Abstract
Background
Osteoarthritis (OA) is a prevalent degenerative joint disease characterized by chronic inflammation and progressive cartilage degradation, ultimately leading to joint dysfunction and disability. Oleocanthal (OC), a bioactive phenolic compound derived from extra virgin olive oil, has garnered significant attention due to its potent anti-inflammatory properties, which are comparable to those of non-steroidal anti-inflammatory drugs (NSAIDs). This study pioneers the investigation into the effects of OC on the Protease-Activated Receptor-2 (PAR-2) mediated inflammatory pathway in OA, aiming to validate its efficacy as a functional food-based therapeutic intervention.
Methods
To simulate cartilage tissue in vitro, human bone marrow-derived mesenchymal stem cells (BMSCs) were differentiated into chondrocytes. An inflammatory OA-like environment was induced in these chondrocytes using lipopolysaccharide (LPS) to mimic the pathological conditions of OA. The therapeutic effects of OC were evaluated by treating these inflamed chondrocytes with various concentrations of OC. The study focused on assessing key inflammatory markers, catabolic enzymes, and mitochondrial function to elucidate the protective mechanisms of OC. Mitochondrial function, specifically mitochondrial membrane potential (ΔΨm), was assessed using Rhodamine 123 staining, a fluorescent dye that selectively accumulates in active mitochondria. The integrity of ΔΨm serves as an indicator of mitochondrial and bioenergetic function. Additionally, Western blotting was employed to analyze protein expression levels, while real-time polymerase chain reaction (RT-PCR) was used to quantify gene expression of inflammatory cytokines and catabolic enzymes. Flow cytometry was utilized to measure cell viability and apoptosis, providing a comprehensive evaluation of OC’s therapeutic effects on chondrocytes.
Results
The results demonstrated that OC significantly downregulated PAR-2 expression in a dose-dependent manner, leading to a substantial reduction in pro-inflammatory cytokines, including TNF-α, IL-1β, and MCP-1. Furthermore, OC attenuated the expression of catabolic markers such as SOX4 and ADAMTS5, which are critically involved in cartilage matrix degradation. Importantly, OC was found to preserve mitochondrial membrane potential (ΔΨm) in chondrocytes subjected to inflammatory stress, as evidenced by Rhodamine 123 staining, indicating a protective effect on cellular bioenergetics. Additionally, OC modulated the Receptor Activator of Nuclear Factor Kappa-Β Ligand (RANKL)/Receptor Activator of Nuclear Factor Kappa-Β (RANK) pathway, suggesting a broader therapeutic action against the multifactorial pathogenesis of OA.
Conclusions
This study is the first to elucidate the modulatory effects of OC on the PAR-2 mediated inflammatory pathway in OA, revealing its potential as a multifaceted therapeutic agent that not only mitigates inflammation but also protects cartilage integrity. The preservation of mitochondrial function and modulation of the RANKL/RANK pathway further underscores OC’s comprehensive therapeutic potential in counteracting the complex pathogenesis of OA. These findings position OC as a promising candidate for integration into nutritional interventions aimed at managing OA. However, further research is warranted to fully explore OC’s therapeutic potential across different stages of OA and its long-term effects in musculoskeletal disorders.
Supplementary Information
The online version contains supplementary material available at 10.1186/s12891-024-07888-y.
Keywords: Osteoarthritis, Protease-activated receptor 2 (PAR-2), Oleocanthal, Anti-inflammatory agents, Chondrocytes, In vitro techniques, Cartilage, Signal transduction, Phenols, Inflammation mediators, Extracellular matrix, Mitochondrial membrane potential
Introduction
The Mediterranean diet (MD), characterized by high consumption of fruits, vegetables, legumes, whole grains, fish, and particularly extra virgin olive oil (EVOO), has long been associated with numerous health benefits, including the prevention of metabolic and cardiovascular diseases [1–3]. A growing body of evidence suggests that the MD may also play a protective role in the management of osteoarthritis (OA), a degenerative joint disease marked by inflammation and cartilage breakdown [4, 5].
Clinical studies have indicated that adherence to the MD correlates with reduced inflammation and may influence the onset and progression of knee OA [6]. The anti-inflammatory effects of the MD are thought to be mediated in part by the bioactive compounds found in EVOO, such as oleocanthal (OC) [7, 8].
OC, a phenolic compound predominantly present in EVOO, imparts the oil’s characteristic bitter flavour and possesses potent anti-inflammatory attributes, chiefly attributed to its ability to inhibit cyclooxygenase (COX), which are comparable to those of non-steroidal anti-inflammatory drugs [9], and its potential therapeutic effects on joint health [10]. OC has also been shown to reduce inflammation and inhibit key enzymes contributing to OA without being cytotoxic, by acting through the MAPK/P38/NF-kB pathways, to prevent disease progression in cartilage [10].
Recently, our research has highlighted the central role of Proteinase-Activated Receptor 2 (PAR2) in the process of inflammation in OA [11, 12]. Activation of PAR2 leads to the upregulation of proinflammatory cytokines such as Tumour Necrosis Factor (TNF)-α, interleukin (IL)-6, and IL-8, and the consequent increase in the expression of RANKL (receptor activator of nuclear factor kappa beta (NFkB ligand)) and RANK. This pathway is further intensified by TNF-α-induced stimulation, contributing to escalated levels of IFNγ, which in turn boosts RANKL expression [12]. Our findings also indicated that mitigating the expression of PAR2 could be a strategic approach in managing the inflammatory response in OA [11, 12], potentially opening new avenues for treatment and management of this condition.
The aim of this study was to explore the effects of OC on the PAR2-mediated inflammatory pathway in OA. Our focus was to examine how OC interacts with this pathway, particularly in terms of its impact on key inflammatory markers. This research aimed to provide insights into the potential use of OC for effectively managing inflammation in OA.
Materials and methods
Study–type
This study was designed as a cross-sectional in vitro experimental investigation. The primary aim was to evaluate the immediate effects of OC on the expression and secretion of inflammation markers in human chondrocytes. The cross-sectional design allowed us to measure these effects at a single point in time, providing a snapshot of OC’s impact on the inflammatory pathways relevant to OA. This approach was instrumental in determining the potential efficacy of OC as a functional food intervention in modulating inflammation without the need for longitudinal or follow-up studies.
Ethics consideration for the present study
The experimental procedures in this research were carried out in vitro and did not entail the utilization of animal models, patient samples, or human subjects. As a result, the study presented minimal risk and falls within one of the exempt review categories outlined by the institutional review board (IRB) regulations at Mohammed Bin Rashid University of Medicine and Health Sciences (MBRU). For additional details and clarification, inquiries can be directed to the MBRU IRB at irb@mbru.ac.ae.
The study exclusively utilized in vitro experiments with readily available cell lines, eliminating the involvement of human subjects. It is essential to highlight that no individuals under the age of 18 were part of the study, rendering parental or guardian consent unnecessary. The experiments conducted did not include any form of direct or indirect interaction with human subjects. It’s crucial to emphasize that our research did not require access to medical records or archived samples.
In summary, our study focused on in vitro experiments using commercially acquired cell lines and did not entail the participation of human subjects. Consequently, participant consent was not deemed necessary, and the requirement for consent was waived.
Cell culture
The human bone marrow mesenchymal stem cell line (BMSC) was procured from AddexBio Technologies, San Diego, California, USA, and upon receipt in liquid nitrogen, a thorough wash with phosphate-buffered saline (PBS, Gibco; Thermo Fisher Scientific, Waltham, Massachusetts, USA) was immediately conducted to eliminate any residues of the cryoprotectant Dimethyl Sulfoxide (DMSO). Subsequently, the washed cells were cultured in mesenchymal stem cell growth media (MSCM) (AddexBio Technologies, San Diego, California, USA) supplemented with 10% foetal bovine serum (FBS, Himedia, Mumbai, Maharashtra, India), and 1% penicillin-streptomycin antibiotic solution (Himedia, Mumbai, Maharashtra, India). Following the addition of MSCM, the cells were placed in an incubator set at 37 °C temperature and 5% CO2. The culture medium was refreshed every three days, and the confluency of the cells was carefully monitored. When the cells reached 90% confluency, proteolytic enzyme trypsin, was introduced to detach the adherent cells from the culture flask. The trypsinization process utilized trypsin/EDTA solution (Himedia, Mumbai, Maharashtra, India). The detached cells were then sub-cultured to facilitate further growth in MSCM.
Differentiation of BMSCs to chondrocytes
The differentiation of BMSCs into chondrocytes were carried out in accordance with the procedure standardized in our laboratory earlier [13].
Upon receiving the human BMSC line in liquid nitrogen, they were immediately washed with PBS to ensure that the cells were free from the cryoprotectant dimethyl sulfoxide. The washed cells were then cultured in Mesenchymal stem cell growth media (MSCM) (Himedia, Mumbai, Maharashtra, India) supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin antibiotic solution. After the addition of MSCM, the cells were kept in an incubator at 37 °C and 5% carbon dioxide. The cell culture medium was replaced with fresh medium at an interval of 3 days, and their confluency was appraised. Once the cells reached 90% confluence, the proteolytic enzyme trypsin was added to dislodge the adherent cells from the culture flask. Trypsinization was performed using trypsin and ethylenediaminetetraacetic acid solution. The detached cells were subcultured for further growth in MSCM.
In this study, we cultured cells as pellets in 15-mL tubes, instead of using a monolayer culture. Although we did not use a matrix gel or scaffold, our cell culture system can be categorized as a “simple 3D cell culture system.” In this pellet culture system, cells are aggregated and allowed to form spheroids or clusters, promoting cell-cell and cell-ECM interactions that more closely resemble the in vivo cellular environment compared with traditional 2D monolayer cultures [14].
After 5 passages of subculture (passage 5), the BMSCs were used for chondrogenic differentiation. For chondrogenic differentiation, 2 × 106 BMSCs (estimated using an automated cell counter (DeNovix, Cell Drop, Wilmington, Delaware, United States) were pelleted in 15-mL polypropylene tubes after centrifugation at 1000 rpm for 10 min. In total, 2 mL of complete MSCM chondrogenic differentiation medium (Stem Cell Technologies, Vancouver, British Columbia, Canada) was added to the cell pellet, from which 0.5 mL of the cell suspension was added to each 15-mL polypropylene tube (4 in total) for “in-tube” differentiation. Each of these tubes was centrifuged at 1000 rpm for 10 min at 25 °C using a Microfuge 20 centrifuge (Beckman Coulter, Brea, California, USA). Caps of the tubes were gently loosened, and the tubes were incubated at 37 °C in the presence of 5% carbon dioxide to ensure that there were no alterations in the pH of the cell culture media. After 3 days of incubation, 0.5 mL of complete MSCM chondrogenic differentiation medium was added to the tubes, followed by incubation at 37 °C in the presence of 5% CO₂ for 3 days. After incubation, the cell culture medium was carefully aspirated from each tube, and 0.5 mL of fresh MSCM chondrogenic differentiation medium was added. The tubes were further incubated at 37 °C in the presence of 5% CO₂ for 21 days, with intermittent replacement (at 3-day intervals) of cell culture medium with fresh MSCM chondrogenic differentiation medium. After each change of cell culture medium, the differentiating cell pellets were gently “flicked” to ensure that the pellets did not adhere to the tube surfaces. After 21 days of incubation, the cell pellets, which were at the stage of chondrogenic differentiation to prechondrocytes, were further incubated for 7 days.
For cryopreservation, chondrocytes were pelleted through centrifugation at 1000 rpm for 10 min, suspended in freezing medium (Dulbecco’s Modified Eagle’s Medium with 5% DMSO, Himedia, Mumbai, India), and stored overnight in cryovials at -80 °C before subsequent long-term storage in liquid nitrogen.
Preparation and analysis of histological samples of chondrocytes
The histological preparations included fixing cell pellets in 10% neutral-buffered formalin for 24 h, followed by a series of processes such as graded ethanol dehydration, xylene clarification, and paraffin embedding. Sections with a thickness of 6 μm were sliced using a microtome (Leica RM2255, Nussloch, Baden-Württemberg, Germany).
For collagen type II staining, the rehydrated sections were incubated with an anti-rabbit anti-collagen II antibody (Antibodies-Online, GmBH, Aachen, North Rhine-Westphalia, Germany), diluted in 2% BSA (Sigma, St. Louis, Missouri, USA), for overnight at 4 °C. After incubation, the sections were washed in PBS to remove unbound antibody. Then, the sections were incubated for 1 h at room temperature using horseradish peroxidase-conjugated secondary antibody (Abcam, Waltham, Massachusetts, USA). The sections were again washed in PBS to remove excess secondary antibody. Finally, the sections were counterstained with hematoxylin (Merck & Co., Inc, Rahway, New Jersey, USA) and observed under a light microscope.
Staining procedures for Alcian Blue (Abcam, Waltham, Massachusetts, USA) and Toluidine Blue (Abcam, Waltham, Massachusetts, USA) were conducted in accordance with established protocols [13]. Stained sections were observed using an Olympus BX63 microscope fitted with an Olympus DP80 camera (Olympus, Tokyo, Japan). Image capture was performed using Cell Sens Dimension 2.3 software, employing 20X and 40X objective lenses.
Assessment of cytotoxicity using MTT assay
We evaluated the cytotoxic effects of OC and assessed LPS separately for its use in creating a pro-inflammatory chondrocyte model. This was done through the 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay (Thermo Fisher Scientific, Waltham, Massachusetts, USA), following a standard protocol [13]. After treating chondrocytes with different doses of OC and LPS, and incubating with MTT solution, we measured the optical density at a wavelength of 570 nm to assess cell viability.
