Skip to main content
Scientific Reports logoLink to Scientific Reports
. 2024 Oct 5;14:23224. doi: 10.1038/s41598-024-72228-y

Optimization of loop-mediated isothermal amplification assay for sunflower mildew disease detection

Oğuzhan Yeni 1, Mutlu Şen 2, Semra Hasançebi 3, Neslihan Turgut Kara 4,
PMCID: PMC11455944  PMID: 39369029

Abstract

Loop-Mediated Isothermal Amplification (LAMP) represents a valuable technique for DNA/RNA detection, known for its exceptional sensitivity, specificity, speed, accuracy, and affordability. This study focused on optimizing a LAMP-based method to detect early signs of Plasmopara halstedii, the casual pathogen of sunflower downy mildew, a severe threat to sunflower crops. Specifically, a set of six LAMP primers (two outer, two inner, and two loop) were designed from P. halstedii genomic DNA, targeting the ribosomal Large Subunit (LSU). These primers were verified by in silico analysis and experimental validation using both target and non-target species' DNAs. Optimizations encompassing reaction conditions (temperature, time) and component concentrations (magnesium, Bst DNA polymerase, primers, and dNTP) were determined. Validation of these optimizations was performed by agarose gel electrophoresis. Furthermore, various colorimetric chemicals (Neutral Red, Hydroxynaphthol Blue, SYBR Safe, Thiazole Green) were evaluated to facilitate method analysis, and the real-time analysis has been optimized, presenting multiple approaches for detecting sunflower downy mildew using the LAMP technique. The analytical sensitivity of the method was confirmed by detecting P. halstedii DNA concentrations as low as 0.5 pg/μl. This pioneering study, establishing P. halstedii detection through the LAMP method, stands as unique in its field. The precision, robustness, and practicality of the LAMP protocol make it an ideal choice for studies focusing on sunflower mildew, emphasizing its recommended use due to its operational ease and reliability.

Keywords: Loop-mediated isothermal amplification (LAMP), Plant pathogens, Sunflower downy mildew, Plasmopara halstedii, Plant disease detection

Subject terms: Biological techniques, Biotechnology, Microbiology, Molecular biology, Plant sciences

Introduction

Helianthus annuus L., commonly known as sunflower, ranks one of the most important oilseed crops grown worldwide. Since 2017, global annual sunflower cultivation has consistently increased1. In 2023, oilseed production worldwide constituted 61% soybean, 12.4% rapeseed, 7.9% groundnut, and 7.8% sunflower2. Except for Antarctica, Helianthus annuus is extensively cultivated across all continents as a source of edible oil and food3.

Sunflower cultivation is economically significant worldwide but faces several pathogenic factors that cause substantial yield losses. Among these, sunflower downy mildew stands prominent4. Downy mildew in sunflowers, caused by Plasmopara halstedii (Farlow) Berlese & de Toni (PHAL), originates from a biotrophic oomycete5. This pathogen is an obligate biotroph, exhibiting prominent symptoms such as stunting in infected sunflowers, rosette formation, spotting on leaves, and white sporangia layers protruding from the lower leaf surface5. The disease can also spread asymptomatically, posing risks during seed trade, leading to significant losses. Consequently, the spread of P. halstedii-resistant strains might occur, as reported by Martínez et al.23. Between 2006 and 2014, there were 35 pathotypes documented, 41 in 2014, and 50 as of 201857. The variability of P. halstedii's pathogenicity, its development of new pathotypes resistant to fungicides used in field management, and the widespread prevalence of fungicide-resistant pathotypes have been reported8.

Detection tests for both symptomatic and asymptomatic PHAL presence are necessary during the transportation of sunflower seeds in agricultural fields and trade. Several methods have been developed for detecting this pathogen in sunflowers, including the Enzyme-Linked Immunosorbent Assay (ELISA), using fatty acids as markers, and Polymerase Chain Reaction (PCR) utilizing specific oligonucleotides based on nucleic acids911.

Presently, PCR based on nucleic acid amplification, which offers high analytical sensitivity compared to serological methods for detecting plant pathogens, presents limitations such as longer reaction times, analysis duration, and the requirement for well-equipped laboratories and expert personnel. Especially in field conditions, molecular methods like PCR for the detection of PHAL present challenges, indicating the necessity for developing nucleic acid-based molecular diagnostic methods. Therefore, an alternative and more user-friendly method is necessary. In recent years, attention has been drawn to the Loop-Mediated Isothermal Amplification (LAMP) test, an isothermal amplification-based detection method. The PCR-based PHAL detection method reported a lowest detection limit of 3 pg10. Our developed and optimized LAMP test, however, has a lowest detection limit of 0.5 pg. Therefore, the PHAL detection can be performed with high analytical sensitivity and accuracy using the LAMP test developed in this study.

