with respect to homemade NGS was observed for AD4SEQ (samples with a coverage < 100 reads were 2, 13 and 17 for homemade NGS, AD4SEQ-SmartVir and AD4SEQ-Stanford, respectively). While we were not able to identify any factor associated with low coverage in our dataset, a recently published study based on a larger number of sequence data generated by the AD4SEQ kit showed that non-B subtype and low viremia are associated with low coverage [14]. Nevertheless, predictions of drug susceptibility were affected only for NRTIs and prevalently when AD4SEQ data were processed by SmartVir (4.7%, 6.0%, 2.4% of discordant prediction for homemade NGS, AD4SEQ-SmartVir, AD4SEQ-Stanford, respectively, with respect to Sanger sequencing). Reassuringly, we did not observe any large shift in the prediction of drug susceptibility from a high score to a low score (i.e., from sensitive to resistant or vice versa).

Several published works [12,15,16,17] have evaluated the performance of homemade NGS systems with respect to Sanger sequencing and obtained results similar to those shown in this study, consistent with the inherently higher sensitivity of NGS in detecting minority RAMs. While participation in external quality assessment programs is a recognised approach for validating homemade NGS methodologies, CE-IVD-approved kits are essential for clinical use. To date, only the Sentosa® SQ HIV kit has been compared with the reference Sanger sequencing [17,18]. Thus, this is the first paper analysing the performance of AD4SEQ HIV-1 Solution v2 kit by Arrow Diagnostics. Although we had the possibility of selecting samples shown to harbour drug resistant viruses by Sanger sequencing, the number of samples was limited and did not allow a wide representation of HIV-1 subtypes. In addition, all but one sample had >1000 HIV-1 RNA copies/mL; thus, we could not test the threshold of sensitivity for the AD4SEQ amplification method. For these reasons, further validation experiments on a larger and more heterogeneous sample panel are advisable for completing the assessment of the system. Notwithstanding such limitations, this study conveys relevant information on the performance and caveats of the AD4SEQ system in clinical settings.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/v16091465/s1, Table S1. Resistance mutations identified in each sample according to the sequencing system and to the data processing method. Table S2. Sequence coverage across the protease (PR), reverse transcriptase (RT) and integrase (IN) regions with the different NGS systems.

viruses-16-01465-s001.zip (198.8KB, zip)

Author Contributions

Conceptualisation, F.S.; methodology, I.V. (Ilaria Vicenti), C.B. and L.F.; validation, C.B., L.F. and N.B.; formal analysis, I.V. (Ilaria Vicenti) and M.Z.; investigation, C.B., L.F., I.V. (Ilenia Varasi), C.P. and N.B.; resources, M.Z., I.V. (Ilaria Vicenti); data curation, F.S.; writing—original draft preparation, I.V. (Ilaria Vicenti), C.B. and L.F.; writing—review and editing, F.S. and M.Z.; visualisation, F.S., I.V. (Ilaria Vicenti); supervision, I.V. (Ilaria Vicenti); funding acquisition, M.Z. All authors have read and agreed to the published version of the manuscript.

Institutional Review Board Statement

Access to residual anonymized plasma samples derived from clinical practice was initially obtained through patient informed consent as approved by the local Ethics Committee at the University Hospital of Siena, Area Vasta Toscana Sud Est, R72.13, 23 November 2015.

Informed Consent Statement

Access to residual anonymised plasma samples derived from clinical practice was initially obtained through patients’ informed consent as approved by the local Ethics Committee at the University Hospital of Siena.

Data Availability Statement

Data are contained within this article and Supplementary Materials. All data not included are available on request from the corresponding author.

Conflicts of Interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Funding Statement

This work received funding from the Ministero dell’Università e della Ricerca in the context of national project (PRIN 2020), project code 202074AA2B, titled “Multidisciplinary Assessment of the blood and gut-associated HIV Reservoir and Immunity following Switch from 3-drug to 2-drug Antiretroviral regimens in virologically suppressed patients” (MARISA).

