Potential benefits of advanced chelate-based trace minerals in improving bone mineralization, antioxidant status, immunity, and gene expression modulation in heat-stressed broilers

Taher Mohammadizad; Kamran Taherpour; Hossein Ali Ghasemi; Hassan Shirzadi; Fatemeh Tavakolinasab; Mohammad Hassan Nazaran

doi:10.1371/journal.pone.0311083

. 2024 Oct 2;19(10):e0311083. doi: 10.1371/journal.pone.0311083

Potential benefits of advanced chelate-based trace minerals in improving bone mineralization, antioxidant status, immunity, and gene expression modulation in heat-stressed broilers

Taher Mohammadizad ¹, Kamran Taherpour ^1,^*,^#, Hossein Ali Ghasemi ^2,^*,^#, Hassan Shirzadi ¹, Fatemeh Tavakolinasab ¹, Mohammad Hassan Nazaran ³

Editor: Ewa Tomaszewska⁴

PMCID: PMC11446444 PMID: 39356694

Abstract

Organic sources of trace minerals (TM) in broiler diets are more bioavailable and stable than inorganic sources, making them particularly beneficial during challenging periods such as heat stress (HS) conditions. A 42-d study investigated the effects of using advanced chelate technology-based TM (ACTM) or adding varying amounts of ACTM to broiler diets during HS conditions. The study involved 672 male broiler chickens in 7 treatment groups, including a thermoneutral control (TNC) group and six HS treatments. There were 8 replicate pens per treatment and 12 birds per replicate. The six HS treatments included birds exposed to a cyclic HS environment (34°C) for 8 h and were as follows: HSC, which consisted of the same basal diet with the recommended ITM levels; ACTM50 and ACTM100, which replaced the basal diet with 50% and 100% ACTM instead of ITM; ITM+ACTM12.5 and ITM+ACTM25, which involved adding extra ACTM to the ITM basal diet at 12.5% and 25%, respectively; and ITM125, which used 125% of the recommended levels of ITM in the basal diet. Compared with the HSC treatment, the TNC, ACTM100, and ITM+ACTM25 treatments resulted in increased (P < 0.05) body weight; tibia weight; tibia ash, phosphorus, iron, and manganese contents; secondary antibody titers; and serum TAC and SOD values but decreased (P < 0.05) serum MDA concentrations and the expression levels of the hepatic genes IL-1β, IL-6, and INF-γ. The TNC and ACTM100 groups also showed greater (P < 0.05) feed efficiency, tibia length, tibia zinc content, and hepatic SOD1 expression but exhibited reduced (P < 0.05) hepatic NF-kB expression. Significant increases (P < 0.05) in primary anti-NDV titers, serum GPx1 activity, and Nrf2 and GPx1 gene expression levels were also detected in the ACTM100, ITM+ACTM12.5, and ITM+ACTM25 groups. In conclusion, the findings suggest that replacing ITM with ACTM or adding ACTM to ITM diets, especially at a 25% higher dose, can effectively protect broilers from heat stress by promoting growth, reducing inflammation, and increasing the expression of antioxidant proteins.

Introduction

Heat stress (HS) is a common environmental stressor that can significantly affect physiological and metabolic processes in animals, including poultry. The breeding of broiler chickens with higher metabolic rates has made them more susceptible to HS [1,2]. Previous studies have shown that elevated temperatures can harm the health and well-being of birds by compromising their immune function, increasing mortality rates, and reducing feed efficiency and growth performance [3,4]. HS-induced oxidative stress is commonly associated with inflammatory pathway activation, resulting in tissue damage in birds [5]. Previous studies have shown that heat stress can activate the nuclear factor kappa B (NF-kB) signaling pathway, leading to inflammation in organs such as the liver [6] and gut [7]. The activation of this molecule is important for regulating inflammatory mediators such as interleukin-1 beta (IL-1β), interleukin-6 (IL-6), and interferon-gamma (IFN-γ), which affect the initiation and progression of inflammation [8]. Previous research has also identified the nuclear factor erythroid 2-related factor 2 (Nrf2) signaling pathway as a potential mechanism for regulating oxidative stress induced by HS [9]. In stress-induced conditions, Nrf2 moves to the nucleus and triggers the activation of protective genes, including those encoding antioxidants such as superoxide dismutase (SOD), glutathione peroxidase (GPx), and catalase (CAT) [10]. Therefore, there has been an increasing emphasis on the importance of antioxidants in minimizing oxidative stress and its associated physiological issues. Trace minerals (TM) such as zinc (Zn), copper (Cu), manganese (Mn), iron (Fe), and selenium (Se) are potential external antioxidants for reducing oxidative stress [11,12]. Furthermore, iodine (I) plays a vital role in the biological activity of thyroid hormones, while chromium (Cr) functions as an insulin cofactor, and both may also possess antioxidant properties [13,14].

Interactions between minerals and feed components can decrease their bioavailability and contribute to deficiencies [15]. Organic TM, found in chelated or complexed forms, are bound to organic compounds such as amino acids, proteins, or organic acids [16–18]. These minerals have a more stable structure, aiding digestion and absorption in the intestinal tract [19]. Therefore, the inclusion of organic minerals in animal diets, along with appropriate levels, may be justified due to the excessive excretion of these minerals during periods of HS. Although a direct correlation between the supplementation of organic TM in broiler diets and enhanced broiler performance has not been established [20], it has been observed that the inclusion of a single organic TM or a combination of organic TM in diets can have beneficial effects on various physiological processes, including antioxidant defense, immune response, and inflammation regulation. For example, supplementation with organic TM has been shown to lead to a reduction in lipid peroxidation [21], an increase in the levels of immunoglobulins [22], an increase in the activity of SOD and GPx [23], and an increase in the expression levels of anti-inflammatory factors [24].

Advanced chelation technology is a new method for synthesizing structures in different fields [25]. In this method, through self-assembly polymerization of organic acids, various structures are synthesized, the efficacy of which has been proven in numerous studies [26–32]. Through these experiments, the assessment of various physiological functions revealed that structures based on advanced chelation technology can effectively control a range of biological processes in plants, animals, or humans to maximize outcomes, leading to the term "metabolism optimizer behavior" for these effects. Previous studies have demonstrated positive outcomes when using organic acid-chelated TM in broiler chickens, laying hens, and turkeys [33–35]. However, the effects of advanced chelate-based TM on the bone health status, immunity, and antioxidant indicators of broilers exposed to HS are still unknown. Therefore, this study aimed to evaluate the effectiveness of an advanced chelated form of TM (ACTM) in heat-stressed broiler chickens by substituting or supplementing inorganic TM with this chelated form at different levels. The focus was on assessing the effects on bone quality and mineralization, antibody responses, hepatic expression levels of NF-kB-dominated pathways, blood antioxidant status, and hepatic expression levels of Nrf2-dominated pathways in heat-stressed broilers.

Materials and methods

Preparation of chelated TM

The ACTM product (Bonzachicken) used in this study was produced using a self-assembly method outlined in a patent (US8288587B2). The structural stability of the product is due to the encapsulation of core ions within the polymerized chelating agent structure. The stability of this structure across different pH values and concentrations of various TMs was investigated in previous studies [33,35]. BET analysis was used to determine the surface areas for advanced chelate crystallinity (S1 Fig). The BET surface areas calculated from the nitrogen isotherms agree well with the accessible surface areas obtained directly from the crystal structures in a geometric fashion.

Ethics statement

In this research study, the Animal Ethics Committee of Ilam University approved the use of animal trials (approval number 80–4188), which were conducted in accordance with the regulations outlined in the Guide for the Care and Use of Experimental Animals. All the procedures involving animals in this study adhere to the ARRIVE guidelines 2.0. The well-being and welfare of the birds were prioritized during the husbandry and euthanasia processes.

Birds, diets, and management

A 42-day study involved a total of 672 one-day-old male broiler chickens, which were randomly assigned to 7 groups. Each group had 8 replications, and each pen housed 12 birds. The birds were provided with unlimited access to mesh food and water. In this study, broilers were assigned to seven diets starting from day 0. The treatment groups were as follows: TNC, basal diet with recommended ITM levels, reared under thermoneutral conditions; HSC, basal diet with recommended ITM levels, reared under HS conditions; ACTM50, basal diet with 50% match levels instead of ITM, reared under HS conditions; ACTM100, basal diet with 100% match levels instead of ITM, reared under HS conditions; ITM+ACTM12.5, basal diet with ACTM added at 12.5% above recommended levels, reared under HS conditions; ITM+ACTM25, basal diet with ACTM added at 25% above recommended levels, reared under HS conditions; and ITM125, basal diet with 125% of recommended ITM levels, reared under HS conditions.

The amount of inorganic TM premix added was 2.5 g/kg for the TNC and HSC treatments and 3.125 g/kg for the ITM125 treatment. The inorganic TM premixes used in the TNC, HSC, and ITM125 treatments were formulated using ferrous sulfate, zinc sulfate, manganese sulfate, copper sulfate, sodium selenite, potassium iodide, and potassium dichromate. Different dosages of the Bonzachicken supplement were administered to achieve specific levels of ACTM, with the ACTM50 treatment receiving 1 g/kg and the ACTM100 treatment receiving 2 g/kg. ACTM was supplemented onto the ITM diet at the following two concentrations: 250 mg/kg in the ITM+ACTM12.5 group and 500 mg/kg in the ITM+ACTM25 group. The diets used in the study followed the nutrient recommendations outlined in the Ross 308 breeding guide for the starter, grower, and finisher stages (Table 1), with the exception of TM, which was included as part of the experimental treatments. S1 Table displays the composition of TM in the different experimental diets.

Table 1. Ingredient composition and calculated nutrient contents of basal diets (as-fed basis).

Item	Starter (d 0 to 10)	Grower (d 10 to 24)	Finisher (d 24 to 42)
Ingredients (%)
Corn	55.46	57.72	61.35
Soybean meal, 44%	32.18	30.15	26.71
Corn gluten meal, 60%	5.25	4.25	3.1
Soybean oil	2.2	3.5	4.8
Dicalcium phosphate	1.95	1.71	1.5
Limestone	1.16	1.07	1
Salt (NaCl)	0.22	0.23	0.2
Sodium bicarbonate	0.11	0.1	0.14
Vitamin premix ¹	0.25	0.25	0.25
Trace mineral premix ²	0–0.25	0–0.25	0–0.25
DL-Methionine	0.26	0.23	0.22
L-Lysine HCl	0.43	0.32	0.28
L-Threonine	0.21	0.15	0.13
Building sand	0–0.32	0–0.32	0–0.32
Total	100	100	100
Calculated nutritive value
Metabolizable energy, kcal/kg	3000	3100	3200
Crude protein (%)	23.0	21.5	19.5
Calcium (%)	0.96	0.87	0.79
Nonphytate phosphorus (%)	0.48	0.44	0.40
Sodium (%)	0.16	0.16	0.16
Digestible lysine (%)	1.28	1.15	1.03
Digestible methionine (%)	0.62	0.55	0.51
Digestible methionine + cysteine (%)	0.95	0.87	0.80
Digestible threonine (%)	0.86	0.77	0.69
DEB ³ , mEq/kg	250	240	230

Open in a new tab

¹Supplied per kg diet: 18 mg retinol, 4 mg cholecalciferol, 36 mg a-tocopherol acetate, 2 mg vitamin K₃, 1.75 mg vitamin B₁, 6.6 mg vitamin B₂, 9.8 mg niacin, 29.65 mg pantothenic acid, 2.94 mg vitamin B₆, 1 mg folic acid, 0.015 mg vitamin B₁₂, 0.1 mg biotin, 250 mg choline chloride and 1 mg ethoxyquin.

²The trace mineral (TM) supplementation were referred to our experimental design. The TM premixes were added in place of the building sand that is used as inert filler to adjust the formulation.

³DEB (dietary electrolyte balance) = (Na⁺, mEq/kg + K⁺, mEq/kg)–CL⁻, mEq/kg.

Environmental conditions

The experiment involved two environment-controlled rooms with independent temperature controls. Each room had a thermostat-controlled portable electric heater to regulate the temperature. Humidity levels were controlled using a humidifier with a 5 L capacity, maintaining a range of 55% ± 5%. The temperature of the chickens was closely monitored throughout the experiment. Initially, the chickens were kept at a temperature range of 33 to 34°C for the first 3 days. After that, the temperature in the TNC group was gradually reduced by 3°C per week until it reached a final temperature of 22–23°C. In contrast, the temperature in the HS groups remained consistent at 33 to 34°C for 8 hours (10:00–18:00) before dropping to match the TNC group’s temperature for the remaining 16 hours daily. To ensure proper ventilation, a mechanical ventilation system was used. This system employed a continuous-flow, pressure-controlled ventilator to effectively circulate air throughout the rooms. The lighting schedule involved a 24-hour period of uninterrupted light from day 0 to day 3, followed by a pattern of 23 h of light and 1 h of darkness from day 3 until the conclusion of the experiment.

Productive traits and sampling

During the entire duration of the experiment, the amount of feed consumed and the weight of the chickens were recorded, and the feed efficiency (body weight gain: feed intake) was calculated. The daily mortality rate of each pen was documented and utilized to modify the performance metrics. The uniformity rate was determined by calculating the coefficient of variation of the individual body weights at 42 days of age [36].

At the end of the experiment (day 42), one chicken per replicate pen (8 per treatment) were selected based on their average body weight. Blood samples were collected from the wing veins of each bird to obtain serum samples for blood antioxidant analysis. The samples were then centrifuged at 2,500 g for 15 minutes at 4°C. After blood collection, the birds were humanely euthanized via cervical dislocation by a trained animal technician. Thereafter, birds were dissected, and the tibiae on both sides were carefully separated and cleaned to remove any remaining tissues. The right tibia was used for morphological assessment, while the left tibia was wrapped in gauze, soaked in isotonic saline solution, and frozen at -20°C for future examination and analysis. Liver samples were obtained, and one lobe from each sample was rinsed with a 0.90% w/v NaCl solution, subsequently flash-frozen in liquid nitrogen, and finally stored at -80°C for gene expression analysis.