The LAMP method, compared to other nucleic acid-based detection methods, is notably faster, does not require expensive equipment, simple instruments such as water bath or heat block, operates at a constant temperature without a thermal cycling process, facilitates easy analysis, does not necessitate a fully equipped laboratory, and is highly suitable for field applications. Reactions performed using LAMP target 6–8 regions on the target sequence, rendering them highly specific12,13.

The analysis of LAMP reaction offers several advantages. Besides being cost-effective and suitable for field conditions, LAMP results can be directly evaluated under visible light with the naked eye, using devices measuring turbidity, or simple spectrophotometric methods14. The LAMP method is resilient to inhibitory agents that might affect PCR and can be conducted directly using samples without the need for DNA extraction.

Colorimetric LAMP is a diagnostic method that uses color-based indicators to visualize the presence of specific nucleic acids. This approach provides an effective solution for detecting viruses and pathogens. By utilizing dyes such as SYBR Green, colorimetric analyses enable visual assessment of test results, reducing the need for laboratory equipment and thereby lowering costs. For instance, the RT-LAMP assay developed for Indian citrus ringspot virus can detect cRNA levels as low as 100 fg, with results visualized using SYBR Green showing no cross-reactivity with other citrus pathogens15. Similarly, the RT-LAMP assay for Citrus tristeza virus detects RNA levels as low as 0.0001 ng and facilitates easy result interpretation with SYBR Green16. These studies highlight the significance of colorimetric LAMP methods as a cost-effective and accessible tool for pathogen detection.

Since 2003, specific LAMP methods have been developed for diagnosing various diseases in different plants. Within this scope, LAMP methods have been established for barley yellow dwarf virus in various cereals17, Candidatus phytoplasma vitis18, tomato chlorosis virus19 and potato ring rot pathogen Clavibacter michiganensis subsp. sepedonicus20. However, no prior LAMP test has been conducted specifically for PHAL.

This study presents the initial application of the LAMP test for detecting PHAL. Consequently, an optimized LAMP test has been developed, providing a cost-effective, field-suitable, and easily analyzable solution with high analytical sensitivity and specificity.

Materials and methods

Fungal material

Infected sunflower (Helianthus annuus) leaves were used for Plasmopara halstedii (PHAL) sources. Infected and healthy sunflower leaf samples were taken from the Thrace Agricultural Research Institute (TARI), which coordinates sunflower farming in Turkey, and were included in the study with the knowledge of the institute. Healthy sunflower leaves were used for DNA isolation. Fungal mycelium and spores were harvested by brushing from the leaves. Five different fungal phytopathogens that are widely observed in local fields were used for screening of the developed method analytical sensitivity. Among them Puccinia carthami and Puccinia triticina were collected in a similar way as P. halstedii. Others (Phoma macdonaldii, Macrophomina phaseolina and Fusarium spp) were obtained as a pure culture from Phytopathology Department of TARI and Plant Protection Department of Ankara University. Mycelium and spores of these fungi were collected by sterile spatula on surface of the culture. Fungal spores were frozen in liquid nitrogen and used for DNA extraction.

Isolation of genomic DNA

Frozen samples were homogenized using a homogenizer (BeadBug D1030 Microtube Homogenizer, BENCHMARK SCIENTIFIC INC.). Genomic DNA from sunflower leaves, fungal spores and mycelliums were isolated utilizing Plant/Fungi DNA Isolation Kits (NORGEN, Cat no: 26200), following the manufacturer's protocol. The purity (A260/A280) and quantity of the isolated DNA samples were measured using a Nanodrop 2000 (THERMO FISHER SCIENTIFIC) and additionally analyzed using agarose gel (2%) electrophoresis.

Design of LAMP primers

All GenBank available PHAL pathotypes sequences were aligned using ClustalW (https://www.megasoftware.net/), and LAMP primer set was designed using Primer Explorer V5 (EIKEN CHEMICAL Co. Ltd., Tokyo, Japan) (https://primerexplorer.jp/e/). The large subunit (LSU) of P. halstedii ribosomal DNA (GenBank: MK294561.1), previously targeted by conventional PCR by Ioos et al.10, was selected as the target region for LAMP primer design to be used in species identification through the LAMP method. This region is highly suitable for specific PCR testing due to its high repetition, as noted by Ioos et al.10. The large subunit (LSU) of ribosomal DNA is an ideal target for PCR tests and phylogenetic analyses due to its high repetition, conservation, and interspecies polymorphisms, facilitating accurate species identification21,22. Designed LAMP primer set is shown in Table 1.

Table 1.

Primer set designed specifically for PHAL ribosomal DNA gene large subunit.