Footnotes

Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

References

  • 1.Kantor R., Gupta R.K., Author C. We Should Not Stop Considering HIV Drug Resistance Testing at Failure of First-Line Antiretroviral Therapy. Lancet HIV. 2022;10:e202–e208. doi: 10.1016/S2352-3018(22)00327-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Carr A., Mackie N.E., Paredes R., Ruxrungtham K. HIV Drug Resistance in the Era of Contemporary Antiretroviral Therapy: A Clinical Perspective. Antivir. Ther. 2023;28:13596535231201162. doi: 10.1177/13596535231201162. [DOI] [PubMed] [Google Scholar]
  • 3.Llibre J.M., Pulido F., García F., Deltoro M.G., Blanco J.L., Delgado R. Genetic Barrier to Resistance for Dolutegravir. AIDS Rev. 2015;17:56–64. [PubMed] [Google Scholar]
  • 4.Loosli T., Hossmann S., Ingle S.M., Okhai H., Kusejko K., Mouton J., Bellecave P., van Sighem A., Stecher M., John Gill M., et al. HIV-1 Drug Resistance in People on Dolutegravir-Based Antiretroviral Therapy: A Collaborative Cohort Analysis. Lancet HIV. 2023;10:e733–e741. doi: 10.1016/S2352-3018(23)00228-X. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Lapointe H.R., Dong W., Lee G.Q., Bangsberg D.R., Martin J.N., Mocello A.R., Boum Y., Karakas A., Kirkby D., Poon A.F.Y., et al. HIV Drug Resistance Testing by High-Multiplex “Wide” Sequencing on the MiSeq Instrument. Antimicrob. Agents Chemother. 2015;59:6824–6833. doi: 10.1128/AAC.01490-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Li Q., Yu F., Song C., Zhao H., Xiao Q., Lao X., Yang S., Tang Y., Zhang F. HIV-1 Genotypic Resistance Testing Using Sanger and Next-Generation Sequencing in Adults with Low-Level Viremia in China. Infect. Drug Resist. 2022;15:6711–6722. doi: 10.2147/IDR.S387215. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Fox E.J., Reid-Bayliss K.S., Emond M.J., Loeb L.A. Accuracy of Next Generation Sequencing Platforms. Next Gener Seq. Appl. 2014;1:1000106. doi: 10.4172/2469-9853.1000106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Qin D. Next-Generation Sequencing and Its Clinical Application. Cancer Biol. Med. 2019;16:4–10. doi: 10.20892/j.issn.2095-3941.2018.0055. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Ode H., Matsuda M., Matsuoka K., Hachiya A., Hattori J., Kito Y., Yokomaku Y., Iwatani Y., Sugiura W. Quasispecies Analyses of the HIV-1 Near-Full-Length Genome with Illumina MiSeq. Front. Microbiol. 2015;6:1258. doi: 10.3389/fmicb.2015.01258. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Brumme C.J., Poon A.F.Y. Promises and Pitfalls of Illumina Sequencing for HIV Resistance Genotyping. Virus Res. 2017;239:97–105. doi: 10.1016/j.virusres.2016.12.008. [DOI] [PubMed] [Google Scholar]
  • 11.Struck D., Lawyer G., Ternes A.M., Schmit J.C., Bercoff D.P. COMET: Adaptive Context-Based Modeling for Ultrafast HIV-1 Subtype Identification. Nucleic Acids Res. 2014;42:e44. doi: 10.1093/nar/gku739. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Ávila-Ríos S., Parkin N., Swanstrom R., Paredes R., Shafer R., Ji H., Kantor R. Next-Generation Sequencing for HIV Drug Resistance Testing: Laboratory, Clinical, and Implementation Considerations. Viruses. 2020;12:617. doi: 10.3390/v12060617. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Bonifacio M.A., Genchi C., Lagioia A., Talamo V., Volpe A., Mariggiò M.A. Analytical Assessment of the Vela Diagnostics NGS Assay for HIV Genotyping and Resistance Testing: The Apulian Experience. Int. J. Mol. Sci. 2022;23:2727. doi: 10.3390/ijms23052727. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Armenia D., Carioti L., Micheli V., Bon I., Allice T., Bonura C., Bruzzone B., Bracchitta F., Cerutti F., Giammanco G.M., et al. Comparison of Different HIV-1 Resistance Interpretation Tools for Next-Generation Sequencing in Italy. Viruses. 2024;16:1422. doi: 10.3390/v16091422. [DOI] [Google Scholar]
  • 15.Fogel J.M., Bonsall D., Cummings V., Bowden R., Golubchik T., De Cesare M., Wilson E.A., Gamble T., Del Rio C., Batey D.S., et al. Performance of a High-Throughput next-Generation Sequencing Method for Analysis of HIV Drug Resistance and Viral Load. J. Antimicrob. Chemother. 2020;75:3510–3516. doi: 10.1093/jac/dkaa352. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Tekin D., Gokengin D., Onay H., Erensoy S., Sertoz R. Investigation of Drug Resistance against Protease, Reverse Transcriptase, and Integrase Inhibitors by next-Generation Sequencing in HIV-Positive Patients. J. Med. Virol. 2021;93:3627–3633. doi: 10.1002/jmv.26582. [DOI] [PubMed] [Google Scholar]
  • 17.Bonsall D., Golubchik T., De Cesare M., Limbada M., Kosloff B., Macintyre-Cockett G., Hall M., Wymant C., Azim Ansari M., Abeler-Dörner L., et al. A Comprehensive Genomics Solution for HIV Surveillance and Clinical Monitoring in Low-Income Settings. J. Clin. Microbiol. 2020;58:e00382-20. doi: 10.1128/JCM.00382-20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Raymond S., Nicot F., Carcenac R., Lefebvre C., Jeanne N., Saune K., Delobel P., Izopet J. HIV-1 Genotypic Resistance Testing Using the Vela Automated next-Generation Sequencing Platform. J. Antimicrob. Chemother. 2018;73:1152–1157. doi: 10.1093/jac/dky003. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

viruses-16-01465-s001.zip (198.8KB, zip)

Data Availability Statement

Data are contained within this article and Supplementary Materials. All data not included are available on request from the corresponding author.


Articles from Viruses are provided here courtesy of Multidisciplinary Digital Publishing Institute (MDPI)

RESOURCES