Generation of inflammatory chondrocyte model
The inflammatory chondrocyte model was created employing the methodology standardised and validated in our earlier studies [11, 13]. Briefly, LPS (Thermo Fisher Scientific, Waltham, Massachusetts, USA) at a 10 µg/mL concentration was applied to differentiated chondrocytes to induce inflammation, generating the model. We avoided higher LPS doses to prevent overstimulation, excessive inflammation, and potential cell death, which could obscure experimental outcomes [15]. The cells were then incubated at 37 °C with 5% CO₂ for 24 h.
Cytokine and aggrecan expression study
In our research, we aimed to elucidate the role of OC in modulating the expression of pro-inflammatory cytokines and aggrecan in the context of OA, with a particular focus on its anti-inflammatory functions. OA is characterized by the degradation of cartilage and underlying bone within the joint, leading to pain and loss of function. The inflammatory environment within the OA joint, including the elevated levels of pro-inflammatory cytokines such as Tumour Necrosis Factor-α (TNF- α), Interleukin-1β (IL-1β), and Monocyte Chemoattractant Protein-1 (MCP-1), plays a crucial role in the progression of this disease.
Aggrecan, a major component of the cartilage extracellular matrix, provides the tissue with its load-bearing properties. However, its degradation by aggrecanases and matrix metalloproteinases (MMPs) is a hallmark of OA, contributing to the pathology of joint destruction.
Chondrocytes were cultured in a 6-well culture plate and treated with 10 µg/mL LPS for 24 h, subsequently receiving OC treatment at concentrations of 0.1, 10, 20, and 40 µg/mL for another 24 h.
Following culture, chondrocyte supernatants were centrifuged at 5000 rpm for 10 min to collect samples. Cytokine, and aggrecan levels were quantitatively analysed in the supernatant using commercial ELISA kits according to the manufacturer’s instructions (Abcam, Waltham, Massachusetts, USA).
Briefly, microtiter plates pre-coated with antibodies specific to human cytokines were used for this assay. Cytokine levels were determined by measuring optical densities with a Hidex microplate reader (Hidex, Turku, Southwest Finland, Finland) at an absorbance of 450 nm and a reference of 620 nm. Experiments were performed in triplicate, with results presented as means ± standard deviations. Statistical analyses were conducted using GraphPad Prism software, (version 9.5.1) (San Diego, California, USA).
RNA extraction and cDNA synthesis
Total RNA was extracted from both control and inflammatory chondrocytes, before and after OC treatment, using total RNA isolation kit (NZYTech, Lisbon, Lisbon District, Portugal). RNA quality and integrity were assessed using Nanodrop Spectrophotometer (Thermo Scientific, Waltham, Massachusetts, USA). High-quality RNA samples were reverse-transcribed into cDNA using the First-Strand cDNA Synthesis kit (OriGene, Heidelberg, Baden-Württemberg, Germany), according to the manufacturer’s instructions [16].
Real-time quantitative PCR (qPCR)
qPCR assays were meticulously conducted using the QuantStudio 5 Flex Real-Time PCR System (Applied Biosystems; Thermo Fisher Scientific, Waltham, Massachusetts, USA). Primers for the genes of interest (Table 1), were designed employing OriGene’s proprietary primer design algorithm, which is distinguished for its algorithmic precision in optimizing parameters such as melting temperature (Tm), GC content, primer length, and the avoidance of secondary structures, thereby ensuring high specificity and amplification efficiency. Although the proprietary nature of this algorithm limits the disclosure of its internal mechanics, its design principles align with the best practices in primer design to maximize the likelihood of successful amplification and minimize non-specific interactions [17].
Table 1.
Oligonucleotide primers used for real Time-PCR
| Gene | Primer Type | Sequence | Accession | E-value | Bit Score |
|---|---|---|---|---|---|
| GAPDH |
Forward (5’-3’) Reverse (5’-3’) |
GTCTCCTCTGACTTCAACAGCG ACCACCCTGTTGCTGTAGCCAA |
NM_002046 | 0.0 | 2374 |
| TNF α |
Forward (5’-3’) Reverse (5’-3’) |
CTCTTCTGCCTGCTGCACTTTG ATGGGCTACAGGCTTGTCACTC |
NM_000594 | 0.0 | 2449 |
| IL 1β |
Forward (5’-3’) Reverse (5’-3’) |
CCACAGACCTTCCAGGAGAATG GTGCAGTTCAGTGATCGTACAGG |
NM_000576 | 0.0 | 2292 |
| MCP 1 |
Forward (5’-3’) Reverse (5’-3’) |
AGAATCACCAGCAGCAAGTGTCC TCCTGAACCCACTTCTGCTTGG |
NM_002982 | 0.0 | 1339 |
GAPDH: Glyceraldehyde-3-phosphate dehydrogenase; TNF α: Tumor Necrosis Factor α; IL 1β: Interleukin 1 Beta; MCP 1: Monocyte Chemoattractant Protein-1
To rigorously validate the specificity and quality of the primers, we conducted in silico analyses focusing on two pivotal bioinformatics metrics: the Expectation value (E-value) and the Bit score. The E-value is a critical parameter derived from sequence alignment algorithms, specifically calculated within the BLAST (Basic Local Alignment Search Tool) framework. It represents the expected number of alignments with a score equal to or better than a given score that could occur purely by chance within a specified database. An E-value nearing zero is indicative of a statistically significant alignment, underscoring the primer’s high specificity for its target sequence by denoting a minimal probability of non-specific binding or random alignment events [18]. The Bit score, conversely, is a normalized score derived from the raw alignment score, which is then adjusted for the size of the search space and the scoring matrix employed. The Bit score encapsulates the relative strength of the alignment, with higher values correlating with more robust and statistically significant sequence homology, thereby reinforcing the primer’s capability to specifically anneal to the intended target [18].
In our analyses, the primers demonstrated exceptionally low E-values, approaching zero, coupled with high Bit scores (Table 1), thereby validating their design as both specific and efficient for the amplification of the desired targets. Such characteristics ensure that these primers are highly selective for their target sequences, minimizing the risk of off-target amplification and thereby enhancing the overall reliability and precision of the qPCR assays.
All qPCR reactions were performed in technical replicates, incorporating no-template controls to meticulously monitor for any potential contamination. The relative expression levels of the target genes were calculated using the 2−ΔΔCt method, a quantitative approach that normalizes gene expression data to the housekeeping gene, GAPDH, providing a robust framework for the accurate assessment of gene expression changes induced by OC treatment in the inflammatory chondrocyte model [19].
Western blotting
Total proteins were extracted with lysis buffer containing 0.5% Sodium Dodecyl Sulphate (SDS) (Invitrogen (Thermo Fisher Scientific), Carlsbad, California, USA) supplemented with protease inhibitors to prevent protein degradation. Bicinchoninic Acid (BCA) assay was employed for quantitative assessment of protein concentration, ensuring normalization across experiments.
We evaluated the effects of OC at concentrations of 20 µg/mL and 40 µg/mL on the inflammatory chondrocyte model, concentrations chosen based on preliminary experiments (data not shown) where OC exhibited maximal anti-inflammatory activity. For electrophoretic analysis, 15 µg of normalized protein samples were subjected to 10% SDS-Polyacrylamide Gel Electrophoresis (SDS-PAGE). Subsequently the separated proteins were transferred to nitrocellulose membranes (Bio-Rad Laboratories, Mississauga, Ontario, Canada).
After transferring the proteins, membranes were blocked with 5% Bovine Serum Albumin (BSA) solution in Tris-Buffered Saline (TBS) ( Pierce Biotechnology (Thermo Fisher Scientific), Rockford, Illinois, USA) for 60 min at 4 °C. This was followed by a 10-minute wash in Tris-Buffered Saline with 0.1% Tween 20 (Sigma, St. Louis, Missouri, USA) (TTBS). For primary antibody incubation membranes were treated with Superblock (1:10 dilution in TTBS) containing mouse anti-human Collagen Type II, PAR-2, SOX4 and rabbit anti-human ADAMTS5 antibodies (Abcam, Waltham, Massachusetts, USA) at 1:1000 dilution, and incubated overnight at 4 °C.
Post-primary antibody treatment, membranes were TTBS-washed and then incubated with HRP-conjugated anti-mouse/rabbit IgG secondary antibodies (Abcam, Waltham, Massachusetts, USA) (1:2000) for 1 h at room temperature. After TTBS washes, chemiluminescence was detected using the SuperSignal ULTRA (Pierce Biotechnology (Thermo Fisher Scientific), Rockford, Illinois, USA) with images captured on Kodak Biomax film (GE Healthcare, Mississauga, Ontario, Canada). Densitometric analysis of Collagen Type II, PAR2, SOX4, and ADAMTS5 band intensities was conducted using ImageJ (National Institutes of Health (NIH), Bethesda, Maryland, USA). The results were normalized to GAPDH expression, and the ratios (Protein expression to GAPDH) were presented in one graph for comparative analysis. All western blot experiments were run in triplicates to ensure reproducibility and reliability of the data.
Rhodamine 123 staining for assessment of mitochondrial membrane potential (ΔΨm)
Rhodamine 123 staining was conducted to assess the effect of OC on ΔΨm in the inflammatory chondrocyte model. The model was treated with 20 and 40 µg/mL OC. Following three washes with PBS, cells were stained with 2 µM Rhodamine 123 (Thermo Fisher, Carlsbad, California, USA) for 15 min at room temperature. Subsequently several PBS washes were carried out to remove any unbound dye. Fluorescent images were captured on Olympus fluorescence microscope (Olympus, Tokyo, Japan). ImageJ (National Institutes of Health (NIH), Bethesda, Maryland, USA) was used for quantitative assessment of fluorescence intensity. The dissipation of ΔΨm was quantified as a percentage, indicating the reduction in green Rhodamine 123 fluorescence intensity [20].
Flow cytometric analysis of RANK and RANKL expression
Cells were washed with 1X PBS and detached with trypsin/EDTA solution (HiMedia Laboratories Pvt. Ltd., Mumbai, Maharashtra, India) at 37 °C, followed by centrifugation at 500 g for 5 min at 4 °C. They were then re-suspended in 1X PBS, to prepare a 500 µL suspension at a concentration of 1 × 106 cells/mL, incubated at room temperature for 30 min, and divided into tubes for analysis.
To evaluate RANK and RANKL expressions, one tube served as a negative control, adding mouse IgG (15 µg/mL; Abcam, Waltham, Massachusetts, USA) for RANKL and mouse IgG coupled to phycoerythrin (IgG-PE: 20 µg/ml; Abcam, Waltham, Massachusetts, USA) for RANK. The experimental tube was treated with a mouse anti-human RANKL antibody(15 µg/ml; Abcam, Waltham, Massachusetts, USA) or mouse anti-human RANK-PE (20 µg/mL; Abcam, Waltham, Massachusetts, USA) for 30 min at 4 °C. For RANKL detection, after incubation, cells were washed and incubated with a goat anti-mouse FITC-conjugated secondary antibody (7.5 µg/mL; Abcam, Waltham, Massachusetts, USA) for another 30 min at 4 °C. Finally, cells were re-suspended in PBS for flow cytometry analysis (Facscalibur; BD Biosciences, Mississauga, Ontario, Canada), using the control to establish background fluorescence for comparison with the antibody-treated samples.
Statistical analysis and validation
In the present investigation, the data were analyzed using appropriate statistical methods to ensure the reliability and validity of the results. All quantitative data were expressed as means ± standard deviations (SD) of at least three independent experiments, each performed in triplicate. The primary statistical method employed was the Student’s t-test, which was used to compare the means between two groups—typically the control and treated groups [21]. A p-value of less than 0.05 was considered statistically significant, indicating a less than 5% probability that the observed differences were due to chance [22].
The t-test was chosen for its robustness in assessing differences in means, particularly when comparing small sample sizes, which is often the case in in vitro studies [23]. All statistical analyses were conducted using GraphPad Prism software (version 9.5.1) (San Diego, California, USA) which provided tools for precise calculation of p-values and confidence intervals. The results of these analyses were used to validate the findings and ensure that any observed effects of OC on inflammatory markers and chondrocyte health were statistically supported. Additionally, post-hoc analysis was conducted when multiple comparisons were made to adjust for potential Type I errors. This rigorous approach to statistical analysis ensures the credibility and reproducibility of the study’s conclusions.
Results
Creation of the inflammatory chondrocyte model
BMSCs were successfully differentiated into chondrocytes using chondrogenic differentiation media. To confirm the successful differentiation of BMSCs into chondrocytes, we employed three distinct staining methods: Collagen Type II staining, Alcian Blue staining, and Toluidine Blue staining (Figures 1A to D). Each of these staining techniques serves a specific purpose in assessing different components of the ECM and cellular differentiation markers, providing a comprehensive evaluation of chondrocyte differentiation.
Fig. 1.
This figure provides a comprehensive view of chondrocyte differentiation from bone marrow-derived mesenchymal stem cells (BM-MSCs) and the cytotoxicity assessment following treatments with lipopolysaccharide (LPS) and Oleocanthal (OC). Panels illustrate the following: (A) Morphological characteristics of chondrocytes differentiated from BM-MSCs over a 28-day period, highlighting the successful induction of chondrogenic lineage; (B) Microscopy images of differentiated chondrocytes stained with type II Collagen to reveal the presence of Collagen, a key component of cartilage extracellular matrix; (C) Microscopy images of differentiated chondrocytes stained with alcian blue, indicating the production of glycosaminoglycans (GAGs), essential cartilage matrix component; (D) Microscopy images of differentiated chondrocytes stained with toluidine blue, indicating the production of proteoglycans, another essential cartilage matrix component; (E) Quantitative analysis of live cell density following exposure to various concentrations of LPS, demonstrating the resilience of differentiated chondrocytes to LPS-induced cytotoxicity; (F) Quantitative analysis of live cell density following exposure to various concentrations of OC, also showing no significant cytotoxic effects at the tested concentrations. (Note: For insets E and F student’s t-test was performed on each experimental dataset, resulting in a significance level denoted by *, where p-value is < 0.05.)