Primer name Description Sequence (5' -3')
F3 Forward outer GTGGTAAATTCCATCTAAAGCT
B3 Backward outer TATACAGCACATACGCCG
FIP Forward inner GCAGTTTCAGGTACTCTTTAACTC-TGCGAGACCGATAGCAAAC
BIP Backward inner GGAACCAAATCGTTTCCAGTGTCTA-AAAGGCCACTACAACAGC
LF Forward loop TTTCATCTTTCCCTCACGGT
LB Backward loop CCGTGGTATATCACATCGGC

LAMP reaction optimization

LAMP reaction optimization studies were conducted using Bst 2.0 Warm Start DNA Polymerase (8,000 U/ml) (NEW ENGLAND BIOLABS, Cat no: M0538) in a thermal cycler (APPLIED BIOSYSTEM, SimpliAmp) and a real-time thermal cycler device (BIO-RAD, CFX96 Touch Real-Time PCR Detection System).

Different reaction conditions were evaluated to optimize the LAMP reaction. These conditions included temperature (63 °C, 65 °C, 67 °C, 70 °C), reaction duration (15, 35, 45, 60 min), Bst 2.0 DNA polymerase concentrations (6, 8, 10, 12 U), LAMP primer concentrations [F3/B3 (0.1, 0.2, 0.4 μM), FIP/BIP (0.8, 1.6, 3.2 μM), LF/LB (0.2, 0.4, 0.8 μM)], and reagent concentrations [Mg2+ (6, 8, 10, 12 mM), dNTPs (1.0, 1.2, 1.4, 1.6 mM)]. In all experiments, the template DNA concentration was maintained at 50 ng, and reactions were conducted in a 1X reaction buffer [20 mM Tris–HCl, 10 mM (NH4)2SO4, 2 mM MgSO4, 0.1% Tween 20, pH 8.8 at 25 °C] with a final reaction volume of 25 µl adjusted with PCR-grade water.

The optimization process was carried out in a systematic manner. Initially, temperature optimization was performed by varying the temperature while keeping all other components constant to determine the optimal temperature. Following this, magnesium ion concentration was optimized by varying Mg2+ levels, and then Bst 2.0 DNA polymerase concentration was adjusted. After establishing the optimal conditions for temperature, Mg2+, and polymerase concentration, primer concentrations were optimized, and finally, dNTP concentration was varied. After amplification, all reactions were incubated at 80 °C for 10 min to inactivate the enzyme. Throughout this study, all reactions were performed with three technical replicates, including No Template Controls (NTC).

Evaluation of all optimization experiments involved recording visualizations of 2% agarose gel electrophoresis using a UV-transilluminator.

Visualization and analysis of LAMP reactions

Different analysis dyes [Neutral Red (GENAXXON BIOSCIENCE) (80, 100, 120 μM), Hydroxynaphthol Blue (HNB, SIGMA-ALDRICH) (100, 120, 140 μM), SYBR Safe DNA Gel Stain (SGS, 10,000X, INVITROGEN) (10X, 100X, 1000X) and Thiazole Green (TG, 10,000X, BIOTIUM) (100X, 1000X)] were used at various concentrations to conduct optimization studies. In the visualization process, fluorescent compounds SYBR Safe DNA Gel Stain and Thiazole Green were added to the tubes after the completion of the reaction, with 4 μL added to each tube. Analyses were conducted by the naked eyes and under UV light (312 nm). The outcomes were evaluated using 2% agarose gel electrophoresis.

In addition to optimized LAMP reactions, real-time LAMP optimization studies were performed. The reaction involved the utilization of SYBR Safe DNA Gel Stain, Thiazole Green, and LAMP Fluorescent Dye (50X, NEW ENGLAND BIOLABS, Cat no: B1700S) at 1X and 2X concentrations, enabling measurement of amplification based on fluorescent emission in real-time. The LAMP reactions were conducted on a real-time PCR machine under conditions of 65 °C for 90 cycles, with a 20 s for each cycle to enable fluorescence acquisition. Result analysis involved real-time fluorescence detection using the FAM channel of the PCR machine.

Analytical Sensitivity and Specificity of LAMP

To determine the minimum detectable amount of PHAL genomic DNA that the optimized LAMP test can identify, serial dilutions of the DNA were analyzed. These serial dilutions, prepared to establish the analytical sensitivity of the LAMP test and including a total of seven different DNA concentrations 50 ng/μl, 5 ng/μl, 500 pg/μl, 50 pg/μl, 5 pg/μl, 0.5 pg/μl, and 0.05 pg/μl. The sensitivity studies of the LAMP test were conducted using 2% agarose gel electrophoresis and the optimized Thiazole Green dye.

To assess the analytical specificity of the optimized LAMP reaction and conditions for the P. halstedii pathogen, genomic DNA samples from, Helianthus annuus, Phoma macdonaldii, Macrophomina phaseolina, Puccinia carthami, Puccinia triticina, Fusarium spp., and P. halstedii were used as templates, with a total of seven different DNA samples employed in the analysis. The reaction products were analyzed by 2% agarose gel electrophoresis.