Blood antioxidant parameters

Spectrophotometric methods were used to measure the enzyme activities of GPx, SOD, and CAT, as well as the levels of total antioxidant capacity (TAC) and malondialdehyde (MDA) in the serum. The measurements were conducted using commercial kits, according to the manufacturer’s instructions. The TAC assay was conducted utilizing a TAC assay kit (Randox Laboratories Ltd., Crumlin, UK). The GPx, SOD, CAT, and MDA assays were performed using the corresponding assay kits (Cayman Chemical Co., Ann Arbor, MI, USA).

Tibial bone parameters

In this study, a digital caliper was used to measure the length and width of the right tibia. An Instron instrument (model 5500, Instron Corp., Canton, MA) was used to test the breaking strength of the tibias. The left tibia bone samples were dried and then exposed to 600°C for 6 h to undergo ashing. The calculation of the tibia ash percentage in relation to the weight of the dry tibia was conducted to measure the ash content of the tibia without considering moisture. An inductively coupled plasma-optical emission spectrometer (ICP‒OES; Optima 7000 DV, Perkin Elmer, Waltham, MA) was used to analyze the mineral content of the tibia ash and diet samples.

Antibody response

The vaccination program involved administering vaccines for Newcastle disease virus (NDV) and infectious bronchitis virus (IBV). Blood samples were collected from broiler chickens (2 birds per replicate) on days 27 and 35, which corresponded to 7 and 14 days after the last vaccination, respectively. Serum samples were obtained through centrifugation, and the antibody titers were determined using a hemagglutination inhibition test [37] for NDV and ELISA kits for IBV [38]. The results are expressed as logarithmic values.

This study also examined the humoral immune response against sheep red blood cells (SRBC). On days 20 and 27, two birds in each replicate were immunized by injecting 0.25 mL of a solution containing 10% SRBC in phosphate-buffered saline (PBS). Blood samples (1.5 mL/bird) were collected from the brachial veins of the birds 7 days after each immunization (on days 27 and 35 after hatching). The blood samples were placed in serum tubes and left at room temperature for 2 h. Next, the samples were centrifuged at 1500 × g for 10 minutes at 25°C to separate the serum, which was later stored at -20°C for antibody analysis. A direct hemagglutination assay using 96-well, U-bottomed microtiter plates was conducted to measure the serum antibody response against SRBC. Prior to the assay, the serum was heated at 56°C for 30 minutes to inactivate it. The levels of total anti-SRBC antibodies and IgG antibodies resistant to mercaptoethanol were determined using the protocol outlined by Delhanty and Solomon [39]. The levels of IgM antibodies were determined by subtracting the IgG response from the total antibody response.

Gene expression analysis

The RNA extraction and gene expression protocols used in this study were previously described by [40]. Total RNA was extracted from chicken liver samples using a commercial kit (Pars Tous Com., Iran), and the purity and quality of the RNA were assessed using a spectrophotometer (BioTek, USA). Genomic DNA was removed using DNase I (Thermo Fisher Scientific, Austin, TX, USA), and cDNA synthesis was performed using a commercial kit (Pars Tous, Iran). Gene expression levels were analyzed using quantitative polymerase chain reaction (qPCR) following the MIQE guidelines [41]. Various genes, including a reference gene [glyceraldehyde-3-phosphate (GAPDH)], immune-related genes [NF-kB, IL-1β, IFN-γ, IL-6, interleukin-10 (IL-10), and transforming growth factor beta (TGF-β1)], and antioxidant-related genes (Nrf2, GPx1, SOD1, and CAT), were examined. The reactions were performed in duplicate, with a total volume of 20 μl. SYBR Green qPCR Master Mix (Pars Tous, Iran) was used for RT‒qPCR on an ABI 7300 Real Time PCR system (Applied Biosystems, Foster City, CA). The sequences of primers used in the study are presented in Table 2. The measurements were conducted in triplicate. The relative gene expression was determined using the 2^−ΔΔCt method, where the Ct values for the target gene were normalized to the reference gene GAPDH.

Table 2. Gene special primers used in the real-time quantitative reverse transcription PCR.

Gene¹	Primer sequence (5⁰−3⁰)²	Length (nt)	GenBank number
NF-kB	F: `CCTGGCTGTTGTCGAATACCT`	154	NM_001001472.3
NF-kB	R: `CACTTTGTTCACATCTGCCCC`	154	NM_001001472.3
IFN-γ	F: `TTCAGATGTAGCTGACGGTGG`	139	NM_205149.2
IFN-γ	R: `CGGCTTTGACTTGTCAGTGTT`	139	NM_205149.2
IL-6	F: `TTCAGCAATGGCAACAGCAATG`	156	NM_204628.2
IL-6	R: `ATAGCAACAAGCGTCGTATTTCAAC`	156	NM_204628.2
IL-10	F: `GCTCTCACACCGCCTTGC`	216	NM_001004414.4
IL-10	R: `ACTGCTTAACTGCTATCACTAACTCTC`	216	NM_001004414.4
IL-1β	F: `TCTTCTACCGCCTGGACAGC`	145	XM_046931582.1
IL-1β	R: `TAGGTGGCGATGTTGACCTG`	145	XM_046931582.1
TGF-β1	F: `GGAGTTATTTGGGGGGGGGT`	141	NM_001318456.1
TGF-β1	R: `GCGTTTCTTTTTGGCCGCCTC`	141	NM_001318456.1
Nrf2	F: `GGCTTCTCCAGCTGCATTTC`	176	XM_046921130.1
Nrf2	R: `TACTTCAGCCAGGTTGTCGTT`	176	XM_046921130.1
GPx1	F: `CCATGTTCGAGAAGTGCGAGG`	120	NM_001277853.3
GPx1	R: `TGTACTGCGGGTTGGTCATCA`	120	NM_001277853.3
SOD1	F: `AATCTCATTACTACTCTGCGTTCTTG`	121	NM_205064.2
SOD1	R: `CCCAATCAACCATCTTCCATTACAC`	121	NM_205064.2
CAT	F: `GTTGGCGGTAGGAGTCTGGTCT`	182	NM_001031215.1
CAT	R: `GTGGTCAAGGCATCTGGCTTCTG`	182	NM_001031215.1
GAPDH	F: `CAGAACATCATCCCAGCGTCCAC`	134	NM_204305.2
GAPDH	R: `CGGCAGGTCAGGTCAACAACAG`	134	NM_204305.2

Open in a new tab

¹NF-kB, nuclear factor kappa B; IFN-γ, interferon gamma; IL-6, interleukin-6; IL-10, interleukin-10; IL-1β, interleukin-1 beta; TGF-β1, transforming growth factor-beta; Nrf2, nuclear factor erythroid 2-related factor 2; GPx1, glutathione peroxidase 1; SOD1, superoxide dismutase 1; CAT, catalase, and GAPDH, glyceraldehyde-3-phosphate.

²F = forward primer; R = reverse primer.

Statistical analysis

The statistical analysis was conducted using the generalized linear model (GLM) procedure, following a completely randomized design. The analysis was performed using the SAS Institute software (version 9.0, SAS Institute, Cary, NC, USA). The Shapiro‒Wilk test was used to evaluate the normality of the data, while the Levene test was used to investigate variance homogeneity. The pen served as the experimental unit for evaluating growth performance, while the individual bird was used to assess other physiological parameters. The LSMEANS option in SAS was utilized to evaluate the differences in means. To determine the significance of these differences, Tukey’s test was employed, with adjustments made at a significance level of P < 0.05.

Results

Growth performance

The performance of broiler chickens under HS conditions is presented in Fig 1. The body weight gain from 0 to 42 days in the ACTM100 and ITM+ACTM25 treatments was similar to that recorded in the TNC treatment group, but it was greater than that in the HSC and ACTM50 treatment groups (P < 0.05). Throughout the entire trial period, there was a significant increase in the feed intake of the TNC treatment group compared to that of all the other HS treatment groups (P < 0.05). Compared with the HSC, ACTM50, and ITM125 treatments, the ACTM100 treatment resulted in a significantly greater feed efficiency (P < 0.05). The overall feed efficiency also significantly increased in the ITM+ACTM25 and TNC treatment groups compared to that in the HSC treatment group (P < 0.05). Additionally, the birds in the TNC treatment group were more uniform than those in the HSC and ACTM50 treatment groups.

Bone characteristics

The results of the analysis of bone characteristics in heat-stressed broiler chickens at 42 days of age are presented in Table 3. Tibial length and weight were greater (P < 0.05) in the ACTM100 and TNC treatments than in the HSC and ACTM50 treatments. Compared with the HSC treatment group, the ITM+ACTM25 treatment group also exhibited greater (P < 0.05) tibia length and weight. A significant increase in the diameter of the tibia at its widest point was observed in the TNC treatment group compared to the HSC treatment group (P < 0.05). The ash and phosphorus levels in the tibia of birds receiving the ACTM100 and ITM+ACTM25 treatments were similar (P > 0.05) to those observed in birds receiving the TNC treatment but greater (P < 0.05) than those in birds receiving the HSC treatment. TNC exhibited the highest tibia sodium concentration (P < 0.05), which was significantly different from that of the other treatments, except for the ITM+ACTM25 and ITM125 treatments. The Fe content in the tibia was greater (P < 0.05) in the ACTM100 and ITM+ACTM25 treatments than in the HSC treatment. Compared with the HSC and ACTM50 treatments, the ACTM100 treatment resulted in the greatest increase in the tibia Zn and Mn contents (P < 0.05), with a statistically significant difference observed. The tibia Zn content was also greater (P < 0.05) in the ITM+ACTM25 treatment group than in the ACTM50 treatment group. Moreover, the tibia Mn and Cu contents were greater (P < 0.05) in the ITM+ACTM25 treatment group than in the HSC treatment group. However, there was no significant change in tibial calcium, magnesium, or potassium content due to the experimental treatments (P > 0.05).

Table 3. Effect of advanced chelate technology-based trace minerals on bone morphology and mineral contents observed in broiler chickens challenged with heat stress.

	Experimental groups¹
Item	TNC	HSC	ACTM50	ACTM100	ITM+ ACTM12.5	ITM+ ACTM25	ITM125	SEM	P-value
length (mm)	105.5^a	96.0^b	96.9^bc	104.3^a	99.8^abc	103.7^ab	99.6^abc	1.63	<0.001
weight (g)	15.09^a	12.79^d	13.10^cd	14.50^ab	13.55^bcd	14.38^abc	13.41^bcd	0.307	0.0002
Relative tibia weight	0.530	0.506	0.513	0.548	0.514	0.546	0.518	0.0145	0.262
Diameter (widest, mm)	9.88^a	9.30^b	9.40^ab	9.73^ab	9.53^ab	9.73^ab	9.52^ab	0.113	0.009
Diameter (narrowest, mm)	7.59	7.15	7.19	7.44	7.24	7.38	7.24	0.1238	0.158
Ash (%)	52.44^a	48.41^b	48.90^ab	52.19^a	51.34^ab	52.09^a	50.12^ab	0.821	0.002
Calcium (g/kg)	166.3	158.8	160.3	163.0	159.2	165.9	159.1	2.44	0.1226
Phosphorus (g/kg)	95.9^a	88.2^b	90.7^ab	94.9^a	91.2^ab	94.8^a	90.8^ab	1.496	0.004
Magnesium (g/kg)	4.66	4.01	4.10	4.13	4.14	4.43	4.09	0.158	0.0643
Potassium (g/kg)	2.25	2.03	2.03	2.12	2.14	2.19	2.10	0.081	0.4395
Sodium (g/kg)	5.54^a	4.65^b	4.58^b	4.68^b	4.67^b	4.86^ab	4.76^ab	0.1867	0.0114
Iron (mg/kg)	131.8^ab	118.7^b	122.8^ab	138.3^a	128.3^ab	137.2^a	125.0^ab	4.08	0.0095
Zinc (mg/kg)	170.3^abc	162.0^bc	159.8^c	182.5^a	169.9^abc	178.6^ab	165.6^abc	3.89	0.0009
Manganese (mg/kg)	4.66^abc	3.70^c	4.06^bc	5.07^a	4.52^abc	4.78^ab	4.40^abc	0.222	0.0016
Copper (mg/kg)	0.819^ab	0.736^b	0.798^ab	0.853^ab	0.840^ab	0.897^a	0.852^ab	0.0287	0.0110

Open in a new tab

Means within a row not sharing the same superscript are different at P < 0.05. Values are means of 8 replicates (pens) per treatment.

¹TNC: Thermoneutral control group with commercially recommended levels of inorganic trace minerals (ITM). Heat stress groups contained: HSC, heat stress control group with commercially recommended levels of ITM; ACTM50, advanced chelate technology-based trace minerals (ACTM) match to 50% of the ITM; ACTM100, ACTM equivalent to ITM; ITM+ACTM12.5, ACTM added to the ITM diet at the level of 12.5% above the commercially recommended levels for TM; ITM+ACTM25, ACTM added to the ITM at the level of 25% above the recommended levels for TM. ITM125, 125% of the commercially recommended levels of ITM.

Humoral immune response

The antibody responses to different antigens are provided in Table 4. Compared with those in the HSC group, the primary anti-NDV antibody titers and secondary anti-IBV antibody titers in the TNC, ACTM100, and ITM+ACTM25 groups were significantly greater (P < 0.05). The experimental treatments did not have any significant effects on the primary anti-SRBC antibody responses (P > 0.05). In contrast, the secondary total anti-SRBC titers were significantly greater (P < 0.05) in the TNC, ACTM100, and ITM+ACTM25 treatment groups than in the HSC treatment group. The secondary anti-SRBC IgM response was also significantly greater in the TNC treatment group than in the HSC and ACTM50 treatment groups (P < 0.05).