The primary purpose of Collagen Type II staining was to confirm the presence of Type II collagen, a definitive marker of chondrocytes and the ECM in hyaline cartilage [24]. Type II collagen is the most abundant collagen in cartilage and plays a crucial role in maintaining the structural integrity and biomechanical properties of the cartilage tissue. The use of an anti-collagen II antibody allows for the specific detection of this collagen type, ensuring that the cells have differentiated correctly into chondrocytes. This staining method provided direct evidence that the BMSCs have produced a cartilage-specific ECM, a key indicator of successful chondrogenic differentiation.
Alcian Blue staining was employed to detect GAGs within the ECM, which are vital components of cartilage [25]. GAGs, such as chondroitin sulfate and keratan sulfate, are sulfated polysaccharides that contribute to the gel-like structure of cartilage, providing resilience and the ability to withstand compressive forces. Alcian Blue is a cationic dye that binds specifically to the negatively charged sulfate groups of GAGs, allowing for their visualization within the ECM. The presence of GAGs is an important marker of chondrocyte differentiation, as these molecules are synthesized and secreted by chondrocytes to form the ECM. Alcian Blue staining, therefore, complements Collagen Type II staining by confirming the production of another key ECM component indicative of chondrogenesis.
Toluidine Blue staining was used to further assess the presence of GAGs and proteoglycans within the ECM, with a specific focus on metachromasia [26]. Toluidine Blue is a basic thiazine dye that exhibits metachromasia, meaning it changes color when bound to certain substrates, such as GAGs. In the presence of high concentrations of GAGs, Toluidine Blue shifts from blue to purple, providing a visual indication of the density and distribution of GAGs within the ECM. This staining method is particularly useful for evaluating the extent of chondrocyte differentiation, as it highlights the synthesis and organization of GAGs within the matrix. The metachromatic shift observed with Toluidine Blue staining serves as an additional validation of the chondrocytic phenotype.
In summary, the use of these three staining techniques—Collagen Type II staining, Alcian Blue staining, and Toluidine Blue staining—allowed for a comprehensive assessment of chondrocyte differentiation.
Figure 1B, shows the results of Collagen Type II staining. Collagen Type II is the primary collagen found in hyaline cartilage and is a definitive marker of chondrocyte differentiation. The red staining observed in the image indicates the presence of Type II collagen within the ECM produced by the differentiated chondrocytes. This staining confirms that the BMSCs have successfully differentiated into chondrocytes capable of producing cartilage-specific ECM components.
The blue staining in Figure 1C indicates the presence of these GAGs, confirming the synthesis and secretion of ECM components typical of chondrocytes. This staining provides additional evidence of successful chondrocyte differentiation and ECM production.
The intense purple staining observed in Figure 1D indicates a high concentration of GAGs within the ECM, which is characteristic of chondrocytes. The metachromatic properties of Toluidine Blue provide a visual confirmation of the synthesis and organization of GAGs within the matrix, further validating the chondrocytic phenotype of the differentiated cells.
In summary, these staining methods (Collagen II, Alcian Blue, and Toluidine Blue) comprehensively confirm the successful differentiation of BMSCs into chondrocytes. Collagen II staining verifies the presence of cartilage-specific collagen, Alcian Blue confirms the production of GAGs, and Toluidine Blue highlights the organization and density of these GAGs within the ECM.
Cytotoxicity evaluation of for LPS and OC using MTT assay
The MTT assay was used to assess the cytotoxic potential of LPS and OC in BMSCs differentiated into chondrocytes. LPS (0–40 µg/mL) and OC (0–100 µg/mL) showed no cytotoxic effects over the tested concentration ranges (Figure 1E and F). These results support the safety of LPS for establishing a pro-inflammatory chondrocyte model and the potential of OC as a non-cytotoxic anti-inflammatory agent for OA.
Effect of oleocanthal on type II collagen expression in chondrocytes
The expression of type II collagen, a critical component of cartilage ECM, was assessed to determine the protective effects of OC on chondrocytes under inflammatory conditions. The results demonstrate a significant impact of OC on maintaining type II collagen expression in chondrocytes subjected to LPS-induced inflammation.
As depicted in the Western blot analysis (Fig. 2A), LPS-treated chondrocytes exhibited a marked decrease in type II collagen expression compared to untreated control cells, reflecting the detrimental effects of inflammation on cartilage ECM integrity. This reduction in collagen expression highlights the catabolic state induced by LPS, which mimics the inflammatory environment characteristic of OA.
Fig. 2.
Effect of OC on type II collagen expression. (A) Western blot depicting the expression of type II collagen in control, LPS-treated chondrocytes, and chondrocytes treated with 20 µg/mL and 40 µg/mL OC. (B): Western blot depicting the expression of GAPDH in control, LPS-treated chondrocytes, and chondrocytes treated with 20 µg/mL and 40 µg/mL OC. (C):Densitometric analysis of type II collagen expression from the Western blot normalized with GAPDH, highlighting dose-dependent restoration of type II collagen expression upon treatment with OC. Student’s t-test was performed on each experimental dataset, resulting in a significance level denoted by * and **, where (*) denotes p-value is < 0.05 and(**) denotes p-value is < 0.01
However, treatment with OC at both 20 µg/mL and 40 µg/mL concentrations resulted in a notable restoration of type II collagen levels in inflammatory chondrocytes. Specifically, OC treatment not only mitigated the LPS-induced suppression of collagen expression but also increased collagen II levels in a dose-dependent manner. The densitometric analysis (Fig. 2C) further quantifies this effect, showing that collagen II expression normalized to GAPDH significantly improved with OC treatment. Chondrocytes treated with 40 µg/mL OC exhibited collagen II levels approaching or even surpassing those of the untreated control cells, indicating a robust protective effect.
These findings underscore the potential of OC as a therapeutic agent capable of preserving cartilage integrity by maintaining ECM composition, particularly under inflammatory conditions that compromise cartilage function. By enhancing the expression of type II collagen, OC may contribute to the prevention of cartilage degradation and the progression of OA, highlighting its promise as a functional food intervention for joint health.
Oleocanthal suppresses PAR-2 expression in a dose-dependent manner
We investigated the effect of OC on PAR-2 expression in chondrocytes. Western blot analysis demonstrated a significant reduction in PAR-2 protein levels in OC treated cells relative to the LPS-induced inflammatory control). This downregulation of PAR-2 expression exhibited a dose-dependent response, with higher concentrations of OC (40 µg/mL) eliciting a greater effect compared to lower concentrations (20 µg/mL) (Figure 3). Densitometric quantification of Western blots confirmed these observations (Figure 3). GAPDH served as a loading control and demonstrated consistent expression across treatments, validating the specificity of OC’s effect on PAR-2 (Figure 3).
Fig. 3.
Effect of OC on PAR2 Expression. (A) Western blot depicting the expression of PAR2 in control, LPS-treated chondrocytes, and chondrocytes treated with 20 µg/mL and 40 µg/mL OC. (B): Western blot depicting the expression of GAPDH in control, LPS-treated chondrocytes, and chondrocytes treated with 20 µg/mL and 40 µg/mL OC. (C):Densitometric analysis of PAR2 expression from the Western blot normalized with GAPDH, highlighting dose-dependent inhibition of PAR2 expression upon treatment with OC. Student’s t-test was performed on each experimental dataset, resulting in a significance level denoted by * and **, where (*) denotes p-value is < 0.05 and (**) denotes p-value is < 0.01
Dose-dependent anti-inflammatory effects of OC on pro-inflammatory cytokines and aggrecan
We assessed the anti-inflammatory effects of OC on pro-inflammatory cytokine and aggrecan expression in the inflammatory chondrocyte model. A dose-dependent decrease in both cytokine and aggrecan expression was observed (Table 2). Chondrocyte cultures were treated with varying concentrations of OC (0, 1, 10, 20, and 40 µg/mL). Cytokine expression was quantified and normalized to the control group (0 µg/mL OC), which served as the 100% baseline for comparison.
Table 2.
Anti-inflammatory response of Oleocanthal (OC), in proinflammatory chondrocyte model
| OC Doses (µM) | Percentage of TNF-α secretion (± SD) | Percentage of IL 1β secretion (± SD) | Percentage of MCP-1 secretion (± SD) | Percentage of Aggrecan secretion (± SD) |
|---|---|---|---|---|
| 0 | 100 (± 0.94) | 100 (± 0.4) | 100 (± 0) | 100 (± 0) |
| 1 | 93.4 (± 2.3) | 92.1 (± 2.3) | 94.6 (± 3.4) | 88.3 (± 2.9) |
| 10 | 78.3 (± 3.8) | 83.2 (± 3.1) | 77.3 (± 2.8) | 74.8 (± 4.6) |
| 20 | 49.2 (± 2.1) | 60.9(± 1.8) | 53.1(± 1.3) | 52.4 (± 3.2) |
| 40 | 33.7 (± 1.8) | 44.7 (± 2.6) | 36.4 (± 2.8) | 41.3 (± 2.9) |
Note: The data are represented as the mean ± SD of at least three independent experiments
(Note: Increasing concentrations of the OC, attenuates tumour necrosis factor-α [TNF-α], Interleukin 1 β, Monocyte chemoattractant protein-1 (MCP 1) and aggrecan secretion.)
Treatment with 1 µg/mL OC maintained cytokine expression near baseline levels (Table 2). Substantial reductions were observed with increasing OC concentrations. At 10 µg/mL, TNF-α secretion decreased to 78.3% (± 3.8), IL-1β to 83.2% (± 3.1), MCP-1 to 77.3% (± 2.8), and aggrecan to 74.8% (± 4.6) compared to the untreated control (Table 2). The anti-inflammatory effect intensified at 20 µg/mL, with further reductions in TNF-α to 33.7% (± 1.8), IL-1β to 44.7% (± 2.6), MCP-1 to 36.4% (± 2.8), and aggrecan to 41.3% (± 2.9) (Table 2). The most significant suppression of cytokine secretion occurred at the highest concentration of 40 µg/mL (Table 2). Here, TNF-α expression was reduced to 33.7% (± 1.8), representing a 66.3% decrease from the control. IL-1β expression was reduced to 44.7% (± 2.6), a 55.3% decrease. Similarly, MCP-1 levels diminished to 36.4% (± 2.8), a 63.6% reduction. Expression of aggrecan in the supernatant decreased to 41.3% (± 2.9), a 58.7% decline from baseline levels (Table 2). These results demonstrate OC’s potent anti-inflammatory properties, highlighted by the dose-dependent suppression of pro-inflammatory cytokines.
Alteration in gene expression by OC in inflammatory chondrocyte model
To investigate the effects of OC on pro-inflammatory cytokine expression in the inflammatory chondrocyte model, we performed RT-PCR analysis of TNF-α, IL-1β, and MCP-1 genes. These cytokines were chosen due to their established roles in cartilage degradation and joint inflammation. LPS stimulation significantly increased the expression of all three cytokines: TNF-α (9.87-fold), IL-1β (8.8-fold), and MCP-1 (9.18-fold) compared to untreated controls. OC treatment dose-dependently reduced this LPS-induced expression. At 20 µg/mL, OC decreased TNF-α to 8.88-fold, IL-1β to 6.3-fold, and MCP-1 to 8.1-fold. A more pronounced suppression was observed at 40 µg/mL OC: TNF-α (4.85-fold), IL-1β (2.5-fold), and MCP-1 (1.9-fold). These findings demonstrate OC’s dose-dependent downregulation of key pro-inflammatory cytokine genes (Figure 4), demonstrating OC’s potential as a therapeutic agent for mitigating inflammation associated with OA.
Fig. 4.
Modulation of Inflammatory Cytokine mRNA Expression by Oleocanthal in Chondrocytes as Detected by RT-PCR. The figure illustrates the relative expression levels of mRNA for key inflammatory cytokines—TNFα, IL1β, and MCP1—in chondrocytes under different treatment conditions. The expression levels are presented as fold changes relative to the untreated control group. The results are organized as follows: Control: Baseline expression levels in untreated chondrocytes LPS-treated Chondrocytes: Expression levels in chondrocytes stimulated with lipopolysaccharide (LPS), serving as an inflammatory model; Inflammatory Chondrocytes after 20 µg/mL Oleocanthal Treatment: Expression levels in LPS-stimulated chondrocytes post-treatment with 20 µg/mL oleocanthal; Inflammatory Chondrocytes after 40 µg/mL Oleocanthal Treatment: Expression levels in LPS-stimulated chondrocytes post-treatment with 40 µg/mL oleocanthal. (Note: The bar graph data indicates that oleocanthal treatment results in a dose-dependent reduction in the mRNA expression of TNFα, IL1β, and MCP1 compared to the LPS-only treated group. The significant downregulation of these pro-inflammatory cytokines at higher oleocanthal concentrations suggests its potential anti-inflammatory effect These RT-PCR findings provide insights into the molecular mechanisms by which oleocanthal may exert its therapeutic effects in inflammatory conditions of chondrocytes.) Student’s t-test was conducted to assess statistical significance. A single asterisk (*) denotes a p-value less than 0.05, while a double asterisk (**) indicates a p-value less than 0.01. Each experiment was repeated three times
OC downregulates SOX4 expression in inflammatory chondrocyte model
Western blot analysis demonstrated that OC dose-dependently reduced SOX4 protein expression in the inflammatory chondrocyte model (Figure 5). Compared to the LPS-induced upregulation of SOX4, OC treatment resulted in a decrease in SOX4 levels, with a more pronounced effect observed at 40 µg/mL (Figure 5). Densitometric analysis confirmed these findings. GAPDH served as a loading control for normalization, with consistent expression across treatments. This validates the specificity of OC’s effect on SOX4 (Figure 5).