Results

LAMP optimizations

Optimization studies aimed at detecting the target DNA of PHAL using the LAMP method involved testing diverse temperatures, Bst DNA Polymerase enzyme units, primer concentrations, Mg2+ concentrations, dNTP concentrations and reaction times. The optimal conditions for the LAMP reaction were determined as follows: a temperature of 65 °C, Bst 2.0 DNA polymerase 10 U, Mg2+ concentration of 10 mM, FIP/BIP primer concentration of 3.2 μM, F3/B3 primer concentration of 0.4 μM, LF/LB primer concentration of 0.8 μM, and dNTP concentration of 1.4 mM. It was also observed that the most efficient and earliest amplification occurred within 35 min. When selecting these values, the most distinct bands in positive samples were visualized on the gel as quickly as possible. The variables used in the optimization studies and the selected optimum values are highlighted in Table 2. All experimental results related to the LAMP optimization studies are provided in the “supplementary material” section.

Table 2.

The variables and optimum values from the optimization studies for the detection of P. halstedii pathogen using the LAMP method are highlighted in bold.

Condition Tested parameters [optimized highlighted in bold]
Temperature 63 °C 65 °C 67 °C 70 °C
Duration 15 min 35 min 45 min 60 min
Bst 2.0 DNA Polymerase 6 U 8 U 10 U 12 U
F3/B3 Primer Concentration 0.1 μM 0.2 μM 0.4 μM
FIP/BIP Primer Concentration 0.8 μM 1.6 μM 3.2 μM
LF/LB Primer Concentration 0.2 μM 0.4 μM 0.8 μM
Mg2+ Concentration 6 mM 8 mM 10 mM 12 mM
dNTPs Concentration 1.0 mM 1.2 mM 1.4 mM 1.6 mM

The products of the optimized LAMP reaction exhibited ladder-like bands as expected in positive reactions during agarose gel electrophoresis, while no bands were observed in NTC shown in Fig. 1.

Fig. 1.

Fig. 1

Agarose gel electrophoresis image of optimized LAMP reaction products for the detection of PHAL. M: Marker 100 bp (HIBRIGEN, MG-LDR-100), 1–2: PHAL (The presence of a positive reaction was visualized as a pattern resembling a ladder), 3: NTC. Samples were run on a 2% agarose gel at 100 V for 45 min.

Visualization results of LAMP reactions

In this study, various optimizations were conducted to enable the analysis of LAMP products. The optimal concentrations determined for Neutral Red, Hydroxynaphthol Blue, SYBR Safe DNA Gel Stain and Thiazole Green were 120 μM, 150 μM, 100X, 1000X, respectively.

When visualizing LAMP reactions using Neutral Red with optimized indicators, positive samples transitioned from a light orange color before the reaction to pink after the reaction, while no color change was identified in the NTCs before or after the reaction. Hydroxynaphthol Blue optimized visualization studies, where PHAL genomic DNA was used in positive samples, observed a color change from purple-magenta to blue, while the color remained purple-magenta in the NTC. Both Neutral Red and Hydroxynaphthol Blue chemical indicators were added before the reaction commenced, and the analyses were evaluated by the naked eye shown in Fig. 2.

Fig. 2.

Fig. 2

Obtained LAMP reaction results with the optimized dye concentrations. In the presence of PHAL genome in the reaction, Neutral Red produced a color gradient from orange to light pink. In case of HNB addition to the reaction, a color gradient from purple magenta to blue was observed. In case of SGS addition to the reaction, a color gradient from orange to yellowish was observed. In case of TG addition to the reaction, a color gradient from orange to yellow was observed.

In the visualization experiments performed by addition of SYBR Safe DNA Gel Stain and Thiazole Green, positive samples exhibited a yellow color when analyzed visually and emitted green fluorescence when observed under UV light. Notably, no fluorescence was observed in NTC samples throughout at that stage.

The results of real-time LAMP optimization involved the use of fluorescent DNA-specific dyes: SYBR Safe DNA Gel Stain, Thiazole Green, and LAMP Fluorescent Dye, each utilized in two different concentrations (1X and 2X) separately.

In this study, we obtained data enabling the detection of PHAL DNA amplification using real-time LAMP. Analysis indicated a sigmoidal amplification curve in positive samples, while NTC showed a flat line, indicating no measurable fluorescence. Amplification was measured in terms of relative fluorescence units (RFU). The addition of dyes enabling real-time analysis of amplification to the tube before the reaction commencement is a significant advantage as it prevents contamination and false positives.

In real-time LAMP, the addition of Thiazole Green fluorescent dye at 2X concentration, LAMP Fluorescent Dye at 2X concentration, and SYBR Safe DNA Gel Stain fluorescent dye at 1X concentration into the tubes before the reaction commencement enabled efficient analysis without inhibiting the reaction, shown in Fig. 3.

Fig. 3.

Fig. 3

Real-time analysis of LAMP reaction results. (a) Utilization of 2X Thiazole Green (TG) fluorescent dye. (b) Utilization of 1X SYBR Safe DNA Gel Stain (SGS) fluorescent dye. (c) Utilization of 2X LAMP Fluorescent Dye (LFD). Each reaction included 3 positive controls and 1 NTC.