Table 4. Effect of advanced chelate technology-based trace minerals on antibody responses against Newcastle disease virus (NDV), infectious bronchitis virus (IBV), and sheep red blood cells (SRBC) observed in broiler chickens challenged with heat stress.

	Experimental groups¹
Item	TNC	HSC	ACTM50	ACTM100	ITM+ ACTM12.5	ITM+ ACTM25	ITM25	SEM	P-value
Anti-NDV titer² (log₂)
day 27	3.13^a	2.50^b	2.72^ab	3.09^a	2.89^a	3.06^a	2.80^ab	0.125	0.012
day 35	2.84	2.20	2.50	2.74	2.57	2.74	2.52	0.139	0.056
Anti-IBV titer³ (log₁₀)
day 27	3.79	3.49	3.69	3.76	3.65	3.75	3.61	0.079	0.145
day 35	4.68^a	4.34^b	4.47^ab	4.60^a	4.48^ab	4.61^a	4.49^ab	0.069	0.037
Anti-SRBC antibody response⁴ (log2)
Primary
Total antibody	2.53	2.05	2.42	2.44	2.43	2.41	2.61	0.125	0.098
IgG	1.63	0.72	1.23	1.23	1.12	1.43	1.35	0.252	0.289
IgM	1.35	1.23	1.52	1.38	1.42	1.32	1.82	0.259	0.776
Secondary
Total antibody	3.20^a	2.70^c	2.82^bc	3.13^ab	2.99^abc	3.12^ab	2.91^abc	0.102	0.018
IgG	1.75	1.78	2.10	1.96	1.72	1.95	1.85	0.211	0.857
IgM	2.53^a	1.52^bc	1.13^c	2.14^ab	2.13^ab	2.03^abc	1.92^abc	0.295	0.050

Open in a new tab

Means within a row not sharing the same superscript are different at P < 0.05. Values are means of 8 replicates (pens) per treatment.

² Hemagglutinin inhibition test.

³ The mean ELISA antibody response.

⁴ Hemagglutinin inhibition test for primary (day 27) and secondary (day 35) antibody response against SRBC.

Gene expression related to the NF-kB signaling pathway

The results pertaining to gene expression in the liver related to the NF-kB pathway are presented in Fig 2. The expression of the Nf-kB gene in the ACTM100 treatment group was similar to that in the TNC treatment group but lower than that in the HSC treatment group (P < 0.05). Decreases in IL-1β and IL-6 gene expression levels were observed in the ACTM100, ITM+ACTM25, and TNC treatment groups compared to the HSC treatment group (P < 0.05). The expression of the IFN-γ gene was greater (P < 0.05) in the ACTM100 and ITM+ACTM25 treatment groups than in the TNC treatment group but lower (P < 0.05) than in the other treatment groups, except for the ITM+ACTM12.5 treatment group. Furthermore, the expression of the hepatic TGF-β gene was greater (P < 0.05) in the ACTM100, ITM+ACTM25, and TNC treatment groups than in the other treatment groups, except for the ITM+ACTM12.5 treatment group. Notably, the TNC treatment group exhibited the highest level of TGF-β expression (P < 0.05).

Blood antioxidant status

According to Table 5, the TAC and SOD activity were lower for the ACTM100 and ITM+ACTM25 treatments than for the HSC treatment (P < 0.05). The GPx activity of birds receiving the ACTM100 and ITM+ACTM25 treatments was comparable (P > 0.05) to that of those receiving the TNC treatment but greater (P < 0.05) than that of those receiving the HSC and ACTM50 treatments. Greater GPx activity was also detected in the ITM+ACTM12.5 and ITM125 treatments than in the HSC treatment (P < 0.05). The lowest serum MDA concentration was also observed in the TNC and ACTM100 treatments, which exhibited a significant difference from the HSC and ACTM50 treatments (P < 0.05). The serum MDA concentration in the ITM+ACTM25 treatment group was also lower (P < 0.05) than that in the HSC treatment group, while it was comparable to that in the TNC treatment group. However, the experimental treatments had no effect on serum CAT activity at 42 days of age (P > 0.05).

Table 5. Effect of advanced chelate technology-based trace minerals on serum antioxidant status and hormone profile observed in broiler chickens challenged with heat stress.

	Experimental groups¹
Item	TNC	HSC	ACTM50	ACTM100	ITM+ ACTM12.5	ITM+ ACTM25	ITM125	SEM	P-value
Total antioxidant capacity (U/mL)	3.86^ab	2.89^b	3.52^ab	4.11^a	3.61^ab	4.02^a	3.59^ab	0.2419	0.0187
Glutathione peroxidase (U/mL)	1883^a	1325^c	1441^bc	1930^a	1708^ab	1835^a	1673^ab	73.26	< .0001
Superoxide dismutase (U/mL)	196.2^a	167.4^b	177.2^ab	218.1^a	182.8^ab	209.8^a	176.6^ab	9.73	0.0038
Catalase (U/mL)	2.54	2.22	2.41	2.61	2.43	2.76	2.33	0.1436	0.1760
Malondialdehyde (nmol/mL)	1.70^d	2.75^a	2.48^ab	1.87^cd	2.33^abc	1.94^bcd	2.42^abc	0.1358	< .0001

Open in a new tab

Means within a row not sharing the same superscript are different at P < 0.05. Values are means of 8 replicates (pens) per treatment.

Gene expression of Nrf2 signaling pathway components

Fig 3 displays the hepatic gene expression results for the Nrf2 pathway. Nrf2 gene expression was greater in all experimental treatments, except for the ITM+ACTM12.5 and ITM125 treatments, than in the HSC treatment. Additionally, there was greater expression of the SOD1 gene (P < 0.05) in the ACTM100 and TNC treatment groups than in the HSC treatment group. The expression of the GPx1 gene was also greater (P < 0.05) in the ACTM100, ITM+ACTM25, ITM+ACTM12.5, and TNC treatment groups than in the HSC treatment group. Among these treatments, the TNC treatment had the greatest effect on GPx1 gene expression (P<0.05). Additionally, a reduction in CAT gene expression was observed in the HSC and ACTM50 treatment groups compared to that in the TNC treatment group (P < 0.05).

Discussion

The current study aligns with previous research indicating that broiler chickens have reduced feed intake when exposed to high temperatures [36,42]. Heat stress conditions may negatively impact feed intake by affecting the presence and distribution of enteroendocrine cells, which regulate appetite [43]. Reduced feed consumption also decreases the availability of nutrients for growth and development [44]. Heat stress can also increase corticosterone levels, which hinder broiler growth and development by impeding thyroid hormone synthesis and restricting feed intake [45]. Furthermore, Quinteiro-Filho et al. [46] reported that HS activates the hypothalamic‒pituitary‒adrenal axis, causing a redistribution of energy resources away from growth processes, resulting in decreased overall growth performance.

This study revealed that using advanced chelate sources of TM at 50% of the recommended commercial level can maintain growth performance in broiler chickens. Our findings also indicate that substituting ITM with ACTM or adding ACTM to the ITM diet at a dosage exceeding the recommended level of 25% could improve productive performance under HS conditions. This finding aligns with previous research indicating that dietary supplementation with 500 ppm organic minerals can positively influence broiler growth [47]. Additionally, Rajkumar et al. [48] showed that incorporating organic forms of Se, Cr, and Zn into the diet can improve overall growth performance in heat-stressed broilers. Baxter et al. [11] also indicated that incorporating organic TM into the diet can reduce stress, improve the inflammatory response, enhance gut integrity, and ultimately improve growth performance. The enhanced growth performance in the ACTM100 and ITM+ACTM25 treatments may be due to improvements in immune system function and heightened activity of antioxidant enzymes, as indicated in this study. The sophisticated chelated structure of the organic acid-chelated TM supplement is believed to have a greater impact on improving growth performance in broiler chickens fed the ACTM100 and ITM+ACTM25 diets. The spatial arrangement of organic acid molecules in the coordination sphere of metal ions creates optimal conditions for chelating minerals, which promotes biological characteristics [33,34]. In addition, the advantages of advanced chelation technology-based TM may be partly attributed to the organic acids present in the supplement. The supplement’s organic acids have several health effects after they penetrate enterocyte cells [29,35]. Several studies have shown that including organic acids in broilers’ diets has positive effects on gut morphology, intestinal mucosal barrier function, and the number of harmful bacteria in the intestine [49–51]. Therefore, it seems that improving gut health through the use of organic acids may lead to better nutrient digestion and absorption, which in turn might boost growth performance.

Based on the results of the present study, exposure to HS had detrimental impacts on various aspects of the tibia bone, including its morphological characteristics (length, weight, and diameter), as well as its ash, phosphorus, and sodium contents. In previous studies, it was observed that HS has negative effects on bone quality parameters in broilers [52] and pullets [53]. Heat stress can have detrimental effects on bone health through various mechanisms. These include disruptions in the gastrointestinal tract, which can affect the absorption of important nutrients such as phosphorus [54]. In addition, HS has the potential to compromise the immune system, which can result in the transportation of pathogens and their byproducts to bones via the bloodstream, leading to inflammation and damage [55]. The functioning of the hypothalamic‒pituitary‒adrenal axis can also be affected, leading to negative impacts on bone remodeling and increased cell death [56]. Furthermore, HS can impair the antioxidant system of bone cells, resulting in oxidative stress [57].

The best results in terms of bone morphology and higher levels of ash, phosphorus, and TM were observed when ITM was completely replaced with ACTM in the ACTM100 treatment or when ACTM was added to the ITM diet at an extra level of 25% of the recommended dosage in the ITM+ACTM25 treatment. These findings suggest that the heat-stressed broilers in these groups had more bone components available. Under typical environmental conditions, comparable results were observed in terms of the physical characteristics and mineral profile of the tibia bone when the inorganic TM premix was completely replaced with advanced chelate technology-based TM in the diet of broilers [35] and turkeys [34]. As previously stated, the presence of HS leads to oxidative stress and inflammation in bone cells [57,58]. Therefore, one potential reason for the improvement of bone characteristics in the ACTM100 and ITM+ACTM25 treatments could be linked to the observed enhancement in antioxidant status and anti-inflammatory properties in this study. The elevated levels of ash and phosphorous in the tibia of broilers treated with ACTM100 and ITM+ACTM25 also support the concept that organic TM supplementation may reduce the interference caused by substances (particularly phytate) that form insoluble complexes with TM [27,35].

There is a clear connection between the prolonged impact of stress on the hypothalamic‒pituitary‒adrenal axis and a decrease in immune system functioning [59,60]. In addition, HS causes oxidative stress, resulting in the oxidation of lipids in the cell membrane of immune-related cells, which can lead to a decrease in immune responses [45,61]. Our findings revealed a noticeable decline in humoral immune responses, specifically in terms of antibody titers against various antigens (NDV, IBV, and SRBC), in broiler chickens raised under HS conditions. The transcription factor NF-kB plays a crucial role in regulating genes involved in the immune response and inflammation [62,63]. Activation of the NF-kB signaling pathway has been shown to elicit the synthesis and release of proinflammatory cytokines, thereby playing a crucial role in the initiation and progression of the inflammatory response [6]. Once produced, these proinflammatory cytokines actively participate in the inflammatory process, further exacerbating the immune response [64]. Previous studies have demonstrated a significant increase in NF-kB protein expression in response to HS [5,7]. Our findings also revealed that prolonged exposure to HS resulted in a significant upregulation of NF-kB expression and subsequent upregulation of IFN-γ-, IL-1β-, and IL-6-related proteins in the liver. These results indicate that the activation of the NF-kB signaling pathway and subsequent secretion of the inflammatory factors IFN-γ, IL-1β, and IL-6 are key mechanisms by which HS induces inflammation in the livers of broilers.

The results of the current study indicate that completely substituting inorganic TM sources with advanced chelated TM has the potential to offer protection against HS conditions by effectively regulating crucial immune-related genes. The implementation of this replacement strategy resulted in the downregulation of NF-kB, a decrease in the expression of the proinflammatory cytokines IL-1β, IL-6, and IFN-γ, and an increase in the expression of the anti-inflammatory cytokine TGF-β. The incorporation of ACTM in ITM diets at 12.5% and 25% (referred to as the ITM+ACTM12.5 and ITM+ACTM25 treatments, respectively) has also been shown to regulate the immune response by reducing the activity of NF-kB and IFN-γ. Our study also revealed that the ACTM100 and ITM+ACTM25 treatments increased the serum antibody titers against NDV, IBV, and SBRC at different ages in heat-stressed broilers, suggesting a positive effect on humoral immune function. The use of ACTM seems to reduce the immunopathological effects caused by HS, resulting in decreased hepatic inflammation and systemic inflammation. In accordance with our findings, it has been observed that the inclusion of an organic form of zinc (Zn–Gly chelate), as opposed to zinc sulfate, as a dietary supplement for broiler chickens has the potential to modulate the immune response [24]. This modulation is achieved through the reduction of proinflammatory cytokine production and the enhancement of the expression of anti-inflammatory factors, particularly IL-10. A previous study also indicated that the replacement of ITM (Fe, Cu, Mn, and Zn in the form of sulfates and Se as sodium selenite) with organic TM led to an increase in blood IgG levels [22]. In a previous investigation conducted on laying hens exposed to elevated ambient temperatures, it was observed that the inclusion of dietary organic mineral mixture supplemented at levels of 0.5 and 1 g/kg resulted in enhanced antibody titers against avian influenza H9N1 and NDV compared to the control diet [65]. The addition of an organic acid-TM chelate supplement in this study has the potential to enhance the absorption of TM, thereby increasing its availability for various physiological processes, such as supporting optimal immune system functions. By ensuring an adequate supply of TM, the immune system can function at its optimal efficiency, thereby enhancing its ability to combat difficult conditions and maintain overall health [66]. In addition, the observed increase may be partly due to the release of organic acids in the enterocytes of the gastrointestinal tract following the administration of this supplement. Based on a previous investigation, the inclusion of organic acids in poultry feed was shown to improve both humoral and cell-mediated immune responses while also effectively modulating cytokine levels within the host organism [67].