Fig. 5.
Effect of OC on SOX4 Expression. (A): Western blot depicting the expression of SOX4 in control, LPS-treated chondrocytes, and chondrocytes treated with 20 µg/mL and 40 µg/mL OC. (B): Western blot depicting the expression of GAPDH in control, LPS-treated chondrocytes, and chondrocytes treated with 20 µg/mL and 40 µg/mL OC. (C):Densitometric analysis of SOX4 expression from the Western blot normalized with GAPDH, highlighting dose-dependent inhibition of SOX4 expression upon treatment with OC. Student’s t-test was performed on each experimental dataset, resulting in a significance level denoted by * and **, where (*) denotes p-value is < 0.05 and (**) denotes p-value is < 0.01
SOX4 promotes cartilage degradation in OA [27], and our results indicate that OC modulates SOX4 expression, suggesting its potential to advantageously influence OA pathways and offering a mechanism for inflammation management.
Modulation of ADAMTS5 expression by OC in inflammatory chondrocyte model
Previous studies have established that SOX4 can directly upregulate ADAMTS5 expression. Building on this knowledge, we investigated the effects of OC on ADAMTS5 levels.
OC significantly reduced ADAMTS5 expression in the inflammatory chondrocyte model. Treatment with 20 and 40 µg/mL OC resulted in dose-dependent reductions in ADAMTS5 expression, with signal intensities reduced by 40% and 60%, respectively, compared to LPS-induced inflammatory chondrocytes (Fig. 6). GAPDH expression remained consistent across all treatment groups, confirming the specificity of OC’s effect on ADAMTS5 (Fig. 6). These findings suggest that OC has the potential to counteract the cartilage-degrading effects of SOX4 by downregulating its downstream target, ADAMTS5.
Fig. 6.
Effect of OC on ADAMTS5 Expression. (A): Western blot depicting the expression of ADAMTS5 in control, LPS-treated chondrocytes, and chondrocytes treated with 20 µg/mL and 40 µg/mL OC. (B): Western blot depicting the expression of GAPDH in control, LPS-treated chondrocytes, and chondrocytes treated with 20 µg/mL and 40 µg/mL OC. (C):Densitometric analysis of ADAMTS5 expression from the Western blot normalized with GAPDH, highlighting dose-dependent inhibition of ADAMTS5expression upon treatment with OC. Student’s t-test was performed on each experimental dataset, resulting in a significance level denoted by * and **, where (*) denotes p-value is < 0.05 and (**) denotes p-value is < 0.01
Mitochondrial membrane potential (ΔΨM) preservation by OC in inflammatory chondrocyte model
In the present study, OC demonstrated the ability to downregulate inflammatory and catabolic markers, including PAR-2, TNF-alpha, IL-1beta, MCP-1, SOX4, and ADAMTS5. ΔΨM is a critical indicator of cellular health and dysregulation is implicated in inflammatory diseases. This parameter serves as a crucial indicator of cellular bioenergetics and integrity, particularly within the context of inflammation-induced chondrocyte degradation. Therefore, we investigated the effects of OC on ΔΨM in chondrocytes subjected to inflammatory insult.
Fluorescence microscopy revealed that LPS treatment induced significant mitochondrial membrane depolarization in chondrocytes, indicated by diminished Rhodamine fluorescence (Figures 7A and B). Quantitative analysis confirmed a reduction in ΔΨM to 40% of control levels in LPS-treated cells (Figure 7E). OC treatment resulted in dose-dependent restoration of ΔΨM. Compared to LPS-only treatment, 20 µg/mL OC partially restored ΔΨM to 60% of control levels, while 40 µg/mL OC further increased ΔΨM to approximately 80% of control (Figures 7C to E).
Fig. 7.
Impact of Oleocanthal on Mitochondrial Membrane Potential (ΔΨM) in Chondrocytes as Demonstrated by Immunofluorescence Staining and Quantitative Analysis. Oleocanthal’s effects on mitochondrial membrane potential (ΔΨM) within chondrocytes through both qualitative and quantitative lenses. Each part is explained as follows: (A) Immunofluorescence staining of untreated control chondrocytes, illustrating the baseline ΔΨM; (B) Chondrocytes treated with lipopolysaccharide (LPS), showing altered ΔΨM as a model of inflammation-induced mitochondrial stress; (C) Chondrocytes after treatment with 20 µg/mL oleocanthal, indicating the effect of oleocanthal on the preservation/restoration of ΔΨM; (D) Chondrocytes post-treatment with 40 µg/mL oleocanthal, further depicting the dose-response relationship between oleocanthal and ΔΨM stabilization; (E) Quantitative bar graph of ΔΨM intensity, normalized to the control, across the different treatment groups. Student’s t-test was conducted to assess statistical significance. A single asterisk (*) denotes a p-value less than 0.05 (Note: The fluorescence images reveal that LPS treatment reduces ΔΨM, indicative of mitochondrial depolarization, which is then partially reversed by oleocanthal treatment in a concentration-dependent manner. The quantitative analysis corroborates the protective effect of oleocanthal on mitochondrial integrity under inflammatory conditions.)
These findings demonstrate that OC mitigates LPS-induced mitochondrial dysfunction in chondrocytes. The dose-dependent restoration of ΔΨM underscores OC’s potential to preserve mitochondrial function and promote cellular health under inflammatory conditions.
Analysis of OC’s effects on RANK and RANKL activity assessed by flow cytometry
In the present study OC demonstrated downregulation of inflammatory mediators and stabilization of mitochondrial membrane potential in chondrocytes. Given the critical role of the RANK/RANKL signalling axis in osteoclastogenesis and bone remodelling, we investigated OC’s potential to modulate this pathway. Dysregulation of RANK/RANKL signalling contributes to OA.
Flow cytometry was used to quantify the effects of OC on RANK and RANKL activity. Control chondrocytes established baseline expression levels (Figure 8A). LPS stimulation induced a significant upregulation of both RANK and RANKL (Figure 8B and C), confirming the expected pro-osteoclastogenic response. OC treatment at 40 µg/mL (Figures 8D and E) reduced RANK and RANKL activity. Significant attenuation of both RANK and RANKL expression was observed at the 40 µg/mL OC concentration. Quantitative analysis (Figure 8F) showed near-baseline RANK activity and a robust decrease in RANKL activity relative to LPS-treated chondrocytes.
Fig. 8.
Effect of High-Concentration Oleocanthal on RANK and RANKL Expression in Chondrocytes Analyzed by Flow Cytometry. This figure presents the impact of a 40 µg/mL oleocanthal treatment on the expression of RANK and RANKL in chondrocytes, assessed through flow cytometry, with a summary of the findings presented in a graphical format. The components of the figure are described as follows: (A) Control chondrocytes with baseline expression of RANK and RANKL; (B) Chondrocytes treated with LPS, illustrating increased RANK expression indicative of an inflammatory response; (C) Chondrocytes treated with LPS, demonstrating increased RANKL expression, which is part of the inflammatory cascade; (D) Chondrocytes treated with a high concentration of oleocanthal (40 µg/mL), showing the expression of RANK post-treatment; (E) Chondrocytes treated with the same high concentration of oleocanthal, revealing the expression of RANKL post-treatment; (F) Graphical analysis of the expression levels of RANK and RANKL in all tested groups, quantifying the effects of LPS and oleocanthal treatment. Student’s t-test was conducted to assess statistical significance. A single asterisk (*) denotes a p-value less than 0.05. (Note: The use of a high oleocanthal concentration is justified by previous findings indicating that lower concentrations had less pronounced effects. The higher concentration employed here is based on a hypothesis that it may have a stronger regulatory impact on the RANK/RANKL pathway, which is crucial in the context of inflammation and osteoclastogenesis. The graph in panel F consolidates the flow cytometry data, providing clear visual evidence of oleocanthal’s modulatory effects at this increased concentration level)
These findings demonstrate that OC directly inhibits the RANK/RANKL pathway, a key mechanism in osteoclast differentiation and activation. This inhibitory effect, particularly potent at 40 µg/mL, suggests OC’s potential to mitigate bone resorption and protect bone integrity in pathologies associated with RANK/RANKL.
Statistical validation of results
The statistical validation of the results was performed to confirm the significance of the observed dose-dependent effects of OC on chondrocyte inflammation and cartilage degradation markers. Each set of experimental data, including the expression levels of inflammatory cytokines, catabolic markers, and mitochondrial membrane potential, was subjected to statistical analysis to determine the reliability of the findings.
The Student’s t-test was applied to compare the mean values of each treatment group with the control group. For example, in the analysis of TNF-α, IL-1β, and MCP-1 expression, the t-test revealed statistically significant reductions in cytokine levels with increasing doses of OC, with p-values consistently below 0.05, thus confirming the dose-dependent anti-inflammatory effects of OC. Similarly, the analysis of mitochondrial membrane potential indicated a statistically significant restoration of mitochondrial function in OC-treated cells compared to the LPS-only treated group, further validating the protective effects of OC against mitochondrial dysfunction.
All statistical results, are reported alongside the corresponding figures and tables in the manuscript. This thorough statistical validation underscores the reliability of our findings and supports the conclusion that OC has significant therapeutic potential in modulating inflammation and protecting chondrocyte function in OA.
Discussion
OC, a major phenolic compound found in EVOO, has garnered significant attention for its potent anti-inflammatory properties. Research suggests OC holds promise in managing bone health, maintaining chondrocyte function, and offering therapeutic benefits for OA and rheumatoid arthritis (RA). OC exerts its anti-inflammatory effects through multiple mechanisms, including the inhibition of pro-inflammatory mediators like MIP-1α and IL-6 in macrophages and chondrocytes [10, 28]. It also downregulates the expression of NOS2 and COX-2, key enzymes involved in inflammation [10].
Evidence suggests that polyphenols related to OC, such as oleuropein and hydroxytyrosol, promote bone mineral density [29], and could reduce osteoclastogenesis [29], suggesting OC may also positively impact bone health. Furthermore, OC has demonstrated antioxidant properties, potentially mitigating inflammation and oxidative stress as observed in a collagen-induced arthritis mouse model [7]. Beyond these effects, OC inhibits proteolytic enzymes that contribute to cartilage degradation in OA [30].
Furthermore, studies indicate OC’s potential in reducing OA inflammation and preventing cartilage damage [10, 31]. The Arthritis Foundation highlights EVOO’s (and thus OC’s) benefits in managing RA [32, 33], and these effects may extend to OA as well. Interestingly, research suggests OC and other olive derivatives may promote autophagy, a cellular process beneficial in OA treatment [34]. Given OC’s demonstrated anti-inflammatory actions, investigating its potential effects on PAR2-mediated inflammation is a promising avenue for further exploration. Our recent research underscores the critical role of PAR2 in mediating OA inflammation [11], and understanding OC’s influence on this pathway could lead to a deeper understanding of its therapeutic mechanisms and potential applications in OA management.
The restoration of type II collagen expression in inflammatory chondrocytes by OC highlights its significant therapeutic potential in preserving cartilage integrity under OA conditions. In this study, LPS-induced inflammation reduced type II collagen levels, a key structural component of cartilage ECM, reflecting the catabolic processes characteristic of OA [35]. However, OC treatment effectively reversed this decline in a dose-dependent manner, with 40 µg/mL OC restoring collagen II expression to levels comparable to or even exceeding those of untreated controls (Fig. 2A and C). This suggests that OC not only mitigates inflammation-induced ECM degradation but also supports the anabolic processes essential for maintaining cartilage homeostasis. These findings underscore the importance of OC as a promising candidate for functional food interventions aimed at protecting cartilage and preventing the progression of OA through the maintenance of essential ECM components such as type II collagen.
We found that OC effectively decreased PAR2 expression in our proinflammatory chondrocyte model (Fig. 3A and B) without affecting control gene expression (Fig. 3C). PAR2 is a key driver of inflammation and cartilage degradation, inducing matrix metalloproteinases (MMPs) [36]. While MMPs are essential for ECM remodelling, their dysregulation contributes to cartilage breakdown in OA. Notably, MMP-1, -8, and − 13 target type II collagen, the primary cartilage component [37, 38]. PAR2 activation leads to MMP-mediated cartilage destruction [39], and its inhibition offers protection against arthritis [40, 41]. Since PAR2 is overexpressed in OA chondrocytes [11], and promotes osteophyte formation [42], our findings indicate that OC may reduce OA inflammation by directly suppressing PAR2 expression (Figure 3).
PAR2 activation triggers signalling through the ERK1/2 and NF-κB pathways, resulting in the production of pro-inflammatory cytokines like TNF-α and IL-1β [43, 44] (Figure 9). Critically, TNF-α can further upregulate PAR-2 expression in chondrocytes [36, 45], creating a vicious cycle of inflammation (Figure 9). This self-perpetuating process underscores the importance of targeting these pathways to manage inflammation. Therefore, we investigated the effect of OC on TNF-α secretion as a potential strategy to interrupt this cycle. OC dose-dependently inhibited TNF-α secretion (Table 2, Fig. 4). This is significant because TNF-α, a potent pro-inflammatory cytokine [46], drives the production of cartilage-degrading enzymes like MMP-13, ADAMTS-5, and ADAMTS-7 [47, 48]. Additionally, TNF-α activates the NF-κB signaling pathway, amplifying inflammation [49], and is directly implicated in the cartilage degeneration associated with OA [50]. Therefore, inhibiting TNF-α expression or activity can attenuate OA-related inflammation [51]. Our findings indicate that OC, by reducing PAR2-mediated TNF-α expression, may suppress the subsequent pro-inflammatory cascade triggered by TNF-α. This suggests a potential long-term therapeutic benefit in OA, like what we have observed with curcumin and Vitamin D in our recent study [11].
Fig. 9.