Analytical sensitivity and specificity of the LAMP reaction developed for PHAL

Serial dilutions of PHAL genomic DNA samples were used to determine the sensitivity of LAMP primers, reaction content and conditions. PHAL genomic DNA was analyzed at 7 different dilutions between 50 ng/μl and 0.05 pg/μl. It was determined that the optimized LAMP reaction could detect a minimum of 0.5 pg/μl PHAL genomic DNA. Analyses conducted visually and under UV light using Thiazole Green are depicted in Fig. 4, while the results of analyses performed using 2% agarose gel are presented in Fig. 5.

Fig. 4.

Fig. 4

Sensitivity determination study. (a) Naked eye analysis under visible light. (b) Analysis under UV irradiation. 1: 50 ng/μl, 2: 5 ng/μl, 3: 500 pg/μl, 4: 50 pg/μl, 5: 5 pg/μl, 6: 0.5 pg/μl, 7: 0.05 pg/μl, 8: NTC.

Fig. 5.

Fig. 5

Analysis of sensitivity determination conducted through agarose gel electrophoresis. M: 100 bp Marker (HIBRIGEN, MG-LDR-100), 1: 50 ng/μl, 2: 5 ng/μl, 3: 500 pg/μl, 4: 50 pg/μl, 5: 5 pg/μl, 6: 0.5 pg/μl, 7: 0.05 pg/μl, 8: NTC. Samples were run on a 2% agarose gel at 100 V for 45 min.

The specificity of the optimized LAMP reaction for PHAL was assessed by testing its reaction with various organisms. Helianthus annuus and pathogens such as Phoma macdonaldii, Macrophomina phaseolina, Puccinia carthami, Puccinia triticina, and Fusarium spp. were used in these tests.

The results indicated that positive reactions were exclusively observed in the samples containing PHAL. This demonstrates the specificity of the LAMP reaction, as it selectively amplifies the target DNA from Plasmopara halstedii without showing any amplification in the presence of other organisms or host DNA, shown in Fig. 6.

Fig. 6.

Fig. 6

Specificity study result of optimized LAMP reaction. M: 100 bp marker (HIBRIGEN, MG-LDR-100), 1: P. halstedii, 2: Sunflower (Helianthus annuus), 3: Phoma macdonaldii, 4: Macrophomina phaseolina, 5: Puccinia carthami, 6: Puccinia triticina, 7: Fusarium spp, 8: NTC.

Discussion

In today's context, sunflower farming faces various environmental and socio-economic challenges such as climate change, economic conditions worldwide, and geopolitical tensions between major sunflower-producing countries. These factors complicate sunflower production, leading to susceptibility to different diseases and subsequent yield losses. Among these diseases, one of the most significant contributors to yield reduction is sunflower downy mildew caused by the obligate biotrophic oomycete Plasmopara halstedii. Early detection of this disease is crucial due to its detrimental impact on sunflower crops4. Specific oligonucleotide-based PCR methods, ELISA techniques, and the utilization of fatty acids as markers are some of the developed methods used to detect PHAL10,11,23.

In this study, we explored and developed a rapid, user-friendly method specifically aimed at detecting PHAL using LAMP techniques. Our research has provided various analysis methods that offer users the flexibility of field-suitable application and laboratory use. By using this optimised protocol, field application is possible because LAMP reaction products can be analyzed calorimetrically and without using professional laboratory equipment.

In this study, optimizations were conducted to determine the reaction temperature for the detection of PHAL using the LAMP method. Previous research indicates that optimal temperatures can vary for different pathogens. For instance, in the detection of Sclerotinia sclerotiorum, 63 °C was found to be suitable, while 68 °C was identified as optimal for Penicillium expansum. In the case of detecting sunflower mildew caused by PHAL, optimization experiments were carried out at different temperatures, specifically 63 °C, 65 °C, 67 °C, and 70 °C. The results revealed that the most efficient detection occurred at 65 °C.

To determine the efficacy of the LAMP reaction, optimization studies were also performed to identify the optimal Mg2+ concentration, crucial for the activity of Bst DNA polymerase and the continuity of the reaction. Mg2+ ions play a pivotal role as a cofactor for Bst DNA polymerase, influencing the specificity and efficiency of the reaction. Prior studies emphasize the critical nature of Mg2+ concentration in various LAMP methods24,25. Nie25, according to the results of an RT-LAMP application for the detection of Y virus in potatoes, reported that the Mg2+ concentration required for product formation should be at least 4 mM, but for the most efficient results, this value is between 6 and 8 mM. Therefore, these optimization efforts aimed to determine both the ideal reaction temperature and the crucial Mg2+ concentration for an efficient and accurate detection of PHAL using the LAMP method.