Heat stress disrupts the balance between cellular antioxidants and oxidants, which in turn affects the homeostasis of these crucial components inside the cell [68]. The transcription factor Nrf2 is recognized as a crucial regulator of antioxidant capacity in the body. The significance of this phenomenon lies in its ability to modulate antioxidant defense mechanisms in various organs, such as the intestine [69], liver [9], and kidneys [70]. A recent study revealed a decrease in the expression of Nrf2 in hepatocytes exposed to HS [9]. The findings of this study revealed a significant reduction in the hepatic mRNA levels of Nrf2, GPx1, and SOD1 due to HS. In addition, HS significantly decreased the levels of key antioxidant enzymes, including GPX, SOD, and CAT. The results obtained from this study also revealed that exposure to HS led to a significant increase in TAC while simultaneously elevating the serum concentration of MDA.

The examination of gene expression patterns associated with antioxidation revealed that replacing ITM with ACTM completely or supplementing the ITM diet with ACTM at a dosage 12.5 or 25% higher than the recommended level has been found to enhance the hepatic expression of the Nrf2 gene, which is responsible for producing antioxidant enzymes, especially hepatic SOD1 and GPx1. Furthermore, the ACTM100 and ITM+ACTM25 treatments led to increased levels of serum TAC, GPx, and SOD but simultaneously decreased levels of serum MDA in response to the HS challenge. The present study proposes that incorporating dietary supplementation with ACTM, especially in the ACTM100 and ITM+ACTM25 groups, could mitigate the negative effects of HS on broiler chickens and may help the chickens achieve a stable physiological state similar to that of the nonchallenged group. Consistent with the findings of this study, the results of a recent study indicated that replacing ITM with organic TM, which contained 50 ppm Fe, 30 ppm Zn, 15 ppm Mn, and 0.2 ppm Se or more, resulted in a significant increase in the gene expression of SOD and GPx in the ileum of piglets [71]. In another study on broiler breeders, Umar Yaqoob et al. [23] discovered that substituting commercial levels of ITM (Cu, Zn, Fe, and Mn sulfates) with 70% commercial levels of TM in the form of complexed glycinates had a positive impact on liver antioxidant status. The effectiveness of antioxidant stress defense relies on the presence of antioxidant minerals as cofactors. Specifically, Zn, Cu, and Mn function as cofactors for SOD, whereas Fe is a constituent of CAT, and Se acts as a cofactor for GPx. Hence, the presence of these minerals in sufficient amounts is essential for the effective operation of antioxidant stress defense mechanisms [34,35]. Consistent with previous research findings, it has been observed that organic forms of Zn, Mn, Cu, and Fe have the potential to enhance the production of SOD and CAT [72,73]. Furthermore, it has been discovered that organic Se can enhance the activity of GPx [74,75]. These results suggest that the inclusion of advanced chelate technology-based TM, particularly in the ACTM100 and ITM+ACTM25 diets, may have led to an increase in mineral bioavailability. This, in turn, could have contributed to a decrease in ROS accumulation and an improvement in the antioxidant defense system when compared to the HSC diet. However, additional research is necessary to investigate the underlying mechanisms and establish the ideal levels of TM inclusion for maximizing these benefits in broiler production systems under challenging conditions, as applied in this study.

In conclusion, ACTM supplementation has positive effects on productive performance, bone characteristics, and health status in heat-stressed broilers, especially when it is used as a complete replacement for inorganic TM or at a supplemental level of 25% in the feed. These findings also suggested that ACTM supplementation can protect broilers from heat stress by reducing the expression of inflammatory markers and increasing the expression of antioxidant proteins. These results suggest that further research is needed to understand the mechanism of action of ACTM and determine the optimum TM sources and requirements in broiler chickens reared under HS conditions.

Supporting information

S1 Fig. The BET analysis of advanced chelates crystallinity used in this study.

(DOCX)

pone.0311083.s001.docx^{(68.2KB, docx)}

S1 Table. Supplemental level and analyzed content of trace minerals in experimental diets (mg/kg).

(DOCX)

pone.0311083.s002.docx^{(15.4KB, docx)}

S1 Data

(XLSX)

pone.0311083.s003.xlsx^{(48.7KB, xlsx)}

Data Availability

All relevant data are within the manuscript and its Supporting Information files.

Funding Statement

The author(s) received no specific funding for this work.