Schematic Overview of Oleocanthal’s Impact on Key Molecular Targets in Chondrocyte Inflammation and Cartilage Integrity. This figure presents a schematic diagram summarizing the multifaceted role of oleocanthal (OC) in modulating various molecular pathways associated with chondrocyte inflammation and cartilage degradation. The inhibition symbol (red “I-“) indicates molecules whose activity or expression is downregulated by OC. The depicted pathways and outcomes are as follows: Activation of the PAR2 receptor triggers the NF-κB signaling pathway, leading to the production of pro-inflammatory cytokines such as MCP-1, TNF-α, and IL-1β. These cytokines facilitate monocyte recruitment and the generation of reactive oxygen species (ROS), contributing to chronic pain and inflammation. OC interferes with this process, downregulating the expression of MCP-1, TNF-α, and IL-1β, as well as mitigating ROS generation, thereby potentially reducing inflammation and associated chronic pain. The pathway further connects to the RANK/RANKL system, essential for osteoclastogenesis, which is also downregulated by OC, suggesting a decrease in bone resorption activity. Downstream, the expression of SOX4, a transcription factor associated with chondrocyte integrity, and ADAMTS5, an aggrecanase involved in cartilage breakdown, is also inhibited by OC, pointing to the preservation of cartilage integrity and function. Overall, this schematic encapsulates the therapeutic potential of OC in protecting chondrocyte from inflammation-induced damage by targeting key proteins and signaling pathways involved in the pathological process of chondrocyte degradation
In recent years, nutraceuticals have gained recognition as promising therapeutic agents for OA due to their anti-inflammatory and chondroprotective properties. Among these, oleocanthal (OC), curcumin, terpenes, and other bioactive compounds have demonstrated varying degrees of efficacy [52].
OC exerts its effects primarily through the inhibition of cyclooxygenase enzymes (COX-1 and COX-2), leading to a reduction in the production of pro-inflammatory mediators such as prostaglandins [9]. Notably, the present study highlights OC’s advantageous modulation of the Protease-Activated Receptor-2 (PAR-2) pathway, which is highly expressed in the chondrocytes of osteoarthritic cartilage. By downregulating PAR-2 expression and signaling, OC effectively reduces the release of pro-inflammatory cytokines like TNF-α, IL-1β, and IL-6, positioning it as a potent anti-inflammatory agent with broad-spectrum efficacy in OA management.
Curcumin, the active component of turmeric, is another nutraceutical with well-established anti-inflammatory and chondroprotective properties. Curcumin primarily inhibits NF-κB and COX-2, suppressing the expression of inflammatory cytokines and matrix metalloproteinases (MMPs) [53]. Recent findings also indicate curcumin’s role in regulating the RANK/RANKL pathway, which is crucial for bone remodeling and cartilage degradation [11]. Interestingly, curcumin’s ability to regulate these pathways through direct interaction with PAR-2 has been demonstrated, further underscoring its therapeutic potential [11].
Terpenes, such as β-caryophyllene and β-myrcene, have attracted attention for their ability to modulate inflammatory responses, primarily through their interaction with CB2 cannabinoid receptors [54]. This interaction contributes to their anti-inflammatory effects within the endocannabinoid system. Although terpenes have been shown to reduce cytokine levels like IL-1β and IL-6 [54], their direct effects on the PAR-2 pathway have not been extensively studied. Future research could explore whether terpenes can modulate PAR-2 signaling, potentially expanding their therapeutic applications in OA management.
Other nutraceuticals, including fish oil, glucosamine sulfate, chondroitin sulfate, and avocado/soy unsaponifiables (ASU), exhibit anti-inflammatory effects through various mechanisms. Fish oil, rich in omega-3 fatty acids (EPA and DHA), reduces the production of eicosanoids derived from arachidonic acid, thereby lowering the overall inflammatory response [55]. However, the relationship between omega-3 fatty acids and PAR-2 has not been thoroughly investigated, presenting an area ripe for future research.
Glucosamine and chondroitin, essential for maintaining cartilage integrity, have been shown to inhibit catabolic activity in chondrocytes by reducing the expression of MMPs [56]and aggrecanases [57–59]. Similarly, ASU suppresses NF-κB signaling and enhances cartilage repair by stimulating collagen synthesis [56]. Despite these benefits, the effects of these compounds on PAR-2 signaling remain largely unknown. Investigating their potential role in modulating PAR-2 could provide deeper insights into their mechanisms of action and enhance their therapeutic efficacy.
Undenatured type II collagen (UC-II) and S-adenosylmethionine (SAMe) also contribute to joint health through immune modulation and antioxidant activity, respectively. UC-II reduces autoimmune responses against collagen in OA [60], while SAMe enhances glutathione synthesis, offering antioxidant protection to chondrocytes [61]. The impact of these nutraceuticals on PAR-2 signaling is another area that warrants exploration, as targeting PAR-2 could further amplify their benefits in OA treatment.
Moreover, recent research highlights the potential of combining nutraceuticals to enhance their therapeutic effects. For example, a combination of hemp seed oil with β-caryophyllene and myrcene has been shown to significantly improve pain and joint function in patients with knee OA [62]. Such combinations could potentially target multiple inflammatory pathways, including PAR-2, offering a more comprehensive approach to managing OA.
Therefore, while OC and curcumin have demonstrated a clear and direct impact on PAR-2 signaling, many other nutraceuticals have yet to be fully explored in this context. OC’s dual action on COX enzymes and PAR-2 makes it a particularly effective agent in reducing OA-related inflammation and cartilage degradation. Terpenes and other nutraceuticals also hold significant promise, but their effects on PAR-2 remain to be fully elucidated. Future research should prioritize investigating these interactions, potentially leading to more targeted and effective nutraceutical therapies for OA. Exploring the synergistic effects of combining these compounds could further enhance their therapeutic efficacy, offering new hope for patients suffering from this debilitating condition.
In addition to the above, future investigations should focus on several key areas. Firstly, it’s important to delineate how PAR2 activation triggers the ERK1/2 and NF-κB pathways, leading to pro-inflammatory factor release specifically in OA. Secondly, exploring the self-perpetuating inflammation cycle where TNF-α upregulates PAR2 expression in chondrocytes is crucial. Thirdly, examining how TNF-α influences inflammatory biomarkers like MMP-13 and ADAMTS-7 will be beneficial. Additionally, investigations into the potential of specifically targeting TNF-α expression or activity to mitigate OA-associated inflammation are warranted. Finally, assessing the role of the PI3K/Akt signalling pathway following TNF-α exposure, and the potential of combination therapies like OC and probucol to target this pathway. Indeed, research has shown that curcumin and probucol safeguard chondrocytes against inflammation triggered by TNF-α and diminishing apoptosis through the PI3K-Akt-mTOR Pathway [63]. These studies will deepen our understanding of TNF-α-related inflammation, the protective effects of OC, and ultimately, the long-term benefits of OC as a potential OA therapy.
The current investigation demonstrates that OC effectively decreases IL-1β secretion (Table 2, Fig. 4). This finding holds significant implications for OA management, as IL-1β is a key driver of inflammation and OA progression. It promotes cartilage degradation by upregulating MMPs and aggrecanases [64] (Figure 9). Furthermore, IL-1β fuels synovial inflammation, exacerbating joint damage [65], and contributes to chronic OA pain (Figure 9) [66]. Studies also suggest IL-1β’s involvement in osteophyte formation [64], and the amplification of inflammation through the stimulation of other pro-inflammatory cytokines [67]. Collectively, this underscores IL-1β’s central role in perpetuating OA’s destructive processes. Our finding that OC downregulates IL-1β (Table 2, Fig. 4), highlights its potential as an OA therapeutic. By suppressing this key inflammatory cytokine, OC may attenuate cartilage degradation, reduce synovial inflammation, and potentially lessen OA-associated pain.
Future studies should focus on several key areas. Firstly, it’s important to investigate how OC’s impact on PAR2 signalling subsequently modulates IL-1β expression. This could elucidate novel pathways through which OC exerts its anti-inflammatory effects. Secondly, determining whether OC directly inhibits IL-1β activity or production, independent of its effect on PAR-2, is crucial as it could reveal multiple mechanisms of action. Thirdly, evaluating the impact of OC-mediated IL-1β suppression on cartilage degradation markers (MMPs, aggrecanases), synovial inflammation markers, and pain-related mediators will be beneficial. Additionally, comparing OC’s effects to targeted IL-1β inhibitors could provide insights into its relative efficacy and potential advantages as a natural, multi-target therapy. Given the complexity of OA inflammation, investigating combination therapies with OC and other agents (like vitamin D, curcumin or probucol) might offer synergistic benefits.
In the complex pathology of OA, the intricate interplay between PAR2, TNF-α, and IL-1β significantly contributes to the disease’s progression through their pivotal roles in the inflammatory cascade (Figure 9), notably involving the upregulation of MCP-1, also known as CCL2 (Chemokine (C-C motif) ligand 2), which serves as a potent chemotactic factor for monocytes [68]. IL-1β, activates critical signaling pathways such as the NF-κB, leading to the stimulation of MCP-1 production [69] (Figure 9), thereby exacerbating the inflammatory milieu characteristic of OA. Similarly, TNF-α also induces MCP-1 expression, further contributing to the recruitment of monocytes to the synovial tissue and perpetuating the inflammatory cycle within the OA joint [70] (Figure 9).
Furthermore, PAR-2, expressed in OA synovial cells, is upregulated by cytokines TNF-α and IL-1β. The activation of PAR-2 is implicated in initiating inflammatory responses, potentially including the production of MCP-1, augmenting OA’s inflammatory processes [71]. Elevated levels of MCP-1 observed in OA patients underscore its significance in monocyte recruitment to the articular cavity, leading to macrophage activation, downstream inflammatory responses, and resultant inflammatory injury. Notably, in animal models, the lack of MCP-1 results in diminished macrophage accumulation, reduced synovitis, and cartilage damage, highlighting its pivotal role in OA pathology [72]. The induction of MCP-1 by both IL-1β and TNF-α further elucidates the interconnected roles of these cytokines in exacerbating OA pathology, drawing parallels with RA mechanisms where synovial tissue macrophages express and upregulate MCP-1 in response to these inflammatory cytokines [70].
In the present study, we therefore investigated the effect of OC on MCP-1 secretion, which was found to be attenuated by OC (Table 2, Figure 4). The ability of OC to downregulate MCP-1, thereby potentially reducing the recruitment of monocytes and the consequent inflammatory response in OA joints, underscores the need for further investigation into the mechanisms underlying OC’s anti-inflammatory effects.
The upregulation of PAR2 expression in OA leads to an increase in pro-inflammatory cytokines: TNF-α, IL-1β, and the chemokine, MCP-1 (Figure 9). These molecules play a crucial role in the pathology of knee OA, with MCP-1 particularly implicated in the degradation of chondrocytes and disease progression [73]. Central to articular cartilage’s resilience against compressive forces is aggrecan, a proteoglycan whose loss signifies early OA onset [74]. Aggrecan forms part of the ECM, binding with hyaluronan, and stabilized by link proteins in proteoglycan aggregates. Our inflammation model revealed that exposure to LPS triggers chondrocytes to secrete increased levels of aggrecan into the ECM, a process seemingly driven by the activation of inflammatory signaling pathways (Table – 2). This activation plausibly prompts the enhanced transcription of catabolic enzymes, notably MMPs and A Disintegrin And Metalloproteinase with Thrombospondin Motifs (ADAMTS) – collectively known as aggrecanases [75]. These enzymes are key players in the proteolytic breakdown of the ECM, leading to a surge of aggrecan fragments in the supernatant. Given this backdrop, our study further delved into the impact of OC on aggrecan presence in the supernatant. Notably, with increasing doses of OC, there was a marked decrease in aggrecan levels in the supernatant (Table – 2), underscoring OC’s potential in attenuating the expression of inflammatory cytokines and MCP-1. This observation also points to OC’s ability to inhibit the enzymatic degradation of critical cartilage components, offering a multifaceted approach to slowing OA progression.
As observed above, elevation of PAR2 expression triggers an increase in pro-inflammatory cytokines such as TNF-α, IL-1β, and MCP-1, key drivers in OA pathology. This upsurge is particularly linked to the degradation of chondrocytes and the progression of OA. Exposure to LPS in our inflammation model induced a notable release of aggrecan into the ECM, attributed to the activation of inflammatory signaling that also upregulates enzymes like MMPs and ADAMTS (aggrecanases). These enzymes facilitate the ECM’s proteolytic breakdown, intensifying aggrecan fragment release. In this context, the role of SRY-Box Transcription Factor 4 (SOX-4) and ADAMTS-5 emerges as significant in OA’s pathology and progression.
Elevated levels of SOX4 were observed in chondrocyte models of OA as well as in patients with OA [76]. It has been shown that SOX4 plays a pivotal role in promoting arthritis through various mechanisms by regulating key signaling pathways. Firstly, it acts as a crucial mediator in the TNF-induced transformation of fibroblast-like synoviocytes (FLS), interacting with RELA (a NF-κB signaling molecule) to control the expression of TNF downstream genes, thereby sustaining FLS transformation and inflammatory pathology in arthritis [77]. Additionally, SOX4’s regulation by the ROS/TGF-β signal amplifies OA pathogenesis and FLS senescence [78]. It also triggers OA onset by upregulating ADAMTS5, an enzyme degrading aggrecan, by binding to its gene promoter, leading to ECM degradation—a hallmark of arthritis [27]. Furthermore, in synovial CD4 + T cells, SOX4 elevation contributes to CXCL13 production and ectopic lymphoid-like structure (ELS) formation at inflammatory sites in RA patients [79]. Lastly, SOX4 activation of the long noncoding RNA MCM3AP-AS1 exacerbates OA progression by targeting the miR-149-5p/Notch1 axis, influencing autophagy and ECM degradation [76]. Also, recent studies have proposed SOX4 as a potential therapeutic target for both OA and RA. Building on the established significance of SOX4 in OA and its association with PAR2-mediated signaling, our investigation focused on the impact of OC on SOX4 expression. Our findings reveal that OC dose-dependently reduces SOX4 expression, without altering the expression of the housekeeping gene GAPDH (Figure 5).
By linking the roles of PAR2, TNF-α, IL-1β, and particularly SOX4 in the progression of OA (Figure 9), our investigation naturally extended to the effect of OC on ADAMTS5 expression. ADAMTS5 is integral to OA’s pathogenesis, acting as the primary aggrecanase that degrades aggrecan and disrupts the articular cartilage matrix, a critical process in the disease’s advancement [80]. This degradation not only compromises the cartilage’s ability to retain water but also its shock-absorbing qualities, escalating joint damage. ADAMTS5’s overactivation, influenced by aging, genetic factors, inflammation, and mechanical stress, further magnifies cartilage ECM degradation [80].
Research has highlighted the modulation of ADAMTS5 expression through various molecular pathways, including Runx2, Fgf2, Notch, Wnt, NF-κB, YAP/TAZ, alongside inflammatory signaling pathways, emphasizing its central role in OA and as a target for therapeutic intervention [80]. Therapeutic strategies against ADAMTS5, such as monoclonal antibodies, small molecule inhibitors, and innovative RNA therapies, have demonstrated potential in halting cartilage degradation in pre-clinical studies and OA animal models [81]. Genetic evidence further positions ADAMTS5 as a key player in OA, where its deletion in murine models prevents cartilage degradation, underscoring its promise as a target for disease-modifying OA drugs (DMOADs) [82].
Considering the intertwined roles of PAR2, TNF-α, IL-1β, and SOX4 in OA pathology, and the crucial function of ADAMTS5 in this network, we investigated if OC could modulate ADAMTS5 expression, offering a new therapeutic angle. Our results confirmed that OC dose-dependently reduces ADAMTS5 expression, while not affecting the housekeeping gene GAPDH’s expression (Figure 6). This reduction in ADAMTS5 expression by OC, as presented in Figure 6, aligns with the observed decrease in aggrecan levels in the supernatant at higher OC doses, as observed earlier (Table − 2). The reason for this correlation stems from ADAMTS5’s role as a key aggrecanase; its downregulation by OC would logically result in less aggrecan being cleaved, and consequently, a reduction in its release into the supernatant. This outcome further strengthens the evidence of OC’s potential as a modulatory agent in OA, attenuating the degradation of key cartilage matrix components through the suppression of specific degradative enzymes.
In the present study, OC has demonstrated a capacity to modulate the expression of inflammatory and catabolic markers, notably PAR-2, TNF-α, IL-1β, MCP-1, SOX4, and ADAMTS5. Such changes are critical, given that ΔΨm serves as an integral indicator of cellular health. Dysregulation of ΔΨm is recognized for its role in the pathophysiology of inflammatory diseases, where it reflects cellular bioenergetics and integrity, both of which are crucial in the context of inflammation-induced chondrocyte degradation [83]. Consequently, we sought to assess the effects of OC on ΔΨm in chondrocytes using Rhodamine fluorescence to probe how OC might influence mitochondrial stability and function during inflammatory challenges.
This investigation dovetails with our interest in the PAR2-mediated signaling pathways and their contribution to the inflammatory and degradative mechanisms in OA. With the mitochondrial electron transport chain (ETC) identified as a major source of reactive oxygen species (ROS) production—factors that exacerbate joint injuries and diseases like OA and RA [84]—it was imperative to explore the mitochondrial dynamics further. Alterations in mitochondrial functions, such as mitochondrial respiratory chain (MRC) activity, ATP synthesis, and especially ΔΨm, have been implicated in OA. These mitochondrial dysfunctions, potentially intensified by inflammatory cytokines such as IL-1β and TNF-α [83, 85–87], prompted our investigation into the protective role of OC against mitochondrial instability in the pathogenesis of OA. Our findings demonstrate that OC treatment facilitates a dose-dependent restoration of ΔΨm (Figure 7), illuminating a novel protective mechanism of OC against OA. These results not only confirm OC’s modulatory capacity on key inflammatory and catabolic markers but also reveal its significant role in enhancing mitochondrial stability and function under inflammatory conditions. This observation underlines the therapeutic potential of OC as a functional food component in mitigating OA’s progression, emphasizing the importance of targeting mitochondrial dysfunction as part of a comprehensive approach to OA management.
In this study, OC demonstrated efficacy in attenuating the expression of inflammatory and catabolic markers, including PAR-2, TNF-α, IL-1β, MCP-1, SOX4, and ADAMTS5, underscoring its therapeutic potential in OA management. PAR2 is intricately linked with the RANKL/ RANK signaling pathway, which is pivotal in bone metabolism through its regulation of osteoclastogenesis [88]. The activation of this pathway is essential for osteoclast development, activation, and survival, thus playing a central role in bone resorption.
The RANKL/RANK pathway’s importance in bone diseases, such as osteoporosis and RA, is well-documented [89], with PAR2 activation known to upregulate RANKL expression [88]. This upregulation promotes osteoclast differentiation and activity, contributing significantly to bone resorption [90]. Given the pathway’s susceptibility to inflammatory cytokines, which can enhance RANKL-mediated osteoclastogenesis, there exists a critical intersection between inflammation, PAR2 activation, and bone health. This relationship underscores the potential for OC to mitigate inflammation-induced bone damage by modulating the RANKL/RANK signaling pathway.
Furthermore, the signaling system of RANK, RANKL, and Osteoprotegerin (OPG) is integral to bone remodeling and osteoclast maturation. RANKL, secreted by osteoblasts and activated T cells, plays a crucial role in various stages of osteoclast life cycle, from differentiation to activation and survival. The involvement of RANKL in synovial fibroblasts and chondrocytes contributes to subchondral bone sclerosis and cartilage degeneration in OA, highlighting the pathway’s contribution to OA pathology. Moreover, the regulation of synovial inflammation and angiogenesis by RANKL in OA suggests its role in the disease’s broader spectrum.
Given this backdrop and the established role of TNF-α in inducing RANKL expression in chondrocytes, our investigation into OC’s effect on RANKL/RANK expression using flow cytometry was a logical progression. OC treatment significantly diminished the expression of both RANK and RANKL, in comparison to LPS-treated chondrocytes (Figure 8). This observation underscores the potent anti-inflammatory effect of OC, highlighting its capability to significantly modulate osteoclastogenesis and bone resorption mitigating joint degradation.
Conclusion
In conclusion, our study elucidates the therapeutic potential of OC in modulating key molecular pathways involved in OA. As depicted in Fig. 9, OC effectively attenuates the PAR2-mediated inflammatory cascade, thereby reducing the expression of inflammatory cytokines TNF-α and IL-1β, along with the subsequent downstream events that contribute to cartilage degradation and joint inflammation. Importantly, OC’s capacity to downregulate the RANKL/RANK signalling pathway and ADAMTS5 activity suggests its role in curtailing osteoclastogenesis and preserving cartilage integrity. These findings, presented within the comprehensive framework of this study, offer compelling evidence of OC’s bioactive functionality in mitigating OA’s pathological processes. The insights gained from this research provide a valuable addition to the body of knowledge on functional foods in OA management and pave the way for future studies to explore OC’s full therapeutic potential in musculoskeletal disorders. This study’s contributions to understanding the complex interactions in OA pathogenesis and the impactful role of OC could inform the development of innovative, nutrition-based therapeutic strategies for OA in clinical settings.
Limitations and future directions
This study, while providing significant insights into the potential of OC in modulating the PAR-2 mediated inflammatory pathway in OA, has certain limitations that should be acknowledged.
Firstly, the in vitro nature of the study, although valuable for controlled mechanistic insights, does not fully replicate the complexity of in vivo conditions. Future studies should aim to validate these findings in animal models or clinical trials to ensure the translatability of OC’s effects to human OA pathology.
Secondly, the study’s focus on a single pathway, the PAR-2 mediated signaling, while crucial, does not encompass the entirety of the inflammatory network involved in OA. Comprehensive studies incorporating multiple pathways and their interactions would provide a more holistic understanding of OC’s therapeutic potential. This could be addressed by integrating systems biology approaches or multi-omics analyses in future research.
Additionally, the study was limited to specific dosages of OC. While dose-response relationships were established, exploring a broader range of concentrations, including sub-therapeutic and supra-therapeutic doses, would offer a more detailed dose-dependent profile. Future investigations could also explore the pharmacokinetics and pharmacodynamics of OC in vivo to optimize its therapeutic window.
Moreover, while the study demonstrated OC’s impact on mitochondrial membrane potential (ΔΨm) as an indicator of cellular health, it did not explore the long-term effects of OC on mitochondrial function under chronic inflammatory conditions. To fully understand the protective effects of OC on chondrocytes, future longitudinal studies should assess mitochondrial dynamics and bioenergetics using advanced techniques. High-resolution respirometry can be employed to measure mitochondrial respiration and oxidative phosphorylation efficiency over time. Additionally, Seahorse XF Analyzer technology could be used to evaluate real-time changes in cellular metabolism, including glycolysis and mitochondrial respiration. Furthermore, imaging techniques such as live-cell fluorescence microscopy using mitochondrial-specific dyes (e.g., MitoTracker) can provide insights into mitochondrial morphology, network dynamics, and membrane potential in response to sustained OC treatment. These approaches, combined with proteomic and metabolomic analyses, would offer a comprehensive understanding of how OC influences mitochondrial function under chronic inflammatory conditions.
Finally, the potential synergistic effects of OC with other nutraceuticals or pharmacological agents were not explored in this study. Given the multifactorial nature of OA, future research should investigate the combined effects of OC with other compounds to potentially enhance therapeutic efficacy and broaden its application in OA management.
In conclusion, while this study provides foundational insights into the anti-inflammatory properties of OC, addressing these limitations through future research will be crucial to fully realizing its potential as a therapeutic agent in OA.
Electronic supplementary material
Below is the link to the electronic supplementary material.
Acknowledgements
The authors wish to express their sincere appreciation to Ms. Monisha Varghese for her invaluable support in conducting the RT-PCR experiments. The authors also extend their deep gratitude to the Al Jalila Foundation for their magnanimous support, which was crucial in providing the necessary laboratory space and state-of-the-art equipment needed to carry out this research.
Biographies
Dr. Rajashree Patnaik
, with her extensive background in biotechnology and current role as a Postdoctoral Fellow with Dr. Yajnavalka Banerjee in the Banerjee Research Group at the College of Medicine at MBRU, oversees multiple projects. Her expertise is applied to a wide array of projects exploring the broader theme of inflammation, specifically focusing on conditions such as osteoarthritis (OA), non-alcoholic fatty liver disease, and colon cancer. Dr. Patnaik’s multidisciplinary research skills encompass a variety of techniques, from cell culture to molecular biology assays like ELISA, Western Blot, and RT-PCR, which she leverages to contribute to cutting-edge research in these crucial areas of human health. Her participation in projects examining the anti-inflammatory properties of various compounds and her involvement in nutraceutical studies demonstrate her commitment to advancing knowledge in inflammatory pathologies and their treatment.
Ms. Riah Varghese
, as a Research Associate in the Banerjee Research Group at MBRU, focuses on understanding inflammatory pathways in osteoarthritis (OA) and obesity. Her contributions include mapping the TNFα, SOX4, ADAMTS5, RANK/RANKL pathway in OA, particularly the effects of Oleocanthal and Resveratrol. Riah is also involved in developing models to study inflammation in OA and obesity, drawing from her extensive background in stem cell technology and regenerative medicine, as evidenced by her MSc project on EndMT during vascular calcification. Her commitment to research excellence is further highlighted by her role in mentoring interns on cell and molecular biology techniques, alongside managing lab resources and schedules, underscoring her integral role within the research group.
Ms. Shirin Jannati
, a second-year MBBS student at MBRU and a research intern in the Banerjee Research Group, focuses her research interests on exploring PAR2-mediated inflammatory pathways in osteoarthritis (OA). She has been recognized for her contributions to understanding the effects of feprazone in attenuating PAR2-mediated inflammation and its synergistic anti-inflammatory effects with curcumin, earning her the best poster award. In collaboration with Dr. Yajnavalka Banerjee, she has co-designed a Progressive Muscle Relaxation (PMR) program aimed at enhancing the mental well-being of medical students, demonstrating her commitment to both research and student health.
Dr. Nerissa Naidoo
, an Associate Professor of Anatomy at MBRU, specializes in the intersection of clinical anatomy and biochemistry, with a particular focus on degenerative conditions affecting major joint complexes. Her award-winning research spans the pectoral girdle to the hip and knee joints, and the lumbar vertebral column. Recognized for her academic excellence with various scholarships and awards, she’s also been honored as a leading figure in her field by McKinsey & Company and recently received the “Science, She Says” award for her contributions in her region.
Dr. Yajnavalka Banerjee
, leading the Banerjee Research Group at MBRU as an Associate Professor of Biochemistry, boasts an extensive career marked by notable achievements in medical education and research. His work encompasses a broad spectrum of interests, including molecular mechanisms of disease, COVID-19’s impact on metabolic disorders, and the therapeutic potential of venom-derived peptides. Dr. Banerjee has successfully acquired significant research grants, such as studies on the anti-inflammatory properties of Apixaban from Pfizer, and venom-derived bioactive peptides against colorectal cancer, with funding reaching substantial amounts. His scholarly contributions are profound, with a total of 86 peer-reviewed publications to his name, reflecting a wide-ranging impact on the fields of molecular biology, medical education, and therapeutic research. Under his direction, the Banerjee Research Group actively explores inflammation’s role in conditions like osteoarthritis, non-alcoholic fatty liver disease, and colon cancer, showcasing his dedication to addressing critical health challenges through a multidisciplinary approach.
Author contributions
Y.B. conceptualized the study. Data curation was managed by R.P., R.V., and S.J. R.P., N.N., and Y.B. performed the formal analysis. Funding was acquired by N.N. and Y.B. The investigation was conducted by R.P. and Y.B. The methodology was developed by R.P., R.V., S.J., and Y.B. Y.B. provided supervision. Validation was carried out by R.P., N.N., and Y.B. The original draft was written by R.P. and Y.B., with both also handling the review and editing of the manuscript. All authors have made significant contributions to the work, have read, and have approved the final manuscript for publication.
Funding
This work was supported by a grant from Mohammed bin Rashid University, with the grant identification number MBRUCM-RG-2022-04. The funding body had no role in the design of the study, collection, analysis, and interpretation of data, or in writing the manuscript.
Data availability
The datasets generated and/or analyzed during the current study are not publicly available but are accessible from the corresponding author upon reasonable request. Interested researchers may contact the corresponding author for data access inquiries, subject to compliance with any applicable privacy or confidentiality obligations.
Declarations
Ethics approval and consent to participate
The experimental procedures in this research were carried out in vitro and did not entail the utilization of animal models, patient samples, or human subjects. As a result, the study presented minimal risk and falls within one of the exempt review categories outlined by the institutional review board (IRB) regulations at Mohammed Bin Rashid University of Medicine and Health Sciences (MBRU). For additional details and clarification, inquiries can be directed to the MBRU IRB at irb@mbru.ac.ae. The study exclusively utilized in vitro experiments with readily available cell lines, eliminating the involvement of human subjects. It is essential to highlight that no individuals under the age of 18 were part of the study, rendering parental or guardian consent unnecessary. The experiments conducted did not include any form of direct or indirect interaction with human subjects. It’s crucial to emphasize that our research did not require access to medical records or archived samples. In summary, our study focused on in vitro experiments using commercially acquired cell lines and did not entail the participation of human subjects. Consequently, participant consent was not deemed necessary, and the requirement for consent was waived.
Consent for publication
Not Applicable.
Competing interests
The authors declare no competing interests.
Clinical trial number
Not Applicable.
Footnotes
Publisher’s note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.Estruch R, Ros E, Salas-Salvado J, Covas MI, Corella D, Aros F, Gomez-Gracia E, Ruiz-Gutierrez V, Fiol M, Lapetra J, et al. Primary Prevention of Cardiovascular Disease with a Mediterranean Diet supplemented with Extra-virgin Olive oil or nuts. N Engl J Med. 2018;378(25):e34. [DOI] [PubMed] [Google Scholar]
- 2.Fan H, Wang Y, Ren Z, Liu X, Zhao J, Yuan Y, Fei X, Song X, Wang F, Liang B. Mediterranean diet lowers all-cause and cardiovascular mortality for patients with metabolic syndrome. Diabetol Metab Syndr. 2023;15(1):107. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Patti AM, Carruba G, Cicero AFG, Banach M, Nikolic D, Giglio RV, Terranova A, Soresi M, Giannitrapani L, Montalto G et al. Daily Use of Extra Virgin Olive Oil with High Oleocanthal Concentration reduced Body Weight, Waist circumference, Alanine Transaminase, inflammatory cytokines and Hepatic Steatosis in subjects with the metabolic syndrome: a 2-Month intervention study. Metabolites 2020, 10(10). [DOI] [PMC free article] [PubMed]
- 4.Geng R, Li J, Yu C, Zhang C, Chen F, Chen J, Ni H, Wang J, Kang K, Wei Z, et al. Knee osteoarthritis: current status and research progress in treatment (review). Exp Ther Med. 2023;26(4):481. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Veronese N, Stubbs B, Noale M, Solmi M, Luchini C, Smith TO, Cooper C, Guglielmi G, Reginster JY, Rizzoli R, et al. Adherence to a Mediterranean diet is associated with lower prevalence of osteoarthritis: data from the osteoarthritis initiative. Clin Nutr. 2017;36(6):1609–14. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Veronese N, Koyanagi A, Stubbs B, Cooper C, Guglielmi G, Rizzoli R, Punzi L, Rogoli D, Caruso MG, Rotolo O, et al. Mediterranean diet and knee osteoarthritis outcomes: a longitudinal cohort study. Clin Nutr. 2019;38(6):2735–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Gonzalez-Rodriguez M, Ait Edjoudi D, Cordero-Barreal A, Farrag M, Varela-Garcia M, Torrijos-Pulpon C, Ruiz-Fernandez C, Capuozzo M, Ottaiano A, Lago F et al. Oleocanthal, an antioxidant phenolic compound in Extra Virgin Olive Oil (EVOO): a comprehensive systematic review of its potential in inflammation and Cancer. Antioxid (Basel) 2023, 12(12). [DOI] [PMC free article] [PubMed]
- 8.Lozano-Castellon J, Lopez-Yerena A, Rinaldi de Alvarenga JF, Romero D, Castillo-Alba J, Vallverdu-Queralt A, Escribano-Ferrer E, Lamuela-Raventos RM. Health-promoting properties of oleocanthal and oleacein: two secoiridoids from extra-virgin olive oil. Crit Rev Food Sci Nutr. 2020;60(15):2532–48. [DOI] [PubMed] [Google Scholar]
- 9.Beauchamp GK, Keast RS, Morel D, Lin J, Pika J, Han Q, Lee CH, Smith AB, Breslin PA. Phytochemistry: ibuprofen-like activity in extra-virgin olive oil. Nature. 2005;437(7055):45–6. [DOI] [PubMed] [Google Scholar]
- 10.Scotece M, Conde J, Abella V, Lopez V, Francisco V, Ruiz C, Campos V, Lago F, Gomez R, Pino J, et al. Oleocanthal inhibits Catabolic and Inflammatory mediators in LPS-Activated human primary osteoarthritis (OA) chondrocytes through MAPKs/NF-kappaB pathways. Cell Physiol Biochem. 2018;49(6):2414–26. [DOI] [PubMed] [Google Scholar]
- 11.Patnaik R, Riaz S, Sivani BM, Faisal S, Naidoo N, Rizzo M, Banerjee Y. Evaluating the potential of Vitamin D and curcumin to alleviate inflammation and mitigate the progression of osteoarthritis through their effects on human chondrocytes: a proof-of-concept investigation. PLoS ONE. 2023;18(12):e0290739. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Jannati S, Patnaik R, Banerjee Y. Beyond anticoagulation: a Comprehensive Review of Non-vitamin K oral anticoagulants (NOACs) in inflammation and protease-activated receptor signaling. Int J Mol Sci. 2024;25(16):8727. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Patnaik R, Jannati S, Sivani BM, Rizzo M, Naidoo N, Banerjee Y. Efficient generation of chondrocytes from bone marrow-derived mesenchymal stem cells in a 3D culture system: protocol for a practical model for assessing anti-inflammatory therapies. JMIR Res Protoc. 2023;12:e42964. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Fennema E, Rivron N, Rouwkema J, van Blitterswijk C, de Boer J. Spheroid culture as a tool for creating 3D complex tissues. Trends Biotechnol. 2013;31(2):108–15. [DOI] [PubMed] [Google Scholar]
- 15.Beutler B. Endotoxin, toll-like receptor 4, and the afferent limb of innate immunity. Curr Opin Microbiol. 2000;3(1):23–8. [DOI] [PubMed] [Google Scholar]
- 16.Ramey-Ward AN, Walthall HP, Smith S, Barrows TH. Human keratin matrices promote wound healing by modulating skin cell expression of cytokines and growth factors. Wound Repair Regen. 2024;32(3):257–67. [DOI] [PubMed] [Google Scholar]
- 17.Dieffenbach CW, Lowe TM, Dveksler GS. General concepts for PCR primer design. PCR Methods Appl. 1993;3(3):S30–37. [DOI] [PubMed] [Google Scholar]
- 18.Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. J Mol Biol. 1990;215(3):403–10. [DOI] [PubMed] [Google Scholar]
- 19.Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 2001;25(4):402–8. [DOI] [PubMed] [Google Scholar]
- 20.Johnson LV, Walsh ML, Bockus BJ, Chen LB. Monitoring of relative mitochondrial membrane potential in living cells by fluorescence microscopy. J Cell Biol. 1981;88(3):526–35. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Mishra P, Singh U, Pandey CM, Mishra P, Pandey G. Application of student’s t-test, analysis of variance, and covariance. Ann Card Anaesth. 2019;22(4):407–11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Kwak S. Are only p-Values less than 0.05 significant? A p-Value Greater Than 0.05 is also significant! J Lipid Atheroscler. 2023;12(2):89–95. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Weissgerber, Tracey L et al. Why we need to report more than ‘Data were Analyzed by t-tests or ANOVA’. eLife 2018;vol. 7:e36163. 10.7554/eLife.36163. [DOI] [PMC free article] [PubMed]
- 24.Wu Z, Korntner SH, Mullen AM, Zeugolis DI. Collagen type II: from biosynthesis to advanced biomaterials for cartilage engineering. Biomater Biosyst. 2021;4:100030. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Lu TJ, Chiu FY, Chiu HY, Chang MC, Hung SC. Chondrogenic differentiation of mesenchymal stem cells in three-Dimensional Chitosan Film Culture. Cell Transpl. 2017;26(3):417–27. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Bergholt NL, Lysdahl H, Lind M, Foldager CB. A standardized method of applying Toluidine Blue Metachromatic Staining for Assessment of Chondrogenesis. Cartilage. 2019;10(3):370–4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Takahata Y, Nakamura E, Hata K, Wakabayashi M, Murakami T, Wakamori K, Yoshikawa H, Matsuda A, Fukui N, Nishimura R. Sox4 is involved in osteoarthritic cartilage deterioration through induction of ADAMTS4 and ADAMTS5. FASEB J. 2019;33(1):619–30. [DOI] [PubMed] [Google Scholar]
- 28.Scotece M, Gomez R, Conde J, Lopez V, Gomez-Reino JJ, Lago F, Smith AB 3rd, Gualillo O. Further evidence for the anti-inflammatory activity of oleocanthal: inhibition of MIP-1alpha and IL-6 in J774 macrophages and in ATDC5 chondrocytes. Life Sci. 2012;91(23–24):1229–35. [DOI] [PubMed]
- 29.Chin KY, Ima-Nirwana S. Olives and bone: a green osteoporosis Prevention option. Int J Environ Res Public Health 2016, 13(8). [DOI] [PMC free article] [PubMed]
- 30.Iacono A, Gomez R, Sperry J, Conde J, Bianco G, Meli R, Gomez-Reino JJ, Smith AB 3rd, Gualillo O. Effect of oleocanthal and its derivatives on inflammatory response induced by lipopolysaccharide in a murine chondrocyte cell line. Arthritis Rheum. 2010;62(6):1675–82. [DOI] [PubMed]
- 31.Montoya T, Sanchez-Hidalgo M, Castejon ML, Rosillo MA, Gonzalez-Benjumea A, Alarcon-de-la-Lastra C. Dietary oleocanthal supplementation prevents inflammation and oxidative stress in Collagen-Induced Arthritis in mice. Antioxid (Basel) 2021, 10(5). [DOI] [PMC free article] [PubMed]
- 32.Eat Right for Your Type of Arthritis. [https://www.arthritis.org/health-wellness/healthy-living/nutrition/healthy-eating/eat-right-for-your-type-of-arthritis]
- 33.Benefits of Olive Oil for Arthritis. [https://www.arthritis.org/health-wellness/healthy-living/nutrition/healthy-eating/olive-oil-benefits-arthritis]
- 34.Chin KY, Pang KL. Therapeutic effects of Olive and its derivatives on Osteoarthritis: from bench to Bedside. Nutrients 2017, 9(10). [DOI] [PMC free article] [PubMed]
- 35.Billinghurst RC, Dahlberg L, Ionescu M, Reiner A, Bourne R, Rorabeck C, Mitchell P, Hambor J, Diekmann O, Tschesche H, et al. Enhanced cleavage of type II collagen by collagenases in osteoarthritic articular cartilage. J Clin Invest. 1997;99(7):1534–45. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.McCulloch K, McGrath S, Huesa C, Dunning L, Litherland G, Crilly A, Hultin L, Ferrell WR, Lockhart JC, Goodyear CS. Rheumatic disease: protease-activated Receptor-2 in Synovial Joint Pathobiology. Front Endocrinol (Lausanne). 2018;9:257. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Lazarus GS, Daniels JR, Brown RS, Bladen HA, Fullmer HM. Degradation of collagen by a human granulocyte collagenolytic system. J Clin Invest. 1968;47(12):2622–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Milner JM, Patel A, Davidson RK, Swingler TE, Desilets A, Young DA, Kelso EB, Donell ST, Cawston TE, Clark IM, et al. Matriptase is a novel initiator of cartilage matrix degradation in osteoarthritis. Arthritis Rheum. 2010;62(7):1955–66. [DOI] [PubMed] [Google Scholar]
- 39.Wilkinson DJ, Arques MDC, Huesa C, Rowan AD. Serine proteinases in the turnover of the cartilage extracellular matrix in the joint: implications for therapeutics. Br J Pharmacol. 2019;176(1):38–51. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Ferrell WR, Kelso EB, Lockhart JC, Plevin R, McInnes IB. Protease-activated receptor 2: a novel pathogenic pathway in a murine model of osteoarthritis. Ann Rheum Dis. 2010;69(11):2051–4. [DOI] [PubMed] [Google Scholar]
- 41.Ferrell WR, Lockhart JC, Kelso EB, Dunning L, Plevin R, Meek SE, Smith AJ, Hunter GD, McLean JS, McGarry F, et al. Essential role for proteinase-activated receptor-2 in arthritis. J Clin Invest. 2003;111(1):35–41. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Lu Q, Gou Y, Tian F, Zhang L. [Research progress on protease-activated receptor 2 in pathogenesis of osteoarthritis]. Zhongguo Xiu Fu Chong Jian Wai Ke Za Zhi. 2017;31(12):1517–22. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Kalogera S, He Y, Bay-Jensen AC, Gantzel T, Sun S, Manon-Jensen T, Karsdal MA, Thudium CS. The activation fragment of PAR2 is elevated in serum from patients with rheumatoid arthritis and reduced in response to anti-IL6R treatment. Sci Rep. 2021;11(1):24285. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Huang X, Ni B, Xi Y, Chu X, Zhang R, You H. Protease-activated receptor 2 (PAR-2) antagonist AZ3451 as a novel therapeutic agent for osteoarthritis. Aging. 2019;11(24):12532–45. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Xiang Y, Masuko-Hongo K, Sekine T, Nakamura H, Yudoh K, Nishioka K, Kato T. Expression of proteinase-activated receptors (PAR)-2 in articular chondrocytes is modulated by IL-1beta, TNF-alpha and TGF-beta. Osteoarthritis Cartilage. 2006;14(11):1163–73. [DOI] [PubMed] [Google Scholar]
- 46.Croft M, Benedict CA, Ware CF. Clinical targeting of the TNF and TNFR superfamilies. Nat Rev Drug Discov. 2013;12(2):147–68. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Zhao YP, Liu B, Tian QY, Wei JL, Richbourgh B, Liu CJ. Progranulin protects against osteoarthritis through interacting with TNF-alpha and beta-catenin signalling. Ann Rheum Dis. 2015;74(12):2244–53. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Buckland J. Osteoarthritis: positive feedback between ADAMTS-7 and TNF in OA. Nat Rev Rheumatol. 2013;9(10):566. [DOI] [PubMed] [Google Scholar]
- 49.Hayden MS, Ghosh S. Regulation of NF-kappaB by TNF family cytokines. Semin Immunol. 2014;26(3):253–66. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Qu R, Chen X, Wang W, Qiu C, Ban M, Guo L, Vasilev K, Chen J, Li W, Zhao Y. Ghrelin protects against osteoarthritis through interplay with Akt and NF-kappaB signaling pathways. FASEB J. 2018;32(2):1044–58. [DOI] [PubMed] [Google Scholar]
- 51.Zhao Y, Li Y, Qu R, Chen X, Wang W, Qiu C, Liu B, Pan X, Liu L, Vasilev K, et al. Cortistatin binds to TNF-alpha receptors and protects against osteoarthritis. EBioMedicine. 2019;41:556–70. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Castrogiovanni P, Trovato FM, Loreto C, Nsir H, Szychlinska MA, Musumeci G. Nutraceutical supplements in the Management and Prevention of Osteoarthritis. Int J Mol Sci 2016, 17(12). [DOI] [PMC free article] [PubMed]
- 53.Buhrmann C, Brockmueller A, Mueller AL, Shayan P, Shakibaei M. Curcumin attenuates Environment-Derived Osteoarthritis by Sox9/NF-kB Signaling Axis. Int J Mol Sci 2021, 22(14). [DOI] [PMC free article] [PubMed]
- 54.Fari G, Megna M, Scacco S, Ranieri M, Raele MV, Noya EC, Macchiarola D, Bianchi FP, Carati D, Gnoni A et al. Effects of terpenes on the Osteoarthritis Cytokine Profile by Modulation of IL-6: double Face versus Dark Knight? Biology (Basel) 2023, 12(8). [DOI] [PMC free article] [PubMed]
- 55.Boe C, Vangsness CT. Fish Oil and Osteoarthritis: current evidence. Am J Orthop (Belle Mead NJ). 2015;44(7):302–5. [PubMed] [Google Scholar]
- 56.Lippiello L, Nardo JV, Harlan R, Chiou T. Metabolic effects of avocado/soy unsaponifiables on articular chondrocytes. Evid Based Complement Alternat Med. 2008;5(2):191–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57.Henrotin Y, Mobasheri A, Marty M. Is there any scientific evidence for the use of glucosamine in the management of human osteoarthritis? Arthritis Res Ther. 2012;14(1):201. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.Michel BA, Stucki G, Frey D, De Vathaire F, Vignon E, Bruehlmann P, Uebelhart D. Chondroitins 4 and 6 sulfate in osteoarthritis of the knee: a randomized, controlled trial. Arthritis Rheum. 2005;52(3):779–86. [DOI] [PubMed] [Google Scholar]
- 59.Kahan A, Uebelhart D, De Vathaire F, Delmas PD, Reginster JY. Long-term effects of chondroitins 4 and 6 sulfate on knee osteoarthritis: the study on osteoarthritis progression prevention, a two-year, randomized, double-blind, placebo-controlled trial. Arthritis Rheum. 2009;60(2):524–33. [DOI] [PubMed] [Google Scholar]
- 60.Zhu P, Li XY, Wang HK, Jia JF, Zheng ZH, Ding J, Fan CM. Oral administration of type-II collagen peptide 250–270 suppresses specific cellular and humoral immune response in collagen-induced arthritis. Clin Immunol. 2007;122(1):75–84. [DOI] [PubMed] [Google Scholar]
- 61.Hosea Blewett HJ. Exploring the mechanisms behind S-adenosylmethionine (SAMe) in the treatment of osteoarthritis. Crit Rev Food Sci Nutr. 2008;48(5):458–63. [DOI] [PubMed] [Google Scholar]
- 62.Fari G, Megna M, Scacco S, Ranieri M, Raele MV, Chiaia Noya E, Macchiarola D, Bianchi FP, Carati D, Panico S et al. Hemp Seed Oil in Association with beta-caryophyllene, Myrcene and Ginger Extract as a Nutraceutical Integration in knee osteoarthritis: a double-blind prospective case-control study. Med (Kaunas) 2023, 59(2). [DOI] [PMC free article] [PubMed]
- 63.Han G, Zhang Y, Li H. The Combination Treatment of Curcumin and Probucol Protects Chondrocytes from TNF-alpha Induced Inflammation by Enhancing Autophagy and Reducing Apoptosis via the PI3K-Akt-mTOR Pathway. Oxid Med Cell Longev 2021, 2021:5558066. [DOI] [PMC free article] [PubMed]
- 64.Kapoor M, Martel-Pelletier J, Lajeunesse D, Pelletier JP, Fahmi H. Role of proinflammatory cytokines in the pathophysiology of osteoarthritis. Nat Rev Rheumatol. 2011;7(1):33–42. [DOI] [PubMed] [Google Scholar]
- 65.Scanzello CR. Chemokines and inflammation in osteoarthritis: insights from patients and animal models. J Orthop Res. 2017;35(4):735–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 66.Mailhot B, Christin M, Tessandier N, Sotoudeh C, Bretheau F, Turmel R, Pellerin E, Wang F, Bories C, Joly-Beauparlant C et al. Neuronal interleukin-1 receptors mediate pain in chronic inflammatory diseases. J Exp Med 2020, 217(9). [DOI] [PMC free article] [PubMed]
- 67.Fields JK, Gunther S, Sundberg EJ. Structural basis of IL-1 family Cytokine Signaling. Front Immunol. 2019;10:1412. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 68.Carr MW, Roth SJ, Luther E, Rose SS, Springer TA. Monocyte chemoattractant protein 1 acts as a T-lymphocyte chemoattractant. Proc Natl Acad Sci U S A. 1994;91(9):3652–6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 69.Molnar V, Matisic V, Kodvanj I, Bjelica R, Jelec Z, Hudetz D, Rod E, Cukelj F, Vrdoljak T, Vidovic D et al. Cytokines and chemokines involved in Osteoarthritis Pathogenesis. Int J Mol Sci 2021, 22(17). [DOI] [PMC free article] [PubMed]
- 70.Koch AE, Kunkel SL, Harlow LA, Johnson B, Evanoff HL, Haines GK, Burdick MD, Pope RM, Strieter RM. Enhanced production of monocyte chemoattractant protein-1 in rheumatoid arthritis. J Clin Invest. 1992;90(3):772–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 71.Chen TL, Lin YF, Cheng CW, Chen SY, Sheu MT, Leung TK, Qin CH, Chen CH. Anti-inflammatory mechanisms of the proteinase-activated receptor 2-inhibiting peptide in human synovial cells. J Biomed Sci. 2011;18(1):43. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 72.Ni F, Zhang Y, Peng X, Li J. Correlation between osteoarthritis and monocyte chemotactic protein-1 expression: a meta-analysis. J Orthop Surg Res. 2020;15(1):516. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 73.Xu YK, Ke Y, Wang B, Lin JH. The role of MCP-1-CCR2 ligand-receptor axis in chondrocyte degradation and disease progress in knee osteoarthritis. Biol Res. 2015;48:64. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 74.Struglics A, Larsson S, Pratta MA, Kumar S, Lark MW, Lohmander LS. Human osteoarthritis synovial fluid and joint cartilage contain both aggrecanase- and matrix metalloproteinase-generated aggrecan fragments. Osteoarthritis Cartilage. 2006;14(2):101–13. [DOI] [PubMed] [Google Scholar]
- 75.Tang H, Qin K, Wang A, Li S, Fang S, Gao W, Lu M, Huang W, Zhang H, Yin Z. 3,3’-diindolylmethane inhibits LPS-induced human chondrocytes apoptosis and extracellular matrix degradation by activating PI3K-Akt-mTOR-mediated autophagy. Front Pharmacol. 2022;13:999851. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 76.Xu F, Hu QF, Li J, Shi CJ, Luo JW, Tian WC, Pan LW. SOX4-activated lncRNA MCM3AP-AS1 aggravates osteoarthritis progression by modulating miR-149-5p/Notch1 signaling. Cytokine. 2022;152:155805. [DOI] [PubMed] [Google Scholar]
- 77.Jones K, Ramirez-Perez S, Niu S, Gangishetti U, Drissi H, Bhattaram P. SOX4 and RELA function as Transcriptional Partners to regulate the expression of TNF- responsive genes in Fibroblast-Like synoviocytes. Front Immunol. 2022;13:789349. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 78.Ye X, Yin C, Huang X, Huang Y, Ding L, Jin M, Wang Z, Wei J, Li X. ROS/TGF-beta signal mediated accumulation of SOX4 in OA-FLS promotes cell senescence. Exp Gerontol. 2021;156:111616. [DOI] [PubMed] [Google Scholar]
- 79.Yoshitomi H, Kobayashi S, Miyagawa-Hayashino A, Okahata A, Doi K, Nishitani K, Murata K, Ito H, Tsuruyama T, Haga H, et al. Human Sox4 facilitates the development of CXCL13-producing helper T cells in inflammatory environments. Nat Commun. 2018;9(1):3762. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 80.Jiang L, Lin J, Zhao S, Wu J, Jin Y, Yu L, Wu N, Wu Z, Wang Y, Lin M. ADAMTS5 in Osteoarthritis: Biological functions, Regulatory Network, and potential targeting therapies. Front Mol Biosci. 2021;8:703110. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 81.Latourte A, Richette P. Inhibition of ADAMTS-5: the right target for osteoarthritis? Osteoarthritis Cartilage. 2022;30(2):175–7. [DOI] [PubMed] [Google Scholar]
- 82.Xiang W, Wang C, Zhu Z, Wang D, Qiu Z, Wang W. Inhibition of SMAD3 effectively reduces ADAMTS-5 expression in the early stages of osteoarthritis. BMC Musculoskelet Disord. 2023;24(1):130. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 83.Grishko VI, Ho R, Wilson GL, Pearsall, AWt. Diminished mitochondrial DNA integrity and repair capacity in OA chondrocytes. Osteoarthritis Cartilage. 2009;17(1):107–13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 84.Zorov DB, Juhaszova M, Sollott SJ. Mitochondrial reactive oxygen species (ROS) and ROS-induced ROS release. Physiol Rev. 2014;94(3):909–50. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 85.Blanco FJ, Rego I, Ruiz-Romero C. The role of mitochondria in osteoarthritis. Nat Rev Rheumatol. 2011;7(3):161–9. [DOI] [PubMed] [Google Scholar]
- 86.Kan S, Duan M, Liu Y, Wang C, Xie J. Role of Mitochondria in Physiology of chondrocytes and diseases of Osteoarthritis and Rheumatoid Arthritis. Cartilage. 2021;13(2suppl):S1102–21. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 87.Liu JT, Guo X, Ma WJ, Zhang YG, Xu P, Yao JF, Bai YD. Mitochondrial function is altered in articular chondrocytes of an endemic osteoarthritis, Kashin-Beck disease. Osteoarthritis Cartilage. 2010;18(9):1218–26. [DOI] [PubMed] [Google Scholar]
- 88.Amiable N, Tat SK, Lajeunesse D, Duval N, Pelletier JP, Martel-Pelletier J, Boileau C. Proteinase-activated receptor (PAR)-2 activation impacts bone resorptive properties of human osteoarthritic subchondral bone osteoblasts. Bone. 2009;44(6):1143–50. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 89.Ma R, Xu J, Dong B, Kauther MD, Jager M, Wedemeyer C. Inhibition of osteoclastogenesis by RNA interference targeting RANK. BMC Musculoskelet Disord. 2012;13:154. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 90.Ono T, Hayashi M, Sasaki F, Nakashima T. RANKL biology: bone metabolism, the immune system, and beyond. Inflamm Regen. 2020;40:2. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
The datasets generated and/or analyzed during the current study are not publicly available but are accessible from the corresponding author upon reasonable request. Interested researchers may contact the corresponding author for data access inquiries, subject to compliance with any applicable privacy or confidentiality obligations.