In this study, optimization experiments were conducted to determine the total Mg2+ concentration within the reaction at 6 mM, 8 mM, 10 mM, and 12 mM. Considering that the LAMP reaction inherently contains 2 mM Mg2+ provided by the 10X isothermal amplification buffer, additional MgSO4 was added to the reaction to achieve the targeted Mg2+ concentration values. The results of these experiments indicated that the optimal Mg2+ concentration was determined to be 10 mM.

Kang et al.26 conducted optimization studies using four different enzyme concentrations 4 U, 6 U, 8 U, and 10 U while developing a point-of-care (POC) test for human influenza virus subtypes H1N1 and H3N2 using the LAMP method. Their findings reported that the optimal enzyme concentration was 10 U. Su et al.27 conducted a study on the detection of Sporisorium scitamineum in sugarcane using the LAMP method. In their research, they performed optimization experiments with four different concentrations of the enzyme, namely 2.0 U, 4.0 U, 6.0 U, and 8.0 U. Their findings indicated that the use of 8.0 U of the enzyme was optimal for efficient detection.

To determine the most suitable Bst DNA polymerase concentration for the LAMP reaction developed to detect PHAL, 6 U, 8 U, 10 U, and 12 U enzymes were used. The results were evaluated by agarose gel electrophoresis, indicating that increasing the Bst DNA polymerase enzyme concentration up to 10 U proportionally increased efficiency. However, no significant difference was observed between the 10 U concentration and the higher 12 U enzyme concentrations. Hence, the optimum enzyme concentration for the developed LAMP method was determined to be 10 U.

To examine the impact of LAMP primers on reaction efficiency, three different concentrations of the primers were used: 3.2 µM for FIP/BIP primers, 0.4 µM for F3/B3 primers, and 0.8 µM for LF/LB primers; 1.6 µM for FIP/BIP primers, 0.2 µM for F3/B3 primers, and 0.4 µM for LF/LB primers; and 0.8 µM for FIP/BIP primers, 0.1 µM for F3/B3 primers, and 0.2 µM for LF/LB primers. Decreasing the primer concentration was found to decrease the reaction efficiency, as detected by agarose gel electrophoresis. Therefore, the optimal primer concentrations were determined to be 3.2 µM for FIP/BIP, 0.4 µM for F3/B3, and 0.8 µM for LF/LB.

For the optimization of the developed LAMP method, four different dNTP concentrations (1 mM, 1.2 mM, 1.4 mM, 1.6 mM) were tested. Li et al.28 tested 0.2, 0.6, 1.0, 1.4 and 1.8 mM dNTP concentrations during the optimization of their RT-LAMP method for the detection of maize chlorotic mottle virus in corn. Ma et al.29 conducted studies on the optimization of dNTP concentration for visual detection of Y virus in potatoes using the LAMP method, working with concentrations of 0.8 mM, 1.0 mM, 1.2 mM, 1.4 mM, 1.6 mM, and 1.8 mM, reporting the most suitable dNTP concentration as 1.0 mM. The optimum dNTP concentration required for the detection of P. halstedii using the LAMP method was determined to be 1.4 mM.

After completing the optimization of the reaction components and temperature the optimum reaction time for the LAMP reaction is determined to operate most efficiently. Four different reaction times (15, 35, 45, 60 min) were tested, with the most efficient reaction time determined to be 35 min.

Optimization studies were conducted to enable the detection of the P. halstedii pathogen using the LAMP reaction for colorimetric analysis, utilizing Neutral Red and Hydroxynaphthol blue reagents. Within this scope, LAMP reactions containing 120 µM Neutral Red successfully detected the P. halstedii pathogen, showing a distinct color change between the sample tubes containing the pathogen and the negative control tubes. Meanwhile, when the LAMP reaction contained 150 µM Hydroxynaphthol blue, a notable shift from a purple-lilac color to blue was observed in the samples containing the pathogen. In addition to these reagents, optimization studies were carried out to determine the concentrations of the fluorescent, DNA specific dyes SYBR Safe DNA Gel Stain and Thiazole Green, which enable the analysis of LAMP reactions under both visible light and UV light sources.

Literature indicates that the addition of such SYBR Green, EvaGreen, and similar dyes before the initiation of the LAMP reaction can lead to inhibition and prevent the working of reaction30. Hence, for colorimetric analysis, these dyes were added into the tube after the completion of the LAMP reaction31. Consequently, for the detection of P. halstedii using the LAMP test, adding 4 µl of 100X SYBR Safe DNA Gel Stain or 1000X Thiazole Green into 25 µl of the reaction allowed for efficient analysis under UV light. However, previous studies have shown that these types of DNA-specific dyes, when used in appropriate concentrations (considerably lower according to colorimetric analysis), can be added before the reaction, allowing real-time analysis without any inhibition32,33. In this study, real-time analysis was conducted to determine the optimal concentrations of Thiazole Green and SYBR Safe DNA Gel Stain as fluorescence dyes during the pre-incubation step of the LAMP reaction. Results regarding the fluorescent dyes used in these studies were evaluated by comparison with 1X and 2X LAMP Fluorescent Dye (50X, New England Biolabs, Cat no: B1700S).