References

1.Virden WS, Kidd MT. Physiological stress in broilers: Ramifications on nutrient digestibility and responses. J Appl Poult Res. 2009;18:338–47. doi: 10.3382/japr.2007-00093 [DOI] [Google Scholar]
2.Altan Ö, Pabuçcuoǧlu A, Altan A, Konyalioǧlu S, Bayraktar H. Effect of heat stress on oxidative stress, lipid peroxidation and some stress parameters in broilers. Br Poult Sci. 2003;44:545–50. doi: 10.1080/00071660310001618334 [DOI] [PubMed] [Google Scholar]
3.He SP, Arowolo MA, Medrano RF, Li S, Yu QF, Chen JY, et al. Impact of heat stress and nutritional interventions on poultry production. Worlds Poult Sci J. 2018;74:647–64. doi: 10.1017/S0043933918000727 [DOI] [Google Scholar]
4.Wang Y, Xia L, Guo T, Heng C, Jiang L, Wang D, et al. Research Note: Metabolic changes and physiological responses of broilers in the final stage of growth exposed to different environmental temperatures. Poult Sci. 2020;99:2017–25. doi: 10.1016/j.psj.2019.11.048 [DOI] [PMC free article] [PubMed] [Google Scholar]
5.Liu YL, Ding KN, Shen XL, Liu HX, Zhang YA, Liu YQ, et al. Chronic heat stress promotes liver inflammation in broilers via enhancing NF-kB and NLRP3 signaling pathway. BMC Vet Res. 2022;18:289. doi: 10.1186/s12917-022-03388-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
6.Du J, Shi Y, Zhou C, Guo L, Hu R, Huang C, et al. Antioxidative and anti-inflammatory effects of vitamin C on the liver of laying hens under chronic heat stress. Front Vet Sci. 2022;9:1052553. doi: 10.3389/fvets.2022.1052553 [DOI] [PMC free article] [PubMed] [Google Scholar]
7.Wang C, Bing A, liu H, Wang X, Zhao J, Lin H, et al. High ambient humidity aggravates ammonia-induced respiratory mucosal inflammation by eliciting Th1/Th2 imbalance and NF-kB pathway activation in laying hens. Poult Sci. 2022;101:102028. doi: 10.1016/j.psj.2022.102028 [DOI] [PMC free article] [PubMed] [Google Scholar]
8.Saroj P, Bansal Y, Singh R, Akhtar A, Sodhi RK, Bishnoi M, et al. Neuroprotective effects of roflumilast against quinolinic acid-induced rat model of Huntington’s disease through inhibition of NF-kB mediated neuroinflammatory markers and activation of cAMP/CREB/BDNF signaling pathway. Inflammopharmacology. 2021;29:499–511. doi: 10.1007/s10787-020-00787-3 [DOI] [PubMed] [Google Scholar]
9.Ding KN, Lu MH, Guo YN, Liang SS, Mou RW, He YM, et al. Resveratrol relieves chronic heat stress-induced liver oxidative damage in broilers by activating the Nrf2-Keap1 signaling pathway. Ecotoxicol Environ Saf. 2023;249:114411. doi: 10.1016/j.ecoenv.2022.114411 [DOI] [PubMed] [Google Scholar]
10.Bhakkiyalakshmi E, Dineshkumar K, Karthik S, Sireesh D, Hopper W, Paulmurugan R, et al. Pterostilbene-mediated Nrf2 activation: Mechanistic insights on Keap1:Nrf2 interface. Bioorg Med Chem. 2016;24:3378–86. doi: 10.1016/j.bmc.2016.05.011 [DOI] [PubMed] [Google Scholar]
11.Baxter MFA, Greene ES, Kidd MT, Tellez-Isaias G, Orlowski S, Dridi S. Water amino acid-chelated trace mineral supplementation decreases circulating and intestinal HSP70 and proinflammatory cytokine gene expression in heat-stressed broiler chickens. J Anim Sci. 2020;98:skaa049. doi: 10.1093/jas/skaa049 [DOI] [PMC free article] [PubMed] [Google Scholar]
12.Calik A, Emami NK, Schyns G, White MB, Walsh MC, Romero LF, et al. Influence of dietary vitamin E and selenium supplementation on broilers subjected to heat stress, Part II: oxidative stress, immune response, gut integrity, and intestinal microbiota. Poult Sci. 2022;101:101858. doi: 10.1016/j.psj.2022.101858 [DOI] [PMC free article] [PubMed] [Google Scholar]
13.Piray A, Foroutanifar S. Chromium supplementation on the growth performance, carcass traits, blood constituents, and immune competence of broiler chickens under heat stress: a systematic review and dose–response meta-analysis. Biol Trace Elem Res. 2022;200:2876–88. doi: 10.1007/s12011-021-02885-x [DOI] [PubMed] [Google Scholar]
14.Sarlak S, Tabeidian SA, Toghyani M, Foroozandeh Shahraki AD, Goli M, Habibian M. Supplementation of two sources and three levels of iodine in the diet of laying hens: effects on performance, egg quality, serum and egg yolk lipids, antioxidant status, and iodine accumulation in eggs. Ital J Anim Sci. 2020;19:974–88. doi: 10.1080/1828051X.2020.1810142 [DOI] [Google Scholar]
15.Aksu T, Aksu MI, Yoruk MA, Karaoglu M. Effects of organically-complexed minerals on meat quality in chickens. Br Poult Sci. 2011;52:558–63. doi: 10.1080/00071668.2011.606800 [DOI] [PubMed] [Google Scholar]
16.Zhao J, Shirley RB, Vazquez-Anon M, Dibner JJ, Richards JD, Fisher P, et al. Effects of chelated trace minerals on growth performance, breast meat yield, and footpad health in commercial meat broilers. J Appl Poult Res. 2010;19:365–72. doi: 10.3382/japr.2009-00020 [DOI] [Google Scholar]
17.Kim GB, Seo YM, Shin KS, Rhee AR, Han J, Paik IK. Effects of supplemental copper-methionine chelate and copper-soy proteinate on the performance, blood parameters, liver mineral content, and intestinal microflora of broiler chickens. J Appl Poult Res. 2011;20:21–32. doi: 10.3382/japr.2010-00177 [DOI] [Google Scholar]
18.Seyfori H, Ghasemi HA, Hajkhodadadi I, Hafizi M. Effects of water supplementation of an organic acid-trace mineral complex on production and slaughter parameters, intestinal histomorphology, and macronutrient digestibility in growing ostriches. Poult Sci. 2019;98:4860–7. doi: 10.3382/ps/pez221 [DOI] [PubMed] [Google Scholar]
19.Vieira R, Ferket P, Malheiros R, Hannas M, Crivellari R, Moraes V, et al. Feeding low dietary levels of organic trace minerals improves broiler performance and reduces excretion of minerals in litter. Br Poult Sci. 2020;61:574–82. doi: 10.1080/00071668.2020.1764908 [DOI] [PubMed] [Google Scholar]
20.Zhu Z, Yan L, Hu S, An S, Lv Z, Wang Z, et al. Effects of the different levels of dietary trace elements from organic or inorganic sources on growth performance, carcass traits, meat quality, and faecal mineral excretion of broilers. Arch Anim Nutr. 2019;73:324–337. doi: 10.1080/1745039X.2019.1620050 [DOI] [PubMed] [Google Scholar]
21.Kong J, Qiu T, Yan X, Wang L, Chen Z, Xiao G, et al. Effect of replacing inorganic minerals with small peptide chelated minerals on production performance, some biochemical parameters and antioxidant status in broiler chickens. Front Physiol. 2022;13:1027834. doi: 10.3389/fphys.2022.1027834 [DOI] [PMC free article] [PubMed] [Google Scholar]
22.Zhang WF, Tian M, Song JS, Chen F, Lin G, Zhang SH, et al. Effect of replacing inorganic trace minerals at lower organic levels on growth performance, blood parameters, antioxidant status, immune indexes, and fecal mineral excretion in weaned piglets. Trop Anim Health Prod. 2021;53:121. doi: 10.1007/s11250-021-02561-1 [DOI] [PubMed] [Google Scholar]
23.Umar Yaqoob M, Wang G, Sun W, Pei X, Liu L, Tao W, et al. Effects of inorganic trace minerals replaced by complexed glycinates on reproductive performance, blood profiles, and antioxidant status in broiler breeders. Poult Sci. 2020;99:2718–26. doi: 10.1016/j.psj.2019.11.058 [DOI] [PMC free article] [PubMed] [Google Scholar]
24.Jarosz L, Marek A, Gradzki Z, Kwiecień M, Zylińska B, Kaczmarek B. Effect of feed supplementation with zinc glycine chelate and zinc sulfate on cytokine and immunoglobulin gene expression profiles in chicken intestinal tissue. Poult Sci. 2017;96:4224–35. doi: 10.3382/ps/pex253 [DOI] [PubMed] [Google Scholar]
25.Nazaran MH. Chelate compounds. 2010. Available: https://patents.google.com/patent/US8288587B2/en.
26.Hafizi M, Hajarizadeh A, Atashi A, Kalanaky S, Fakharzadeh S, Masoumi Z, et al. Nanochelating based nanocomplex, GFc7, improves quality and quantity of human mesenchymal stem cells during in vitro expansion. Stem Cell Res Ther. 2015;6:226. doi: 10.1186/s13287-015-0216-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
27.Seyfori H, Ghasemi HA, Hajkhodadadi I, Nazaran MH, Hafizi M. Growth performance, mineral digestibility, and blood characteristics of ostriches receiving drinking water supplemented with varying levels of chelated trace mineral complex. Biol Trace Elem Res. 2018;183:147–55. doi: 10.1007/s12011-017-1117-9 [DOI] [PubMed] [Google Scholar]
28.Fakharzadeh S, Hafizi M, Baghaei MA, Etesami M, Khayamzadeh M, Kalanaky S, et al. Using nanochelating technology for biofortification and yield increase in rice. Sci Rep. 2020;10:4351. doi: 10.1038/s41598-020-60189-x [DOI] [PMC free article] [PubMed] [Google Scholar]
29.Zamany S, Sedghi M, Hafizi M, Nazaran MH, KimiaeiTalab MV. Organic acid-based chelate trace mineral supplement improves broiler performance, bone composition, immune responses, and blood parameters. Biol Trace Elem Res. 2023;201:4882–9. doi: 10.1007/s12011-023-03555-w [DOI] [PubMed] [Google Scholar]
30.Hafizi M, Kalanaky S, Fakharzadeh S, Karimi P, Fakharian A, Lookzadeh S, et al. Beneficial effects of the combination of BCc1 and Hep-S nanochelating-based medicines on IL-6 in hospitalized moderate COVID-19 adult patients: a randomized, double-blind, placebo-controlled clinical trial. Trials. 2023;24:720. doi: 10.1186/s13063-023-07624-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
31.Fakharzadeh S, Kalanaky S, Hafizi M, Nazaran MH, Zardooz H. DIBc, a nanochelating-based nano metal-organic framework, shows anti-diabetic effects in high-fat diet and streptozotocin-induced diabetic rats. Int J Nanomedicine. 2019;14:2145–56. doi: 10.2147/IJN.S196050 [DOI] [PMC free article] [PubMed] [Google Scholar]
32.Charehgani H, Fakharzadeh S, Nazaran MH. Evaluation of nano-chelated silicon fertilizer in the management of Meloidogyne javanica in tomato. Indian Phytopathol. 2021;74:1027–34. doi: 10.1007/s42360-021-00413-4 [DOI] [Google Scholar]
33.Ghasemi HA, Hajkhodadadi I, Hafizi M, Fakharzadeh S, Abbasi M, Kalanaky S, et al. Effect of advanced chelate compounds-based mineral supplement in laying hen diet on the performance, egg quality, yolk mineral content, fatty acid composition, and oxidative status. Food Chem. 2022;366:130636. doi: 10.1016/j.foodchem.2021.130636 [DOI] [PubMed] [Google Scholar]
34.Ghasemi HA, Fakharzadeh S, Hafizi M, Nemati M, Kalanaky S, Nazaran MH. Growth performance, nutrient digestibility, bone mineralization, gut morphology, and antioxidant status in meat-type turkeys receiving diets supplemented with advanced chelate compounds-based minerals. J Appl Poult Res. 2023;32:100348. doi: 10.1016/j.japr.2023.100348 [DOI] [Google Scholar]
35.Ghasemi HA, Hajkhodadadi I, Hafizi M, Taherpour K, Nazaran MH. Effect of advanced chelate technology based trace minerals on growth performance, mineral digestibility, tibia characteristics, and antioxidant status in broiler chickens. Nutr Metab (Lond). 2020;17:94. doi: 10.1186/s12986-020-00520-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
36.Amiri M, Ghasemi HA, Hajkhodadadi I, Khaltabadi Farahani AH. Efficacy of guanidinoacetic acid at different dietary crude protein levels on growth performance, stress indicators, antioxidant status, and intestinal morphology in broiler chickens subjected to cyclic heat stress. Anim Feed Sci Technol. 2019;254:114208. doi: 10.1016/j.anifeedsci.2019.114208 [DOI] [Google Scholar]
37.Iritani Y, Aoyama S, Takigami S, Hayashi Y, Ogawa R, Yanagida N, et al. Antibody response to Newcastle disease virus (NDV) of recombinant fowlpox virus (FPV) expressing a hemagglutinin-neuraminidase of NDV into chickens in the presence of antibody to NDV or FPV. Avian Dis. 1991;35:659–61. doi: 10.2307/1591592 [DOI] [PubMed] [Google Scholar]
38.De Wit JJ, Mekkes DR, Kouwenhoven B, Verheijden JHM. Sensitivity and specificity of serological tests for infectious bronchitis virus antibodies in broilers. Avian Pathol. 1997;26:105–18. doi: 10.1080/03079459708419198 [DOI] [PubMed] [Google Scholar]
39.Delhanty JJ, Solomon JB. The nature of antibodies to goat erythrocytes in the developing chicken. Immunology. 1966;11:103–113. [PMC free article] [PubMed] [Google Scholar]
40.Kermanshahi H, Ghofrani Tabari D, Khodambashi Emami N, Daneshmand A, Ibrahim SA. Effect of in ovo injection of threonine on immunoglobulin A gene expression in the intestine of Japanese quail at hatch. J Anim Physiol Anim Nutr (Berl). 2017;101:10–14. doi: 10.1111/jpn.12543 [DOI] [PubMed] [Google Scholar]
41.Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, Kubista M, et al. The MIQE guidelines: Minimum information for publication of quantitative real-time PCR experiments. Clin Chem. 2009;55:611–22. doi: 10.1373/clinchem.2008.112797 [DOI] [PubMed] [Google Scholar]
42.Gouda A, Amer SA, Gabr S, Tolba SA. Effect of dietary supplemental ascorbic acid and folic acid on the growth performance, redox status, and immune status of broiler chickens under heat stress. Trop Anim Health Prod. 2020;52:2987–96. doi: 10.1007/s11250-020-02316-4 [DOI] [PubMed] [Google Scholar]
43.Mazzoni M, Zampiga M, Clavenzani P, Lattanzio G, Tagliavia C, Sirri F. Effect of chronic heat stress on gastrointestinal histology and expression of feed intake-regulatory hormones in broiler chickens. Animal. 2022;16:100600. doi: 10.1016/j.animal.2022.100600 [DOI] [PubMed] [Google Scholar]
44.Liu L, Ren M, Ren K, Jin Y, Yan M. Heat stress impacts on broiler performance: a systematic review and meta-analysis. Poult Sci. 2020;99:6205–11. doi: 10.1016/j.psj.2020.08.019 [DOI] [PMC free article] [PubMed] [Google Scholar]
45.Ghasemi HA, Nari N. Interactive effects of methionine source and carnitine supplementation on growth performance, immunity, antioxidant status, and HSP70 gene expression in broilers reared under heat stress conditions. J Appl Poult Res. 2023;32:100374. doi: 10.1016/j.japr.2023.100374 [DOI] [Google Scholar]
46.Quinteiro-Filho WM, Rodrigues M V., Ribeiro A, Ferraz-de-Paula V, Pinheiro ML, Sá LRM, et al. Acute heat stress impairs performance parameters and induces mild intestinal enteritis in broiler chickens: Role of acute hypothalamic-pituitary-adrenal axis activation. J Anim Sci. 2012;90:1986–94. doi: 10.2527/jas.2011-3949. [DOI] [PubMed]
47.Saleh AA, El-Tahan HM, Shaban M, Morsy WA, Genedy S, Alzawqari MH, et al. Effect of dietary supplementation of betaine and organic minerals on growth performance, serum biochemical parameters, nutrients digestibility, and growth-related genes in broilers under heat stress. Poult Sci. 2023;102:103051. doi: 10.1016/j.psj.2023.103051 [DOI] [PMC free article] [PubMed] [Google Scholar]
48.Rajkumar U, Vinoth A, Reddy EPK, Shanmugam M, Rao SVR. Effect of supplemental trace minerals on Hsp-70 mRNA expression in commercial broiler chicken. Anim Biotechnol. 2018;29:20–5. doi: 10.1080/10495398.2017.1287712 [DOI] [PubMed] [Google Scholar]
49.Yang X, Liu Y, Yan F, Yang C, Yang X. Effects of encapsulated organic acids and essential oils on intestinal barrier, microbial count, and bacterial metabolites in broiler chickens. Poult Sci. 2019;98:2858–65. doi: 10.3382/ps/pez031 [DOI] [PubMed] [Google Scholar]
50.Mustafa A, Bai S, Zeng Q, Ding X, Wang J, Xuan Y, et al. Effect of organic acids on growth performance, intestinal morphology, and immunity of broiler chickens with and without coccidial challenge. AMB Express. 2021;11:140. doi: 10.1186/s13568-021-01299-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
51.Bialkowski S, Toschi A, Yu L en, Schlitzkus L, Mann P, Grilli E, et al. Effects of microencapsulated blend of organic acids and botanicals on growth performance, intestinal barrier function, inflammatory cytokines, and endocannabinoid system gene expression in broiler chickens. Poult Sci. 2023;102:102460. doi: 10.1016/j.psj.2022.102460. [DOI] [PMC free article] [PubMed]
52.Yan FF, Mohammed AA, Murugesan GR, Cheng HW. Effects of a dietary synbiotic inclusion on bone health in broilers subjected to cyclic heat stress episodes. Poult Sci. 2019;98:1083–9. doi: 10.3382/ps/pey508 [DOI] [PubMed] [Google Scholar]
53.Castro FLS, Kim Y, Xu H, Kim WK. The effect of total sulfur amino acid levels on growth performance and bone metabolism in pullets under heat stress. Poult Sci. 2020;99:5783–91. doi: 10.1016/j.psj.2020.06.081 [DOI] [PMC free article] [PubMed] [Google Scholar]
54.Ansari I, Khalaji S, Hedayati M. Potassium phosphate and potassium carbonate administration by feed or drinking water improved broiler performance, bone strength, digestive phosphatase activity and phosphorus digestibility under induced heat stress conditions. Trop Anim Health Prod. 2020;52:591–600. doi: 10.1007/s11250-019-02046-2 [DOI] [PubMed] [Google Scholar]
55.Varasteh S, Braber S, Akbari P, Garssen J, Fink-Gremmels J. Differences in susceptibility to heat stress along the chicken intestine and the protective effects of galacto-oligosaccharides. PLoS One. 2015;10:e0138975. doi: 10.1371/journal.pone.0138975 [DOI] [PMC free article] [PubMed] [Google Scholar]
56.Yan F fei, Wang W chao, Cheng H wei. Bacillus subtilis–based probiotic promotes bone growth by inhibition of inflammation in broilers subjected to cyclic heating episodes. Poult Sci. 2020;99:5252–60. doi: 10.1016/j.psj.2020.08.051. [DOI] [PMC free article] [PubMed]
57.Domazetovic V, Marcucci G, Iantomasi T, Brandi ML, Vincenzini MT. Oxidative stress in bone remodeling: Role of antioxidants. Clin Cases Miner Bone Metab. 2017;14:209–16. doi: 10.11138/ccmbm/2017.14.1.209 [DOI] [PMC free article] [PubMed] [Google Scholar]
58.Zhang H, Majdeddin M, Gaublomme D, Taminiau B, Boone M, Elewaut D, et al. 25-hydroxycholecalciferol reverses heat induced alterations in bone quality in finisher broilers associated with effects on intestinal integrity and inflammation. J Anim Sci Biotechnol. 2021;12:104. doi: 10.1186/s40104-021-00627-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
59.Kim DY, Kim JH, Choi WJ, Han GP, Kil DY. Comparative effects of dietary functional nutrients on growth performance, meat quality, immune responses, and stress biomarkers in broiler chickens raised under heat stress conditions. Anim Biosci. 2021;34:1839–48. doi: 10.5713/ab.21.0230 [DOI] [PMC free article] [PubMed] [Google Scholar]
60.Ghasemi HA, Nari N. Effect of supplementary betaine on growth performance, blood biochemical profile, and immune response in heat-stressed broilers fed different dietary protein levels. J Appl Poult Res. 2020;29:301–13. doi: 10.1016/j.japr.2019.11.004 [DOI] [Google Scholar]
61.Abo Ghanima MM, Abd El-Hack ME, Othman SI, Taha AE, Allam AA, Eid Abdel-Moneim AM. Impact of different rearing systems on growth, carcass traits, oxidative stress biomarkers, and humoral immunity of broilers exposed to heat stress. Poult Sci. 2020;99:3070–78. doi: 10.1016/j.psj.2020.03.011 [DOI] [PMC free article] [PubMed] [Google Scholar]
62.Handel ML, Mcmorrow LB, Gravallese EM. Nuclear factor–kB in rheumatoid synovium. Localization of P50 and P65. Arthritis Rheum. 1995;38:1762–70. doi: 10.1002/art.1780381209 [DOI] [PubMed] [Google Scholar]
63.Rajput IR, Ying H, Sun Y, Arain MA, Li W, Ping L, et al. Saccharomyces boulardii and Bacillus subtilis B10 modulate TLRs and cytokines expression patterns in jejunum and ileum of broilers. PLoS One. 2017;12:e0173917. doi: 10.1371/journal.pone.0173917 [DOI] [PMC free article] [PubMed] [Google Scholar]
64.Liu WC, Ou BH, Liang ZL, Zhang R, Zhao ZH. Algae-derived polysaccharides supplementation ameliorates heat stress-induced impairment of bursa of Fabricius via modulating NF-kB signaling pathway in broilers. Poult Sci. 2021;100:101139. doi: 10.1016/j.psj.2021.101139 [DOI] [PMC free article] [PubMed] [Google Scholar]
65.Saleh AA, Eltantawy MS, Gawish EM, Younis HH, Amber KA, Abd El-Moneim AEME, et al. Impact of dietary organic mineral supplementation on reproductive performance, egg quality characteristics, lipid oxidation, ovarian follicular development, and immune response in laying hens under high ambient temperature. Biol Trace Elem Res. 2020;195:506–14. doi: 10.1007/s12011-019-01861-w [DOI] [PubMed] [Google Scholar]
66.Echeverry H, Yitbarek A, Munyaka P, Alizadeh M, Cleaver A, Camelo-Jaimes G, et al. Organic trace mineral supplementation enhances local and systemic innate immune responses and modulates oxidative stress in broiler chickens. Poult Sci. 2016;95:518–27. doi: 10.3382/ps/pev374 [DOI] [PubMed] [Google Scholar]
67.Ebeid TA, Al-Homidan IH. Organic acids and their potential role for modulating the gastrointestinal tract, antioxidative status, immune response, and performance in poultry. Worlds Poult Sci J. 2022;78:83–101. doi: 10.1080/00439339.2022.1988803 [DOI] [Google Scholar]
68.Wasti S, Sah N, Lee CN, Jha R, Mishrai B. Dietary supplementation of alpha-lipoic acid mitigates the negative effects of heat stress in broilers. PLoS One. 2021;16:e0254936. doi: 10.1371/journal.pone.0254936 [DOI] [PMC free article] [PubMed] [Google Scholar]
69.Song J, Lei X, Luo J, Everaert N, Zhao G, Wen J, et al. The effect of Epigallocatechin-3-gallate on small intestinal morphology, antioxidant capacity and anti-inflammatory effect in heat-stressed broilers. J Anim Physiol Anim Nutr (Berl). 2019;103:1030–38. doi: 10.1111/jpn.13062 [DOI] [PubMed] [Google Scholar]
70.Qiu W, Zhang X, Pang X, Huang J, Zhou S, Wang R, et al. Asiatic acid alleviates LPS-induced acute kidney injury in broilers by inhibiting oxidative stress and ferroptosis via activation of the Nrf2 pathway. Food Chem Toxicol. 2022;170:113468. doi: 10.1016/j.fct.2022.113468 [DOI] [PubMed] [Google Scholar]
71.Wang S, Wu S, Zhang Y, Chen J, Zhou X. Effects of different levels of organic trace minerals on oxidative status and intestinal function in weanling piglets. Biol Trace Elem Res. 2023;201:720–27. doi: 10.1007/s12011-022-03174-x [DOI] [PubMed] [Google Scholar]
72.Jankowski J, Ognik K, Kozłowski K, Stępniowska A, Zduńczyk Z. Effect of different levels and sources of dietary copper, zinc and manganese on the performance and immune and redox status of turkeys. Animals. 2019;9:883. doi: 10.3390/ani9110883 [DOI] [PMC free article] [PubMed] [Google Scholar]
73.Winiarska-Mieczan A, Kwiecień M, Mieczan T, Kwiatkowska K, Jachimowicz K. The effect of Cu, Zn and Fe chelates on the antioxidative status of thigh meat of broiler chickens. Animal. 2021;15:100367. doi: 10.1016/j.animal.2021.100367 [DOI] [PubMed] [Google Scholar]
74.Li KX, Wang JS, Yuan D, Zhao RX, Wang YX, Zhan XA. Effects of different selenium sources and levels on antioxidant status in broiler breeders. Asian-Australas J Anim Sci. 2018;31:1939–45. doi: 10.5713/ajas.18.0226 [DOI] [PMC free article] [PubMed] [Google Scholar]
75.Gul F, Ahmad B, Afzal S, Ullah A, Khan S, Aman K, et al. Comparative analysis of various sources of selenium on the growth performance and antioxidant status in broilers under heat stress. Braz J Biol. s2023;83:e251004. doi: 10.1590/1519-6984.251004 [DOI] [PubMed] [Google Scholar]

PLoS One. doi: 10.1371/journal.pone.0311083.r001

Decision Letter 0

Ewa Tomaszewska

20 Aug 2024

PONE-D-24-23790Potential benefits of advanced chelate-based trace minerals in improving bone mineralization, oxidative status, humoral immunity, and gene expression modulation associated with antioxidation and immunity in heat-stressed broilersPLOS ONE

Dear Dr. Taherpour,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by Oct 04 2024 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Ewa Tomaszewska, DVM Ph.D

Academic Editor

PLOS ONE

Journal requirements:

1. When submitting your revision, we need you to address these additional requirements.

Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf.

2. We suggest you thoroughly copyedit your manuscript for language usage, spelling, and grammar. If you do not know anyone who can help you do this, you may wish to consider employing a professional scientific editing service.

The American Journal Experts (AJE) (https://www.aje.com/) is one such service that has extensive experience helping authors meet PLOS guidelines and can provide language editing, translation, manuscript formatting, and figure formatting to ensure your manuscript meets our submission guidelines. Please note that having the manuscript copyedited by AJE or any other editing services does not guarantee selection for peer review or acceptance for publication.

Upon resubmission, please provide the following:

The name of the colleague or the details of the professional service that edited your manuscript

A copy of your manuscript showing your changes by either highlighting them or using track changes (uploaded as a *supporting information* file)

A clean copy of the edited manuscript (uploaded as the new *manuscript* file)”.

3. Please include captions for your all Supporting Information files at the end of your manuscript, and update any in-text citations to match accordingly. Please see our Supporting Information guidelines for more information: http://journals.plos.org/plosone/s/supporting-information.

4. Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The authors address an important on heat stress in poultry

The manuscript is generally well written

A few comments to address

1 The title is so wordy and complicated. Can the authors simplify the title and keep the words to about twenty

The abstract requires an introductory statement on the topic of study instead of the “42 day experiment”

Line 231 what is the reference gene?

What are the limitations of the study?

What is the strength of the study?

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: ESTER LILIAN ACEN

**********

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2024 Oct 2;19(10):e0311083. doi: 10.1371/journal.pone.0311083.r002

Author response to Decision Letter 0

26 Aug 2024

Dear Editor, “PLOS ONE” Journal

Thank you very much for giving us an opportunity to revise our manuscript (PONE-D-24-23790). Following the reviewer's suggestion, we have shortened the paper's title to "Potential benefits of advanced chelate-based trace minerals in improving bone mineralization, antioxidant status, immunity, and gene expression modulation in heat-stressed broilers." We responded to the reviewer's comments individually, indicating exactly how we addressed each comment and describing the changes we made. The authors want to extend their appreciation for taking the time and effort necessary to provide such insightful guidance. Additionally, the points offered by the journal have been carefully considered. All authors have approved the revisions and used MS Word's "Track Changes" option to mark changes related to reviewer comments and structural changes. Formatting changes in accordance with the journal guidelines and the "PLOS ONE style templates" have been marked with yellow highlighting to better differentiate them. We hope that this revision improves the paper so that you and the reviewer deem it worthy of publication.

Reviewer #1: The authors address an important on heat stress in poultry. The manuscript is generally well written.

A few comments to address

Response:

Dear Reviewer,

Thank you very much for your valuable comments on our manuscript. The authors have tried to be responsive to your comments and also responded to your comments. The lines mentioned in the parentheses are related to the highlighted version of the revised manuscript (with track change).

1 - The title is so wordy and complicated. Can the authors simplify the title and keep the words to about twenty

Response: According to this comment, the length of the tile has been reduced to 21 words (L 4-7).

2- The abstract requires an introductory statement on the topic of study instead of the “42 day experiment”

Response: Thank you for this comment. The following sentence has been added at the beginning of the abstract: (L 21-23)

“Organic sources of trace minerals (TM) in broiler diets are more bioavailable and stable than inorganic sources, making them particularly beneficial during challenging periods such as heat stress (HS) conditions.“

3- Line 231 what is the reference gene?

Response: Addes as requested (L 225).

4- What are the limitations of the study?

Response: Thank you for bringing up this important query. Insufficient funding is indeed a major limitation in conducting research, especially when it comes to exploring cellular and molecular details. In these areas, the higher costs associated with laboratory work often limit the scope of research. In this particular study, the researchers attempted to examine immune and antioxidant responses by analyzing the genes involved in active pathways. However, a more comprehensive analysis of all genes involved in these cases, as well as the examination of multiple tissues, would require additional funding. Additionally, conducting challenging studies like heat stress with complex instructions and following study protocols can be challenging and costly, which is a common limitation in these kinds of studies.

5- What is the strength of the study?

Response: The strength of this study lies in its investigation of an organic trace mineral supplement using modern methods as a substitute for inorganic products. The study explores different replacement levels of inorganic supplements with organic supplements, as well as higher dietary supplemental levels of these supplements under stressful conditions. This is important because in commercial settings, feed is typically formulated with recommended levels of inorganic supplements. By comparing the effects of different dietary levels of organic supplements to the commercial levels of inorganic supplements, the study provides valuable insights into the potential benefits of using advanced chelate technology in improving bird performance and health in heat-stressed broilers. Additionally, the study uses a variety of measures to evaluate bone health, immune function, and oxidant/antioxidant status, which further strengthens its findings. Overall, this study highlights the potential benefits of advanced chelate technology in improving bird performance and health in heat-stressed broilers.

Again, we appreciate all of your insightful comments. We hope our revision meet your approval.

Best Regards,

Authors

Attachment

Submitted filename: Response to Reviewers.docx

pone.0311083.s004.docx^{(21.1KB, docx)}

PLoS One. doi: 10.1371/journal.pone.0311083.r003

Decision Letter 1

Ewa Tomaszewska

12 Sep 2024

Potential benefits of advanced chelate-based trace minerals in improving bone mineralization, antioxidant status, immunity, and gene expression modulation in heat-stressed broilers

PONE-D-24-23790R1

Dear Dr. Kamran Taherpour,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice will be generated when your article is formally accepted. Please note, if your institution has a publishing partnership with PLOS and your article meets the relevant criteria, all or part of your publication costs will be covered. Please make sure your user information is up-to-date by logging into Editorial Manager at Editorial Manager® and clicking the ‘Update My Information' link at the top of the page. If you have any questions relating to publication charges, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Ewa Tomaszewska, DVM Ph.D

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #1: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

Reviewer #1: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

Reviewer #1: Yes

**********

6. Review Comments to the Author

Reviewer #1: the authors need to include the strength and limitations of the study they presented in the rebuttal letter in the discussion section

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: ESTER LILIAN ACEN

**********

PLoS One. doi: 10.1371/journal.pone.0311083.r004

Acceptance letter

Ewa Tomaszewska

23 Sep 2024

PONE-D-24-23790R1

PLOS ONE

Dear Dr. Taherpour,

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now being handed over to our production team.

At this stage, our production department will prepare your paper for publication. This includes ensuring the following:

* All references, tables, and figures are properly cited

* All relevant supporting information is included in the manuscript submission,

* There are no issues that prevent the paper from being properly typeset

If revisions are needed, the production department will contact you directly to resolve them. If no revisions are needed, you will receive an email when the publication date has been set. At this time, we do not offer pre-publication proofs to authors during production of the accepted work. Please keep in mind that we are working through a large volume of accepted articles, so please give us a few weeks to review your paper and let you know the next and final steps.

Lastly, if your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

If we can help with anything else, please email us at customercare@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Professor Ewa Tomaszewska

Academic Editor

PLOS ONE

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Fig. The BET analysis of advanced chelates crystallinity used in this study.

(DOCX)

pone.0311083.s001.docx^{(68.2KB, docx)}

S1 Table. Supplemental level and analyzed content of trace minerals in experimental diets (mg/kg).

(DOCX)

pone.0311083.s002.docx^{(15.4KB, docx)}

S1 Data

(XLSX)

pone.0311083.s003.xlsx^{(48.7KB, xlsx)}

Attachment

Submitted filename: Response to Reviewers.docx

pone.0311083.s004.docx^{(21.1KB, docx)}

Data Availability Statement

All relevant data are within the manuscript and its Supporting Information files.

[pone.0311083.ref001] 1.Virden WS, Kidd MT. Physiological stress in broilers: Ramifications on nutrient digestibility and responses. J Appl Poult Res. 2009;18:338–47. doi: 10.3382/japr.2007-00093 [DOI] [Google Scholar]

[pone.0311083.ref002] 2.Altan Ö, Pabuçcuoǧlu A, Altan A, Konyalioǧlu S, Bayraktar H. Effect of heat stress on oxidative stress, lipid peroxidation and some stress parameters in broilers. Br Poult Sci. 2003;44:545–50. doi: 10.1080/00071660310001618334 [DOI] [PubMed] [Google Scholar]

[pone.0311083.ref003] 3.He SP, Arowolo MA, Medrano RF, Li S, Yu QF, Chen JY, et al. Impact of heat stress and nutritional interventions on poultry production. Worlds Poult Sci J. 2018;74:647–64. doi: 10.1017/S0043933918000727 [DOI] [Google Scholar]

[pone.0311083.ref004] 4.Wang Y, Xia L, Guo T, Heng C, Jiang L, Wang D, et al. Research Note: Metabolic changes and physiological responses of broilers in the final stage of growth exposed to different environmental temperatures. Poult Sci. 2020;99:2017–25. doi: 10.1016/j.psj.2019.11.048 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0311083.ref005] 5.Liu YL, Ding KN, Shen XL, Liu HX, Zhang YA, Liu YQ, et al. Chronic heat stress promotes liver inflammation in broilers via enhancing NF-kB and NLRP3 signaling pathway. BMC Vet Res. 2022;18:289. doi: 10.1186/s12917-022-03388-0 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0311083.ref006] 6.Du J, Shi Y, Zhou C, Guo L, Hu R, Huang C, et al. Antioxidative and anti-inflammatory effects of vitamin C on the liver of laying hens under chronic heat stress. Front Vet Sci. 2022;9:1052553. doi: 10.3389/fvets.2022.1052553 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0311083.ref007] 7.Wang C, Bing A, liu H, Wang X, Zhao J, Lin H, et al. High ambient humidity aggravates ammonia-induced respiratory mucosal inflammation by eliciting Th1/Th2 imbalance and NF-kB pathway activation in laying hens. Poult Sci. 2022;101:102028. doi: 10.1016/j.psj.2022.102028 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0311083.ref008] 8.Saroj P, Bansal Y, Singh R, Akhtar A, Sodhi RK, Bishnoi M, et al. Neuroprotective effects of roflumilast against quinolinic acid-induced rat model of Huntington’s disease through inhibition of NF-kB mediated neuroinflammatory markers and activation of cAMP/CREB/BDNF signaling pathway. Inflammopharmacology. 2021;29:499–511. doi: 10.1007/s10787-020-00787-3 [DOI] [PubMed] [Google Scholar]