In addition to contributing to the literature by developing the first application of the LAMP test for PHAL, this study offers a useful and innovative approach as a user-friendly and easily analyzable solution in the field. As a step forward from this developed test, we foresee a near future in which the test can be adapted to devices such as biosensors, chips and POC devices that can be routinely applied both in the professional laboratory and in the field.

Supplementary Information

Supplementary Figures. (745.8KB, docx)

Acknowledgements

The research was funded by the Research Fund of Istanbul University under Project Number FYL 2022-39343. Oğuzhan YENİ, who conducted his thesis as a graduate student during this study, received a 2210A success scholarship from The Scientific and Technological Research Council of Türkiye and we express our gratitude for the support provided by The Scientific and Technological Research Council of Türkiye. We thank Önder BAYDEMİR (Directorate of Trakya Agricultural Research Institute, Türkiye) and Assoc. Prof. Arzu ÇELİK OĞUZ (Ankara University, Faculty of Agriculture, Plant Protection Department, Türkiye) for their support in providing experimental materials. The authors have no conflict of interest to declare.

Author contributions

O.Y.: Methodology, investigation, analysis, writing—original draft preparation; M.Ş.: Metodology, revised the manuscript; S.H.: Metodology, revised the manuscript; N.T.K.: conceptualization and revised the manuscript, and supervision. All authors contributed to the concept and design of the study.

Data availability

Data is provided within the manuscript or supplementary information files.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher's note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary Information

The online version contains supplementary material available at 10.1038/s41598-024-72228-y.

References

  • 1.Bozer, P., Çöteli, F.T., Gülaç, N. Agricultural Economics and Policy Development Institute, Sunflower, Agricultural Products Market Report (2023).
  • 2.USDA, Sunflowerseed Explorer. https://ipad.fas.usda.gov/cropexplorer/cropview/commodityView.aspx?cropid=2224000 (2023).
  • 3.Kaya, Y., Jocic, S., Miladinovic, D. Sunflower. Springer eBooks 85–129 10.1007/978-1-4614-0356-2_4 (2012).
  • 4.Bán, R. et al. New and high virulent pathotypes of sunflower downy mildew (Plasmopara halstedii) in seven countries in Europe. J. Fungi7, 549–549 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Spring, O. Spreading and global pathogenic diversity of sunflower downy mildew – review. Plant Prot. Sci.55, 149–158 (2019). [Google Scholar]
  • 6.Veverka, K. A. Lebeda, P. T. N. Spencer-Phillips (eds): Advances in Downy Mildew Research. Vol. 3 (Proceedings of the 2nd International Downy Mildews Symposium) - Book Review," Plant Protect. Sci., vol. 43, pp. 125–6 (2007).
  • 7.Viranyi, F., Gulya, T. J. & Tourvieille, D. L. Recent changes in the pathogenic variability of Plasmopara halstedii (sunflower downy mildew) populations from different continents. Helia38, 149–162 (2015). [Google Scholar]
  • 8.Moinard, J. et al. An overview of sunflower downy mildew. Phytoma – La Défense des Végétaux589, 34–8 (2006). [Google Scholar]
  • 9.Liese, A. R., Gotlieb, A. R., Sackston, W. E. Proceedings of the 10th International Sunflower Conference, Queensland, Australia: International Sunflower AssociationUse of enzyme-linked immunosorbent assay (ELISA) for the detection of downy mildew (Plasmopara halstedii) in sunflower; pp. 173–175 (1982).
  • 10.Ioos, R. R., Laugustin, L. L., Rose, S. S., Tourvieille, J. J. & Tourvieille, D. D. Development of a PCR test to detect the downy mildew causal agent Plasmopara halstedii in sunflower seeds. Plant Pathol.56, 209–218 (2007). [Google Scholar]
  • 11.Viranyi, F. & Spring, O. Advances in sunflower downy mildew research. Eur. J. Plant Pathol.129, 207–220 (2011). [Google Scholar]
  • 12.Notomi, T. et al. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res.28(12), e63–e63 (2000). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Tomita, N., Mori, Y., Kanda, H. & Notomi, T. Loop-mediated isothermal amplification (LAMP) of gene sequences and simple visual detection of products. Nat. Protocols3, 877–882 (2008). [DOI] [PubMed] [Google Scholar]
  • 14.Wong, Y.-P., Othman, S., Lau, Y.-L., Radu, S. & Chee, H.-Y. Loop-mediated isothermal amplification (LAMP): A versatile technique for detection of micro-organisms. J. Appl. Microbiol.124, 626–643 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Kokane, A. D. et al. A rapid and sensitive reverse transcription–loop-mediated isothermal amplification (RT-LAMP) assay for the detection of Indian citrus ringspot virus. Plant Dis.105, 1346–1355 (2021). [DOI] [PubMed] [Google Scholar]
  • 16.Warghane, A. et al. Development of a simple and rapid reverse transcription-loop mediated isothermal amplification (RT-LAMP) assay for sensitive detection of Citrus tristeza virus. J. Virol. Methods250, 6–10 (2017). [DOI] [PubMed] [Google Scholar]
  • 17.Zhao, K., Liu, Y. & Wang, X. Reverse transcription loop-mediated isothermal amplification of DNA for detection of Barley yellow dwarf viruses in China. J. Virol. Methods169, 211–214 (2010). [DOI] [PubMed] [Google Scholar]
  • 18.Kogovšek, P. et al. LAMP assay and rapid sample preparation method for on-site detection of flavescence dorée phytoplasma in grapevine. Plant Pathol.64, 286–296 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Karwitha, M. et al. Rapid detection of tomato chlorosis virus from infected plant and whitefly by one-step reverse transcription loop-mediated isothermal amplification. J. Phytopathol.164, 255–263 (2015). [Google Scholar]
  • 20.Sagcan, H. & Kara, N. T. Detection of Potato ring rot Pathogen Clavibacter michiganensis subsp. sepedonicus by Loop-mediated isothermal amplification (LAMP) assay. Sci. Rep.9, 20393 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Riethmüller, A., Voglmayr, H., Göker, M., Weiß, M. & Oberwinkler, F. Phylogenetic relationships of the downy mildews (Peronosporales) and related groups based on nuclear large subunit ribosomal DNA sequences. Mycologia94, 834–849 (2002). [DOI] [PubMed] [Google Scholar]
  • 22.Voglmayr, H., Riethmüller, A., Göker, M., Weiss, M. & Oberwinkler, F. Phylogenetic relationships of Plasmopara, Bremia and other genera of downy mildew pathogens with pyriform haustoria based on Bayesian analysis of partial LSU rDNA sequence data. Mycol. Res.108, 1011–1024 (2004). [DOI] [PubMed] [Google Scholar]
  • 23.Martínez, A., Quiroz, F. & Carrera, A. Detection of Plasmopara halstedii in sunflower seeds: A case study using molecular testing. J. Saudi Soc. Agric. Sci.20, 395–400 (2021). [Google Scholar]
  • 24.Fukuta, S. et al. Development of immunocapture reverse transcription loop-mediated isothermal amplification for the detection of tomato spotted wilt virus from chrysanthemum. J. Virol. Methods121, 49–55 (2004). [DOI] [PubMed] [Google Scholar]
  • 25.Nie, X. Reverse transcription loop-mediated isothermal amplification of DNA for detection of Potato virus Y. Plant Disease89, 605–610 (2005). [DOI] [PubMed] [Google Scholar]
  • 26.Kang, J.-S., Seo, M.-R. & Chung, Y.-J. Development of reverse-transcription loop-mediated isothermal amplification assays for point-of-care testing of human influenza virus subtypes H1N1 and H3N2. Genom. Inf.20, e46–e46 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Su, Y. et al. Development and application of a rapid and visual loop-mediated isothermal amplification for the detection of Sporisorium scitamineum in sugarcane. Sci. Rep.6, 23994 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Li, X. et al. Development of an RT-LAMP assay for the detection of maize yellow mosaic virus in maize. J. Virol. Methods300, 114384–114384 (2022). [DOI] [PubMed] [Google Scholar]
  • 29.Ma, Y., Zhang, Y., Zhu, H. & Wang, J. A rapid visual detection method for Potato virus Y based on loop mediated isothermal amplification (LAMP). J. Plant Dis. Prot.130, 1423–1431 (2023). [Google Scholar]
  • 30.Moon, Y.-J., Lee, S.-Y. & Oh, S.-W. A review of isothermal amplification methods and food-origin inhibitors against detecting food-borne pathogens. Foods11, 322–322 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Lai, M. Y., Ooi, C. H. & Lau, Y. L. Validation of SYBR green I based closed-tube loop-mediated isothermal amplification (LAMP) assay for diagnosis of Knowlesi malaria. Malar J.20, 166 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Quyen, T. L., Ngo, T. A., Bang, D. D., Madsen, M. & Wolff, A. Classification of multiple DNA dyes based on inhibition effects on real-time loop-mediated isothermal amplification (LAMP): Prospect for point of care setting. Front. Microbiol.10, 2234 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Xiong, X. et al. Using real time fluorescence loop-mediated isothermal amplification for rapid species authentication of Atlantic salmon (Salmo salar). J. Food Compos. Anal.95, 103659–103659 (2021). [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Figures. (745.8KB, docx)

Data Availability Statement

Data is provided within the manuscript or supplementary information files.


Articles from Scientific Reports are provided here courtesy of Nature Publishing Group

RESOURCES