[pone.0311083.ref009] 9.Ding KN, Lu MH, Guo YN, Liang SS, Mou RW, He YM, et al. Resveratrol relieves chronic heat stress-induced liver oxidative damage in broilers by activating the Nrf2-Keap1 signaling pathway. Ecotoxicol Environ Saf. 2023;249:114411. doi: 10.1016/j.ecoenv.2022.114411 [DOI] [PubMed] [Google Scholar]

[pone.0311083.ref010] 10.Bhakkiyalakshmi E, Dineshkumar K, Karthik S, Sireesh D, Hopper W, Paulmurugan R, et al. Pterostilbene-mediated Nrf2 activation: Mechanistic insights on Keap1:Nrf2 interface. Bioorg Med Chem. 2016;24:3378–86. doi: 10.1016/j.bmc.2016.05.011 [DOI] [PubMed] [Google Scholar]

[pone.0311083.ref011] 11.Baxter MFA, Greene ES, Kidd MT, Tellez-Isaias G, Orlowski S, Dridi S. Water amino acid-chelated trace mineral supplementation decreases circulating and intestinal HSP70 and proinflammatory cytokine gene expression in heat-stressed broiler chickens. J Anim Sci. 2020;98:skaa049. doi: 10.1093/jas/skaa049 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0311083.ref012] 12.Calik A, Emami NK, Schyns G, White MB, Walsh MC, Romero LF, et al. Influence of dietary vitamin E and selenium supplementation on broilers subjected to heat stress, Part II: oxidative stress, immune response, gut integrity, and intestinal microbiota. Poult Sci. 2022;101:101858. doi: 10.1016/j.psj.2022.101858 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0311083.ref013] 13.Piray A, Foroutanifar S. Chromium supplementation on the growth performance, carcass traits, blood constituents, and immune competence of broiler chickens under heat stress: a systematic review and dose–response meta-analysis. Biol Trace Elem Res. 2022;200:2876–88. doi: 10.1007/s12011-021-02885-x [DOI] [PubMed] [Google Scholar]

[pone.0311083.ref014] 14.Sarlak S, Tabeidian SA, Toghyani M, Foroozandeh Shahraki AD, Goli M, Habibian M. Supplementation of two sources and three levels of iodine in the diet of laying hens: effects on performance, egg quality, serum and egg yolk lipids, antioxidant status, and iodine accumulation in eggs. Ital J Anim Sci. 2020;19:974–88. doi: 10.1080/1828051X.2020.1810142 [DOI] [Google Scholar]

[pone.0311083.ref015] 15.Aksu T, Aksu MI, Yoruk MA, Karaoglu M. Effects of organically-complexed minerals on meat quality in chickens. Br Poult Sci. 2011;52:558–63. doi: 10.1080/00071668.2011.606800 [DOI] [PubMed] [Google Scholar]

[pone.0311083.ref016] 16.Zhao J, Shirley RB, Vazquez-Anon M, Dibner JJ, Richards JD, Fisher P, et al. Effects of chelated trace minerals on growth performance, breast meat yield, and footpad health in commercial meat broilers. J Appl Poult Res. 2010;19:365–72. doi: 10.3382/japr.2009-00020 [DOI] [Google Scholar]

[pone.0311083.ref017] 17.Kim GB, Seo YM, Shin KS, Rhee AR, Han J, Paik IK. Effects of supplemental copper-methionine chelate and copper-soy proteinate on the performance, blood parameters, liver mineral content, and intestinal microflora of broiler chickens. J Appl Poult Res. 2011;20:21–32. doi: 10.3382/japr.2010-00177 [DOI] [Google Scholar]

[pone.0311083.ref018] 18.Seyfori H, Ghasemi HA, Hajkhodadadi I, Hafizi M. Effects of water supplementation of an organic acid-trace mineral complex on production and slaughter parameters, intestinal histomorphology, and macronutrient digestibility in growing ostriches. Poult Sci. 2019;98:4860–7. doi: 10.3382/ps/pez221 [DOI] [PubMed] [Google Scholar]

[pone.0311083.ref019] 19.Vieira R, Ferket P, Malheiros R, Hannas M, Crivellari R, Moraes V, et al. Feeding low dietary levels of organic trace minerals improves broiler performance and reduces excretion of minerals in litter. Br Poult Sci. 2020;61:574–82. doi: 10.1080/00071668.2020.1764908 [DOI] [PubMed] [Google Scholar]

[pone.0311083.ref020] 20.Zhu Z, Yan L, Hu S, An S, Lv Z, Wang Z, et al. Effects of the different levels of dietary trace elements from organic or inorganic sources on growth performance, carcass traits, meat quality, and faecal mineral excretion of broilers. Arch Anim Nutr. 2019;73:324–337. doi: 10.1080/1745039X.2019.1620050 [DOI] [PubMed] [Google Scholar]

[pone.0311083.ref021] 21.Kong J, Qiu T, Yan X, Wang L, Chen Z, Xiao G, et al. Effect of replacing inorganic minerals with small peptide chelated minerals on production performance, some biochemical parameters and antioxidant status in broiler chickens. Front Physiol. 2022;13:1027834. doi: 10.3389/fphys.2022.1027834 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0311083.ref022] 22.Zhang WF, Tian M, Song JS, Chen F, Lin G, Zhang SH, et al. Effect of replacing inorganic trace minerals at lower organic levels on growth performance, blood parameters, antioxidant status, immune indexes, and fecal mineral excretion in weaned piglets. Trop Anim Health Prod. 2021;53:121. doi: 10.1007/s11250-021-02561-1 [DOI] [PubMed] [Google Scholar]

[pone.0311083.ref023] 23.Umar Yaqoob M, Wang G, Sun W, Pei X, Liu L, Tao W, et al. Effects of inorganic trace minerals replaced by complexed glycinates on reproductive performance, blood profiles, and antioxidant status in broiler breeders. Poult Sci. 2020;99:2718–26. doi: 10.1016/j.psj.2019.11.058 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0311083.ref024] 24.Jarosz L, Marek A, Gradzki Z, Kwiecień M, Zylińska B, Kaczmarek B. Effect of feed supplementation with zinc glycine chelate and zinc sulfate on cytokine and immunoglobulin gene expression profiles in chicken intestinal tissue. Poult Sci. 2017;96:4224–35. doi: 10.3382/ps/pex253 [DOI] [PubMed] [Google Scholar]

[pone.0311083.ref025] 25.Nazaran MH. Chelate compounds. 2010. Available: https://patents.google.com/patent/US8288587B2/en.

[pone.0311083.ref026] 26.Hafizi M, Hajarizadeh A, Atashi A, Kalanaky S, Fakharzadeh S, Masoumi Z, et al. Nanochelating based nanocomplex, GFc7, improves quality and quantity of human mesenchymal stem cells during in vitro expansion. Stem Cell Res Ther. 2015;6:226. doi: 10.1186/s13287-015-0216-9 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0311083.ref027] 27.Seyfori H, Ghasemi HA, Hajkhodadadi I, Nazaran MH, Hafizi M. Growth performance, mineral digestibility, and blood characteristics of ostriches receiving drinking water supplemented with varying levels of chelated trace mineral complex. Biol Trace Elem Res. 2018;183:147–55. doi: 10.1007/s12011-017-1117-9 [DOI] [PubMed] [Google Scholar]

[pone.0311083.ref028] 28.Fakharzadeh S, Hafizi M, Baghaei MA, Etesami M, Khayamzadeh M, Kalanaky S, et al. Using nanochelating technology for biofortification and yield increase in rice. Sci Rep. 2020;10:4351. doi: 10.1038/s41598-020-60189-x [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0311083.ref029] 29.Zamany S, Sedghi M, Hafizi M, Nazaran MH, KimiaeiTalab MV. Organic acid-based chelate trace mineral supplement improves broiler performance, bone composition, immune responses, and blood parameters. Biol Trace Elem Res. 2023;201:4882–9. doi: 10.1007/s12011-023-03555-w [DOI] [PubMed] [Google Scholar]

[pone.0311083.ref030] 30.Hafizi M, Kalanaky S, Fakharzadeh S, Karimi P, Fakharian A, Lookzadeh S, et al. Beneficial effects of the combination of BCc1 and Hep-S nanochelating-based medicines on IL-6 in hospitalized moderate COVID-19 adult patients: a randomized, double-blind, placebo-controlled clinical trial. Trials. 2023;24:720. doi: 10.1186/s13063-023-07624-2 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0311083.ref031] 31.Fakharzadeh S, Kalanaky S, Hafizi M, Nazaran MH, Zardooz H. DIBc, a nanochelating-based nano metal-organic framework, shows anti-diabetic effects in high-fat diet and streptozotocin-induced diabetic rats. Int J Nanomedicine. 2019;14:2145–56. doi: 10.2147/IJN.S196050 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0311083.ref032] 32.Charehgani H, Fakharzadeh S, Nazaran MH. Evaluation of nano-chelated silicon fertilizer in the management of Meloidogyne javanica in tomato. Indian Phytopathol. 2021;74:1027–34. doi: 10.1007/s42360-021-00413-4 [DOI] [Google Scholar]

[pone.0311083.ref033] 33.Ghasemi HA, Hajkhodadadi I, Hafizi M, Fakharzadeh S, Abbasi M, Kalanaky S, et al. Effect of advanced chelate compounds-based mineral supplement in laying hen diet on the performance, egg quality, yolk mineral content, fatty acid composition, and oxidative status. Food Chem. 2022;366:130636. doi: 10.1016/j.foodchem.2021.130636 [DOI] [PubMed] [Google Scholar]

[pone.0311083.ref034] 34.Ghasemi HA, Fakharzadeh S, Hafizi M, Nemati M, Kalanaky S, Nazaran MH. Growth performance, nutrient digestibility, bone mineralization, gut morphology, and antioxidant status in meat-type turkeys receiving diets supplemented with advanced chelate compounds-based minerals. J Appl Poult Res. 2023;32:100348. doi: 10.1016/j.japr.2023.100348 [DOI] [Google Scholar]

[pone.0311083.ref035] 35.Ghasemi HA, Hajkhodadadi I, Hafizi M, Taherpour K, Nazaran MH. Effect of advanced chelate technology based trace minerals on growth performance, mineral digestibility, tibia characteristics, and antioxidant status in broiler chickens. Nutr Metab (Lond). 2020;17:94. doi: 10.1186/s12986-020-00520-5 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0311083.ref036] 36.Amiri M, Ghasemi HA, Hajkhodadadi I, Khaltabadi Farahani AH. Efficacy of guanidinoacetic acid at different dietary crude protein levels on growth performance, stress indicators, antioxidant status, and intestinal morphology in broiler chickens subjected to cyclic heat stress. Anim Feed Sci Technol. 2019;254:114208. doi: 10.1016/j.anifeedsci.2019.114208 [DOI] [Google Scholar]

[pone.0311083.ref037] 37.Iritani Y, Aoyama S, Takigami S, Hayashi Y, Ogawa R, Yanagida N, et al. Antibody response to Newcastle disease virus (NDV) of recombinant fowlpox virus (FPV) expressing a hemagglutinin-neuraminidase of NDV into chickens in the presence of antibody to NDV or FPV. Avian Dis. 1991;35:659–61. doi: 10.2307/1591592 [DOI] [PubMed] [Google Scholar]

[pone.0311083.ref038] 38.De Wit JJ, Mekkes DR, Kouwenhoven B, Verheijden JHM. Sensitivity and specificity of serological tests for infectious bronchitis virus antibodies in broilers. Avian Pathol. 1997;26:105–18. doi: 10.1080/03079459708419198 [DOI] [PubMed] [Google Scholar]

[pone.0311083.ref039] 39.Delhanty JJ, Solomon JB. The nature of antibodies to goat erythrocytes in the developing chicken. Immunology. 1966;11:103–113. [PMC free article] [PubMed] [Google Scholar]

[pone.0311083.ref040] 40.Kermanshahi H, Ghofrani Tabari D, Khodambashi Emami N, Daneshmand A, Ibrahim SA. Effect of in ovo injection of threonine on immunoglobulin A gene expression in the intestine of Japanese quail at hatch. J Anim Physiol Anim Nutr (Berl). 2017;101:10–14. doi: 10.1111/jpn.12543 [DOI] [PubMed] [Google Scholar]

[pone.0311083.ref041] 41.Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, Kubista M, et al. The MIQE guidelines: Minimum information for publication of quantitative real-time PCR experiments. Clin Chem. 2009;55:611–22. doi: 10.1373/clinchem.2008.112797 [DOI] [PubMed] [Google Scholar]

[pone.0311083.ref042] 42.Gouda A, Amer SA, Gabr S, Tolba SA. Effect of dietary supplemental ascorbic acid and folic acid on the growth performance, redox status, and immune status of broiler chickens under heat stress. Trop Anim Health Prod. 2020;52:2987–96. doi: 10.1007/s11250-020-02316-4 [DOI] [PubMed] [Google Scholar]

[pone.0311083.ref043] 43.Mazzoni M, Zampiga M, Clavenzani P, Lattanzio G, Tagliavia C, Sirri F. Effect of chronic heat stress on gastrointestinal histology and expression of feed intake-regulatory hormones in broiler chickens. Animal. 2022;16:100600. doi: 10.1016/j.animal.2022.100600 [DOI] [PubMed] [Google Scholar]

[pone.0311083.ref044] 44.Liu L, Ren M, Ren K, Jin Y, Yan M. Heat stress impacts on broiler performance: a systematic review and meta-analysis. Poult Sci. 2020;99:6205–11. doi: 10.1016/j.psj.2020.08.019 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0311083.ref045] 45.Ghasemi HA, Nari N. Interactive effects of methionine source and carnitine supplementation on growth performance, immunity, antioxidant status, and HSP70 gene expression in broilers reared under heat stress conditions. J Appl Poult Res. 2023;32:100374. doi: 10.1016/j.japr.2023.100374 [DOI] [Google Scholar]

[pone.0311083.ref046] 46.Quinteiro-Filho WM, Rodrigues M V., Ribeiro A, Ferraz-de-Paula V, Pinheiro ML, Sá LRM, et al. Acute heat stress impairs performance parameters and induces mild intestinal enteritis in broiler chickens: Role of acute hypothalamic-pituitary-adrenal axis activation. J Anim Sci. 2012;90:1986–94. doi: 10.2527/jas.2011-3949. [DOI] [PubMed]

[pone.0311083.ref047] 47.Saleh AA, El-Tahan HM, Shaban M, Morsy WA, Genedy S, Alzawqari MH, et al. Effect of dietary supplementation of betaine and organic minerals on growth performance, serum biochemical parameters, nutrients digestibility, and growth-related genes in broilers under heat stress. Poult Sci. 2023;102:103051. doi: 10.1016/j.psj.2023.103051 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0311083.ref048] 48.Rajkumar U, Vinoth A, Reddy EPK, Shanmugam M, Rao SVR. Effect of supplemental trace minerals on Hsp-70 mRNA expression in commercial broiler chicken. Anim Biotechnol. 2018;29:20–5. doi: 10.1080/10495398.2017.1287712 [DOI] [PubMed] [Google Scholar]

[pone.0311083.ref049] 49.Yang X, Liu Y, Yan F, Yang C, Yang X. Effects of encapsulated organic acids and essential oils on intestinal barrier, microbial count, and bacterial metabolites in broiler chickens. Poult Sci. 2019;98:2858–65. doi: 10.3382/ps/pez031 [DOI] [PubMed] [Google Scholar]

[pone.0311083.ref050] 50.Mustafa A, Bai S, Zeng Q, Ding X, Wang J, Xuan Y, et al. Effect of organic acids on growth performance, intestinal morphology, and immunity of broiler chickens with and without coccidial challenge. AMB Express. 2021;11:140. doi: 10.1186/s13568-021-01299-1 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0311083.ref051] 51.Bialkowski S, Toschi A, Yu L en, Schlitzkus L, Mann P, Grilli E, et al. Effects of microencapsulated blend of organic acids and botanicals on growth performance, intestinal barrier function, inflammatory cytokines, and endocannabinoid system gene expression in broiler chickens. Poult Sci. 2023;102:102460. doi: 10.1016/j.psj.2022.102460. [DOI] [PMC free article] [PubMed]

[pone.0311083.ref052] 52.Yan FF, Mohammed AA, Murugesan GR, Cheng HW. Effects of a dietary synbiotic inclusion on bone health in broilers subjected to cyclic heat stress episodes. Poult Sci. 2019;98:1083–9. doi: 10.3382/ps/pey508 [DOI] [PubMed] [Google Scholar]

[pone.0311083.ref053] 53.Castro FLS, Kim Y, Xu H, Kim WK. The effect of total sulfur amino acid levels on growth performance and bone metabolism in pullets under heat stress. Poult Sci. 2020;99:5783–91. doi: 10.1016/j.psj.2020.06.081 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0311083.ref054] 54.Ansari I, Khalaji S, Hedayati M. Potassium phosphate and potassium carbonate administration by feed or drinking water improved broiler performance, bone strength, digestive phosphatase activity and phosphorus digestibility under induced heat stress conditions. Trop Anim Health Prod. 2020;52:591–600. doi: 10.1007/s11250-019-02046-2 [DOI] [PubMed] [Google Scholar]

[pone.0311083.ref055] 55.Varasteh S, Braber S, Akbari P, Garssen J, Fink-Gremmels J. Differences in susceptibility to heat stress along the chicken intestine and the protective effects of galacto-oligosaccharides. PLoS One. 2015;10:e0138975. doi: 10.1371/journal.pone.0138975 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0311083.ref056] 56.Yan F fei, Wang W chao, Cheng H wei. Bacillus subtilis–based probiotic promotes bone growth by inhibition of inflammation in broilers subjected to cyclic heating episodes. Poult Sci. 2020;99:5252–60. doi: 10.1016/j.psj.2020.08.051. [DOI] [PMC free article] [PubMed]

[pone.0311083.ref057] 57.Domazetovic V, Marcucci G, Iantomasi T, Brandi ML, Vincenzini MT. Oxidative stress in bone remodeling: Role of antioxidants. Clin Cases Miner Bone Metab. 2017;14:209–16. doi: 10.11138/ccmbm/2017.14.1.209 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0311083.ref058] 58.Zhang H, Majdeddin M, Gaublomme D, Taminiau B, Boone M, Elewaut D, et al. 25-hydroxycholecalciferol reverses heat induced alterations in bone quality in finisher broilers associated with effects on intestinal integrity and inflammation. J Anim Sci Biotechnol. 2021;12:104. doi: 10.1186/s40104-021-00627-6 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0311083.ref059] 59.Kim DY, Kim JH, Choi WJ, Han GP, Kil DY. Comparative effects of dietary functional nutrients on growth performance, meat quality, immune responses, and stress biomarkers in broiler chickens raised under heat stress conditions. Anim Biosci. 2021;34:1839–48. doi: 10.5713/ab.21.0230 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0311083.ref060] 60.Ghasemi HA, Nari N. Effect of supplementary betaine on growth performance, blood biochemical profile, and immune response in heat-stressed broilers fed different dietary protein levels. J Appl Poult Res. 2020;29:301–13. doi: 10.1016/j.japr.2019.11.004 [DOI] [Google Scholar]

[pone.0311083.ref061] 61.Abo Ghanima MM, Abd El-Hack ME, Othman SI, Taha AE, Allam AA, Eid Abdel-Moneim AM. Impact of different rearing systems on growth, carcass traits, oxidative stress biomarkers, and humoral immunity of broilers exposed to heat stress. Poult Sci. 2020;99:3070–78. doi: 10.1016/j.psj.2020.03.011 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0311083.ref062] 62.Handel ML, Mcmorrow LB, Gravallese EM. Nuclear factor–kB in rheumatoid synovium. Localization of P50 and P65. Arthritis Rheum. 1995;38:1762–70. doi: 10.1002/art.1780381209 [DOI] [PubMed] [Google Scholar]

[pone.0311083.ref063] 63.Rajput IR, Ying H, Sun Y, Arain MA, Li W, Ping L, et al. Saccharomyces boulardii and Bacillus subtilis B10 modulate TLRs and cytokines expression patterns in jejunum and ileum of broilers. PLoS One. 2017;12:e0173917. doi: 10.1371/journal.pone.0173917 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0311083.ref064] 64.Liu WC, Ou BH, Liang ZL, Zhang R, Zhao ZH. Algae-derived polysaccharides supplementation ameliorates heat stress-induced impairment of bursa of Fabricius via modulating NF-kB signaling pathway in broilers. Poult Sci. 2021;100:101139. doi: 10.1016/j.psj.2021.101139 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0311083.ref065] 65.Saleh AA, Eltantawy MS, Gawish EM, Younis HH, Amber KA, Abd El-Moneim AEME, et al. Impact of dietary organic mineral supplementation on reproductive performance, egg quality characteristics, lipid oxidation, ovarian follicular development, and immune response in laying hens under high ambient temperature. Biol Trace Elem Res. 2020;195:506–14. doi: 10.1007/s12011-019-01861-w [DOI] [PubMed] [Google Scholar]

[pone.0311083.ref066] 66.Echeverry H, Yitbarek A, Munyaka P, Alizadeh M, Cleaver A, Camelo-Jaimes G, et al. Organic trace mineral supplementation enhances local and systemic innate immune responses and modulates oxidative stress in broiler chickens. Poult Sci. 2016;95:518–27. doi: 10.3382/ps/pev374 [DOI] [PubMed] [Google Scholar]

[pone.0311083.ref067] 67.Ebeid TA, Al-Homidan IH. Organic acids and their potential role for modulating the gastrointestinal tract, antioxidative status, immune response, and performance in poultry. Worlds Poult Sci J. 2022;78:83–101. doi: 10.1080/00439339.2022.1988803 [DOI] [Google Scholar]

[pone.0311083.ref068] 68.Wasti S, Sah N, Lee CN, Jha R, Mishrai B. Dietary supplementation of alpha-lipoic acid mitigates the negative effects of heat stress in broilers. PLoS One. 2021;16:e0254936. doi: 10.1371/journal.pone.0254936 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0311083.ref069] 69.Song J, Lei X, Luo J, Everaert N, Zhao G, Wen J, et al. The effect of Epigallocatechin-3-gallate on small intestinal morphology, antioxidant capacity and anti-inflammatory effect in heat-stressed broilers. J Anim Physiol Anim Nutr (Berl). 2019;103:1030–38. doi: 10.1111/jpn.13062 [DOI] [PubMed] [Google Scholar]

[pone.0311083.ref070] 70.Qiu W, Zhang X, Pang X, Huang J, Zhou S, Wang R, et al. Asiatic acid alleviates LPS-induced acute kidney injury in broilers by inhibiting oxidative stress and ferroptosis via activation of the Nrf2 pathway. Food Chem Toxicol. 2022;170:113468. doi: 10.1016/j.fct.2022.113468 [DOI] [PubMed] [Google Scholar]

[pone.0311083.ref071] 71.Wang S, Wu S, Zhang Y, Chen J, Zhou X. Effects of different levels of organic trace minerals on oxidative status and intestinal function in weanling piglets. Biol Trace Elem Res. 2023;201:720–27. doi: 10.1007/s12011-022-03174-x [DOI] [PubMed] [Google Scholar]

[pone.0311083.ref072] 72.Jankowski J, Ognik K, Kozłowski K, Stępniowska A, Zduńczyk Z. Effect of different levels and sources of dietary copper, zinc and manganese on the performance and immune and redox status of turkeys. Animals. 2019;9:883. doi: 10.3390/ani9110883 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0311083.ref073] 73.Winiarska-Mieczan A, Kwiecień M, Mieczan T, Kwiatkowska K, Jachimowicz K. The effect of Cu, Zn and Fe chelates on the antioxidative status of thigh meat of broiler chickens. Animal. 2021;15:100367. doi: 10.1016/j.animal.2021.100367 [DOI] [PubMed] [Google Scholar]

[pone.0311083.ref074] 74.Li KX, Wang JS, Yuan D, Zhao RX, Wang YX, Zhan XA. Effects of different selenium sources and levels on antioxidant status in broiler breeders. Asian-Australas J Anim Sci. 2018;31:1939–45. doi: 10.5713/ajas.18.0226 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0311083.ref075] 75.Gul F, Ahmad B, Afzal S, Ullah A, Khan S, Aman K, et al. Comparative analysis of various sources of selenium on the growth performance and antioxidant status in broilers under heat stress. Braz J Biol. s2023;83:e251004. doi: 10.1590/1519-6984.251004 [DOI] [PubMed] [Google Scholar]

PERMALINK

Potential benefits of advanced chelate-based trace minerals in improving bone mineralization, antioxidant status, immunity, and gene expression modulation in heat-stressed broilers

Taher Mohammadizad

Kamran Taherpour

Hossein Ali Ghasemi

Hassan Shirzadi

Fatemeh Tavakolinasab

Mohammad Hassan Nazaran

Roles

Abstract

Introduction

Materials and methods

Preparation of chelated TM

Ethics statement

Birds, diets, and management

Table 1. Ingredient composition and calculated nutrient contents of basal diets (as-fed basis).

Environmental conditions

Productive traits and sampling

Blood antioxidant parameters

Tibial bone parameters

Antibody response

Gene expression analysis

Table 2. Gene special primers used in the real-time quantitative reverse transcription PCR.

Statistical analysis

Results

Growth performance

Fig 1.

Bone characteristics

Table 3. Effect of advanced chelate technology-based trace minerals on bone morphology and mineral contents observed in broiler chickens challenged with heat stress.

Humoral immune response

Table 4. Effect of advanced chelate technology-based trace minerals on antibody responses against Newcastle disease virus (NDV), infectious bronchitis virus (IBV), and sheep red blood cells (SRBC) observed in broiler chickens challenged with heat stress.

Gene expression related to the NF-kB signaling pathway

Fig 2. Bar charts of hepatic mRNA expression levels of nuclear factor kappa B (NF-kB), interleukin (IL)-1β, IL-6, IL-10, interferon-γ (INF-γ), and transforming growth factor-β (TGF-β) in broilers at 42 days of age.

Blood antioxidant status

Table 5. Effect of advanced chelate technology-based trace minerals on serum antioxidant status and hormone profile observed in broiler chickens challenged with heat stress.

Gene expression of Nrf2 signaling pathway components

Fig 3. Bar charts of hepatic mRNA expression levels of nuclear factor erythroid 2-related factor 2 (Nrf2), glutathione peroxidase 1 (GPx1), superoxide dismutase 1 (SOD1), and catalase (CAT) in broilers at 42 days of age.

Discussion

Supporting information

Data Availability

Funding Statement

References

Decision Letter 0

Ewa Tomaszewska

Roles

Author response to Decision Letter 0

Decision Letter 1

Ewa Tomaszewska

Roles

Acceptance letter

Ewa Tomaszewska

Roles

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases