Abstract
Objective and Rationale
Inflammatory bowel disease, including Crohn's disease and ulcerative colitis, manifests with chronic intestinal inflammation and frequent sequential fibrosis. Current pharmacological therapies may show harmful side effects and are not useful for prevention or resolution of fibrosis. Thus, the use of alternative therapies is emerging as a novel useful approach. Previous results suggest that Scutellaria baicalensis Georgi (SBG) and Boswellia serrata (BS) display anti‐inflammatory properties. The aim of this study was to investigate in intestinal epithelial cells and fibroblasts the anti‐inflammatory and anti‐fibrotic potential of SBG and BS, alone or in combination.
Methods
Human colorectal adenocarcinoma cells (HT29), human intestinal epithelial cells (HIEC6) and human colon fibroblasts (CCD‐18Co) were used. Cells were pretreated with SBG and BS and then exposed to pro‐inflammatory and pro‐fibrotic cytokines.
Results
SBG and BS extracts significantly decreased pro‐inflammatory cytokine expression and improved epithelial restitution in HT29 and HIEC6 cells. Besides, fibrotic marker expression, including SNAIL, ACTA2, ZNF281, was strongly reduced. Colon myofibroblasts treated with SBG and BS showed a significant decrease of fibrotic markers as well.
Conclusions
SBG and BS extracts significantly reduce inflammation and impair fibrosis in intestinal epithelial cells and colon myofibroblasts. No cooperative effect is observed.
Keywords: Boswellia Serrata, fibrosis, IBD, inflammation, Scutellaria baicalensis Georgi
Inflammatory bowel disease manifests with chronic intestinal inflammation, frequently resulting in fibrosis, for which pharmacological therapies are not available. The use of natural bioactive compounds is emerging as a novel promising approach. We showed that Scutellaria baicalensis Georgi and Boswellia Serrata extracts significantly reduce inflammation and impair fibrosis in intestinal epithelial cells and colon myofibroblasts.

1. INTRODUCTION
Inflammatory bowel disease (IBD), which include Crohn's disease (CD) and ulcerative colitis (UC), is a group of chronic intestinal disorders caused by dysregulated immune response in genetically susceptible individuals. The disease is characterized by chronic inflammation of the gastrointestinal wall, leading to increased risk of hospitalization, surgery and disability with a high impact on patients’ quality of life. 1
Intestinal fibrosis is a common complication of IBD inducing persistent luminal narrowing and strictures, significantly destroying the structure and function of the intestine. 2 Around 50% of CD patients will develop fibrotic strictures or penetrating lesions, and up to 75% will eventually need surgery. 3 , 4 Although less frequent, recent evidence shows some degree of fibrosis in patients with UC as well. 5 , 6 The mechanism underlying the development and progression of fibrosis in IBD is still unclear, but growing evidence suggests that chronic intestinal inflammation is an important initiating factor of fibrosis. 7 , 8
Currently, traditional pharmacological therapies used in the treatment of IBD involve salicylates, steroids, immunosuppressants or biological agents, that may manifest, in addition to their therapeutic action, harmful side effects, including gastrointestinal disturbance, systemic immunosuppression, kidney toxicity, weight gain, high blood pressure, and increased infections. 9 , 10 Besides, the existing anti‐inflammatory drugs do not effectively prevent and relieve fibrosis, so that the incidence of intestinal stricture did not reach a significant drop yet. 11 , 12 , 13 , 14 , 15
Newer treatments are now expected to be provided for better efficacy with an improved adverse event profile.
Natural bioactive compounds have already been considered an asset in the therapeutic armamentarium of complex chronic disorders, including digestive tract diseases. 16 , 17
Scutellaria baicalensis Georgi (SBG) is a flowering plant belonging to the Lamiaceae family noted for its high content of bioactive compounds, such as baicalin, baicalein, wogonoside, and wogonin, with high therapeutic potential. 18 Indeed, anti‐inflammatory, 19 , 20 antiviral, 21 antibacterial, 22 antioxidant, 23 anticancer 24 , 25 and immunomodulatory 26 effects of SBG have reported.
Boswellia serrata (BS), belonging to the family of Burseraceae, comprises of a series of pentacyclic triterpene molecules, principally the boswellic acids (BAs), isolated from the gum resin of the plant, that exhibit high efficacy against various chronic diseases such as arthritis, diabetes, asthma, cancer, IBD, Parkinson's disease, Alzheimer's. 21 , 27 , 28 In the resin, more than 12 different boswellic acids have been identified, such as 11‐keto‐β‐boswellic acid (KBA) and 3‐O‐acetyl‐11‐keto‐β‐boswellic acid (AKBA), the latter receiving the most significant pharmacological interest. 29 , 30
While some evidence has shed light on the anti‐inflammatory properties of SBG and BS, almost nothing is known about their effects on fibrosis. Thus, the aim of this study was to investigate in vitro, in intestinal epithelial cells and fibroblasts, the anti‐inflammatory and anti‐fibrotic potential of SBG and BS, alone or in combination.
We show that SBG and BS extracts significantly reduce inflammation and impair fibrosis in intestinal epithelial cells and colon myofibroblasts. Possibly because of the strong effect displayed by each extract alone, no cooperative effect is observed. Due to the lack of adverse effects, we believe that SBG and BS extracts may represent very promising candidates for the management of intestinal inflammation and fibrosis.
2. MATERIALS AND METHODS
2.1. Plant extracts
The dried roots from SBG and the dried resin from BS were provided by Cadigroup Farmaceutici (Rome, Italy). Dry extracts were obtained by extraction and subsequent evaporation of plants cultivated in China and collected in 2018, according with Good Manufacturing Practice. In SBG extracts, baicalin content was certified as 90–95%, as assessed by HPLC. In BS extract, boswellic acid contents was 95%.
Dry extracts were weighted and dissolved in ethanol 85% at 1 mg/ml w/v (stock solution) under sterile conditions and stored at +4°C before using.
2.2. Cell lines
All cell lines were purchased from American Type Culture Collection (ATCC, Rockville, MA, USA).
Human colorectal adenocarcinoma cells, HT29, were cultured in McCOY's 5 A medium (Gibco, Life Technologies, Carlsbad, CA, USA), supplemented with 10% heat‐inactivated fetal bovine serum (FBS Eu Approved, Euroclone, Milan, Italy), 2 mM l‐Glutamine, 100 U/ml penicillin and 100 µg/ml streptomycin (Euroclone).
Human intestinal epithelial cells, HIEC6, were cultured in OPTIMEM (Gibco), supplemented with 4% heat‐inactivated FBS, 200 mM HEPES, 10 mM L‐Glutamine (Euroclone) and 10 ng/ml Epidermal Growth Factor (Gibco).
Human colon fibroblasts, CCD‐18Co, were grown in Minimum Essential Medium (MEM, Sigma) supplemented with 10% FBS, 1 mM Sodium Pyruvate, 2 mM l‐Glutamine and Penicillin‐Streptomycin.
2.3. Cell viability assay
Cell viability was assessed by MTT assay (Sigma‐Aldrich, Darmstadt, DE) (HT29 and HIEC6) or MTS assay (Promega, Madison, USA) (CCD‐18Co), preformed following manufacturers’ protocols. Briefly, 1.0 × 104 cells were seeded in a 96 multi‐well plate, and the following treatments were performed:
-
‐
HT29 were pretreated with SBG 10 μg/ml and BS 10 μg/ml, alone or in combination, in McCOY's 5 A medium complemented with 1% FBS for 24 h (h) and then exposed to 100 ng/ml TNF‐α (Peprotech, Cranbury, USA) and 5 ng/ml TGFβ1 (Abcam, Cambridge, UK) for 48 h;
-
‐
HIEC6 were pretreated with SBG 10 μg/ml and BS 10 μg/ml, alone or in combination, in OPTIMEM medium complemented with 1% FBS for 24 h and then exposed to 0.5 ng/ml IL‐1β, (Peprotech, Cranbury, USA) and 10 ng/ml TGFβ1 for 24 h;
-
‐
CCD18‐Co were pretreated with SBG 10 μg/ml and BS 10 μg/ml, in MEM medium complemented with 0,5% FBS for 24 h and then exposed to 10 ng/ml TGFβ1 for 24 h.
2.4. RT‐qPCR
Total RNA was isolated from cell using the mini RNeasy kit (Qiagen), and 1 μg of total RNA was reverse‐transcribed by IScriptTM cDNA Synthesis Kit (BioRad, Hercules). RT‐PCR amplifications were obtained by a BioRad CFX96 TouchTM Real‐Time PCR Detection System using SsoAdvanced Universal SYBR Green super Mix (BioRad). The following primers were used: ZNF281 (Zinc Finger Protein 281) fwd primer 5′‐GCCATCCTCTCCCCAAGTC‐3′, rev primer 5′‐GAGCTTCGGAAAGCAGCACTA‐3′; SNAIL (Snail Family Transcriptional Repressor 1) fwd primer 5′‐GACCACTATGCCGCGCTCTT‐3′; rev primer 5′‐TCGCTGTAGTTAGGCTTCCGATT‐3′; ACTA2 (Actin Alpha 2, Smooth Muscle) fwd primer 5′‐CCGACCGAATGCAGAAGGA‐3′; rev primer 5′‐ ACAGAGTATTTGCGCTCCGAA‐3′; IL‐8 (Interleukin‐8) fwd primer 5′‐CTGGCCGTGGCTCTCTTG‐3′, rev primer 5′‐CTTGGCAAAACTGCACCTTCA‐3′; IL1B (Interleukin‐1 beta) fwd primer: 5′‐AGACATCACCAAGCTTTTTTGCT‐3′, rev primer: 5′‐GCACGATGCACCTGTACGAT‐3′; TNFA (Tumor Necrosis Factor‐ Alpha) fwd primer 5′‐GGCAGTCAGATCATC‐3′; rev primer 5′‐GCTGCCCCTCAGCTT‐3′; FAP (Fibroblast Activation Protein Alpha) fwd primer 5′‐CCCACGCTCTGAAGACAGAA‐3′; rev primer 5′‐AGTTATGAACTCTTGAAGGGCGT‐3′; FN1 (Fibronectin 1) fwd primer 5′‐AGACCATACCTGCCGAATGTAG‐3′; rev primer 5′‐GAGAGCTTCCTGTCCTGTAGAG‐3′; GAPDH (Glyceraldehyde‐3‐Phosphate Dehydrogenase) fwd primer 5′‐GCACCGTCAAGGCTGAGAAC‐3′ and GAPDH rev primer 5′‐GAGGGATCTCGCTCCTGG‐3′. The expression level of each mRNA was assessed using 2−ΔΔCt method and GADPH was used as housekeeping gene for normalization.
2.5. Immunoblot analysis
Cell pellets from HT29, HIEC6 and CCD‐18Co pretreated with SBG and BS and exposed to pro‐inflammatory and/or pro‐fibrotic cytokines, as described above, were lysed in ice‐cold lysis buffer (50 mM Tris pH 7.4, 5 mM EDTA, 250 mM NaCl, 0.1% Triton X‐100, 1 mM phenylmethylsulfonyl fluoride, 5 mg/ml aprotinin, 5 mg/ml leupeptin, and 1 mM sodium orthovanadate). Ten μg of total proteins were analyzed by western blot using the following antibodies: Anti‐ZNF281 (Abcam, Cambridge, UK), anti‐SNAIL (Cell Signaling, Danvers, MA, USA), anti‐COL3A1 (ThermoFisherScientific, Waltham, MA USA), anti‐β‐actin (Sigma Aldrich), anti‐β‐tubulin (T7816, Sigma).
Culture medium (300 µl) from HT29, HIEC6 and CCD‐18Co was also collected and centrifuged at 2000 r.p.m. for 10 min. Then, supernatants were collected and analyzed by western blot using anti‐COL3A1 and anti‐COL1A1 antibodies (Cell Signaling, Danvers, MA, USA).
2.6. Enzyme‐Linked ImmunoSorbent assay (ELISA)
Quantification of human IL‐8, IL‐1β and TNF‐α released in culture medium was carried out by Immunoassay in solid phase ELISA (IL‐8/CXCL8 Quantikine ELISA Kit, IL‐1β/IL1F2 Quantikine ELISA Kit, TNF‐α Quantikine ELISA Kit, R&D System, Minneapolis, MN, USA), according to the manufacture instructions. Positive signals were measured spectrophotometrically at a wavelength of 450 nm by GloMax® Explorer Multimode Microplate Reader (Promega Italia S.r.l., Milan, Italy). IL‐8, IL‐1β and TNF‐α concentration was expressed as pg/ml.
2.7. Wound healing assay
HT29 and HIEC6 cells were cultured in 6‐well plated at a density of 4 × 105 cells/ml until confluence reached 90%. A straight‐line wound was made using a 10‐ul pipette tip. Cell debris were removed by a wash with PBS and cells were then maintained in a medium with a reduced percentage of FBS (1%). HT29 and HIEC6 cells were pretreated with SBG and BS, alone or in combination, then, exposed to to pro‐inflammatory and/or pro‐fibrotic cytokines as described above. Scratch wound closure was visualized under light microscope at day 0 and after 48 h and analyzed by Image J plugin Wound Healing tool. Results were reported as percentage of wound size relative to day 0.
2.8. Statistics
All experiments were repeated three times. Data were given as mean ± standard deviation (SD) or standard error mean (SEM). All statistical analyses were carried out using GraphPad Prism 6 software. Comparison among groups was performed using the one‐way ordinary ANOVA test with Welch's correction (significance taken as p < .05).
3. RESULTS
3.1. SBG and BS extracts significantly decrease pro‐inflammatory cytokine expression in HT29 and HIEC6 cells
To perform experiments, we selected HT29 cells with epithelial morphology; moreover, as a more physiological model to investigate effects of plant extracts on inflammation and on inflammation‐derived fibrosis, we also used the non‐tumorigenic intestinal epithelial cells HIEC6.
Firstly, we set up a protocol to induce an inflammatory‐driven fibrosis. 8 , 31 Intestinal epithelial cells were treated with the pro‐inflammatory cytokine TNF‐α and the pro‐fibrotic cytokine TGFβ1 for 48 h (HT29) or with IL‐1β and TGFβ1 for 24 h (HIEC6). As assessed by RT‐qPCR, treatments increased the expression levels of inflammatory (IL8, IL1B namely IL‐1β, TNFA namely TNF‐α), mesenchymal (ZNF281 and SNAIL), and fibrotic (ACTA2, also known as αSMA, α‐smooth muscle actin) markers in both cell lines (Figure 1).
Figure 1.

Co‐treatment with pro‐inflammatory and pro‐fibrotic cytokines induces an inflammatory‐driven fibrosis in intestinal epithelial cell lines. HT29 cells were treated with the pro‐inflammatory cytokine TNF‐α (100 ng/ml) and the pro‐fibrotic cytokine TGFβ1 (5 ng/ml) for 48 h (A). HIEC cells were treated with the pro‐inflammatory cytokine IL‐1β (0.5 ng/ml) and TGFβ1 (10 ng/ml) for 24 h (B). The expression of inflammatory (IL8, IL1B, and TNFA), mesenchymal (ZNF281 and SNAIL), and fibrotic (ACTA2) markers was assessed by RT‐qPCR. Data are expressed as mean ± SEM. * = p‐value ≤ .05; ** = p‐value ≤ .01 n = 3.
Then, cells were pretreated with vehicle (Et‐OH 85%), SBG and BS extracts for 24 h and exposed to TNF‐α and TGFβ1 (HT29) or to IL‐1β and TGFβ1 (HIEC6). First, we analyzed the impact of two different concentrations of SBG and BS extracts on cell viability. Results showed that extracts from both plants, alone or in combination, did not affect HT29 or HIEC6 cell viability after 48 h (HT29) or 24 h (HIEC6), while the higher concentration reduced cell viability after 72 h (HT29) or 48 h (HIEC6) (Figure 2).
Figure 2.

SBG and BS extracts do not affect viability of intestinal epithelial cells. HT29 cells were pretreated with vehicle (Et‐OH 85%) or with SBG (10 μg/ml) and/or BS (10 μg/ml) extracts for 24 h and then exposed to the pro‐inflammatory cytokine TNF‐α (100 ng/ml) and pro‐fibrotic cytokine TGFβ1(5 ng/ml) for 48 h (A). HIEC cells were pretreated with vehicle (Et‐OH 85%) or with SBG (10 μg/ml) and/or BS (10 μg/ml) extracts for 24 h and then exposed to the pro‐inflammatory cytokine IL‐1β (0.5 ng/ml) and pro‐fibrotic cytokine TGFβ1(10 ng/ml) for 24 h (B). Cell viability was assessed by MTT assay. Data are expressed as mean ± SEM. * = p‐value ≤ .05; *** = p‐value ≤ .001 n = 3.
Thus, we selected the lowest concentration for 48 h (HT29) and 24 h (HIEC6) for following experiments. Then, we analyzed the mRNA expression of pro‐inflammatory cytokines (IL8 and IL1B for HT29, IL8 and TNFA for HIEC6). The exposure to TNF‐α + TGFβ1 (HT29) or IL‐1β + TGFβ1 (HIEC6) upregulated the expression of pro‐inflammatory cytokines, however, it was significantly reduced by the treatment with SBG and BS extracts, alone or in combination (Figure 3A,B).
Figure 3.

SBG and BS extracts downregulate the expression and the secretion of pro‐inflammatory cytokines in intestinal epithelial cells. HT29 cells were pretreated with vehicle, SBG (10 μg/ml) and BS (10 μg/ml) extracts for 24 h and then exposed to TNF‐α (100 ng/ml) + TGFβ1(5 ng/ml) for 48 h. Expression of IL8 and IL1B was assessed by RT‐qPCR (A) Secretion of IL‐8 and IL‐1β (C) was assessed by ELISA. HIEC6 cells were pretreated with vehicle, SBG (10 μg/ml) and BS (10 μg/ml) extracts for 24 h and then exposed to IL‐1β (0.5 ng/ml) + TGFβ1(10 ng/ml) for 24 h (B). Expression of IL8 and TNFA was assessed by RT‐qPCR (B) Secretion of IL‐8 and TNF‐α was assessed by ELISA (D). Data are expressed as mean ± SEM. * = p‐value ≤ .05; ** = p‐value ≤ .01; *** = p‐value ≤ .001 n = 3.
Further, in HT29 and HIEC6 cells secretion of pro‐inflammatory cytokines upon inflammatory/fibrotic insult was significantly decreased by SBG and BS as well (Figure 3C,D).
3.2. SBG and BS extracts improve epithelial restitution during inflammation in HT29 and HIEC6 cells
To analyze the effect of SBG and BS on wound healing process after inflammatory/fibrotic injury, confluent HT29 cells were scratched with a 10 µl micropipette tip and the gap widths (1 mm at day 0) were measured after 48 h, when 50% physiological wound healing occurred in these cells.
Scratched cells were exposed to TNF‐α + TGFβ1 or pretreated with vehicle, SBG and BS extracts for 24 h and then exposed to TNF‐α + TGFβ1 for 48 h. Results showed that cells exposed to inflammatory/fibrotic agents showed a delay of healing of about 45% after 48 h as compared to control cells. However, pretreatment with SBG and/or BS significantly improved the rate of epithelial restitution, reaching values comparable to control. No cooperative effect between plant extracts was observed (Figure 4A,C).
Figure 4.

SBG and BS extracts improve epithelial restitution in intestinal epithelial cells exposed to inflammatory and fibrotic stimuli. Scratch test was performed in HT29 (A) and HIEC6 (B) cells pretreated with vehicle, SBG (10 μg/ml) and BS (10 μg/ml) extracts for 24 h and then exposed to TNF‐α (100 ng/ml) + TGFβ1(5 ng/ml) or to IL‐1β (0.5 ng/ml) + TGFβ1(10 ng/ml), respectively, for 48 h. Bar charts of cellular density of wounded area in HT29 (C) and HIEC6 (D) relative to T0 are depicted. Data are expressed as mean ± SD. * = p‐value ≤ .05; ** = p‐value ≤ .01; *** = p‐value ≤ .001 n = 3.
These data were validated in HIEC6 cells. Again, co‐treatment with SBG or BS significantly improved the rate of epithelial restitution and no cooperative effect was observed (Figure 4B,D).
3.3. Fibrotic marker expression is strongly reduced in intestinal epithelial cells exposed to SBG and BS extracts
Intestinal epithelial cells have been closely involved in fibrosis due to the occurrence of the epithelial‐to‐mesenchymal transition (EMT) process that is critical for cellular conversion from epithelial to mesenchymal phenotypes. Thus, HT29 and HIEC6 were pretreated with SBG and BS extracts for 24 h and then exposed to TNF‐α + TGFβ1 (HT29) or IL‐1β + TGFβ1 (HIEC6) for 24 and 48 h, respectively. To assess the putative role of plant extracts in controlling fibrosis, fibrotic markers including SNAIL, ACTA2, collagen type 3 alpha 1 chain (COL3A1) and ZNF281 were analyzed. Results showed that SNAIL, ACTA2 and ZNF281 mRNA expression, that was increased by the mix of inflammatory/fibrotic cytokines treatment, was significantly reduced in all cells after the treatment with SBG and BS extracts, alone or in combination (Figure 5A,B).
Figure 5.

Fibrotic marker mRNAs and proteins are significantly reduced by SBG and BS extracts in intestinal epithelial cells exposed to inflammatory and fibrotic stimuli. HT29 cells were pretreated with vehicle, SBG (10 μg/ml) and BS (10 μg/ml) extracts for 24 h and then exposed to TNF‐α (100 ng/ml) + TGFβ1(5 ng/ml) for 48 h. Expression of ZNF281, SNAIL and ACTA2 was assessed by RT‐qPCR (A). HIEC6 cells were pretreated with vehicle, SBG (10 μg/ml) and BS (10 μg/ml) extracts for 24 h and then exposed to IL‐1β (0.5 ng/ml) + TGFβ1(10 ng/ml) for 24 h. Expression of ZNF281, SNAIL and ACTA2 was assessed by RT‐qPCR (B). Data are expressed as mean ± SEM. * = p‐value ≤ .05; ** = p‐value ≤ .01; *** = p‐value ≤ .001 n = 3. ZNF281 and SNAIL protein expression was analyzed by western blot in cell lysates and COL3A1 secretion in cell supernatant (C, D).
Accordingly, protein expression of SNAIL, and ZNF81 was importantly decreased, while the co‐exposure did not show further effect. Similarly, the amount of secreted COL3A1, analyzed in cell supernatants, was significantly reduced by the pretreatment with SBG and BS extracts (Figure 5C,D).
3.4. Fibrosis is toughly reduced in colon myofibroblasts exposed to SBG and BS extracts
Myofibroblasts, belonging to the mesenchymal repertoire, are the major cell type involved in fibrogenesis due to their ability in secreting extracellular matrix (ECM) components. Thus, colonic myofibroblasts CCD‐18Co were used to strengthen previous results. Hence, cells were pretreated with SBG or BS extracts for 24 h and then exposed to the pro‐fibrotic cytokine TGFβ1 for 24 h. As in epithelial cells, the exposure to plant extracts, at the same concentration as before, did not affect cell viability of myofibroblasts (Figure 6A). Analysis of mRNA expression of the fibrotic markers SNAIL, ACTA2, Fibroblast activation protein (FAP), Fibronectin (FN1) and ZNF281, known to be upregulated during fibrosis in colon fibroblasts, 32 showed a significant decrease after the exposure to SBG or BS extracts (Figure 6B).
Figure 6.

Fibrotic markers are reduced by SBG and BS extracts in intestinal fibroblasts exposed to fibrotic stimulus. CCD18‐Co cells were pretreated with SBG (10 μg/ml) and BS (10 μg/ml) for 24 h and then exposed to 10 ng/ml TGFβ1 for 24 h. Cell viability was assessed by MTS assay (A). Expression of ZNF281, SNAIL, ACTA2, FAP and FN1 was assessed by RT‐qPCR (B). Data are expressed as mean ± SEM. * = p‐value ≤ .05; ** = p‐value ≤ .01; *** = p‐value ≤ .001 n = 4. CCD18‐Co were pretreated with SBG (10 μg/ml) and BS (10 μg/ml) for 24 h and then exposed to 10 ng/ml TGFβ1 for 24 h. COL1A1 secretion was analyzed in cell supernatants by western blot and normalized on total secreted proteins. Densitometric analysis was performed (C). * = p‐value ≤ .05; n = 3.
Likewise, the secreted COL1A1 returned to control value following the extract exposure (Figure 6C).
4. DISCUSSION
According to recent evidence, the use of natural compounds as alternative therapies in chronic inflammatory autoimmune diseases, has emerged as a promising approach in gastrointestinal diseases. 33 Currently, the consumption of complementary and alternative medicines, such as the herbal therapy, is becoming more popular among IBD patients. 34 , 35 , 36 , 37 , 38 In this study, we demonstrate the anti‐inflammatory and anti‐fibrotic effects of SBG and BS on human intestinal cells, suggesting that these promising herbal drugs deserve be considered for IBD management in the future.
First, the anti‐inflammatory properties of SBG and BS extracts were analyzed. We used intestinal epithelial cells that were previously exposed to plant extracts followed by inflammatory/fibrotic agent treatment. After 24–48 h, we observed a significant reduction of pro‐inflammatory cytokine levels in cells treated with SBG or BS. No synergistic effect was seen, probably due to the strong effect of each extract alone. Moreover, much evidence supports the view that the maintenance of a healthy intestinal barrier is of crucial importance, indeed, gastrointestinal disorders, including IBD, are often strictly correlated with barrier dysfunctions. 39 , 40 The loss of barrier integrity is normally restored through wound healing, a highly complex and coordinated process resulting in tissue restitution. When inflamed, cells undergo a delay in healing. Interestingly, in this study, intestinal epithelial cells pretreated with SBG or BS extracts significantly improved tissue repair as compared to the positive control. Again, no cooperative effect between SBG and BS extracts was observed.
All these results highlight an evident role of plant extracts in reducing intestinal inflammation. This evidence is in agreement with previous studies showing that SBG and BS extracts show anti‐inflammatory effects and attenuate tissue damage in mice with experimental colitis. 41 , 42 , 43 , 44 , 45 , 46
Developing antifibrotics from natural products may represent a remarkable strategy because it reduces the occurrence of adverse collateral effects due to toxicity and improves the safety profile, while maintaining the therapeutic effectiveness, as previously shown in the context of hepatic and pulmonary fibrosis. 47 , 48
Previously, the study of Latella et al. suggested that the administration of SBG and BS was effective in preventing colon fibrosis in rats with a TNBS‐induced colitis. 49 However, results are still insufficient and further evidence is mandatory to consider these compounds represent reliable tools for the prevention and/or resolution of fibrosis.
First, we used intestinal epithelial cells for experimentation since it is known that during fibrosis they may undergo to the EMT process changing phenotype with loss of epithelial features and acquisition of mesenchymal characteristics and contributing to the ECM deposition. 50 Previous literature showed that damaged epithelial cells may act as crucial sources of fibroblasts contributing to organ fibrosis through EMT in IBD. 51 Accordingly, our results showed that in both cell lines, in which fibrosis was induced, as evidenced by the increased levels of fibrotic markers, the treatment with plant extracts caused a significant drop of the expression of the fibrotic markers αSMA and SNAIL, as well as a decrease of COL3A1 release. We also analyzed the expression level of ZNF281, a protein traditionally characterized as an EMT‐inducing transcription factor, but that we have recently found to play a role in gut fibrosis as a novel regulator of colon fibroblast activation and myofibroblast differentiation. 32 Accordingly, ZNF281 was increased during fibrosis and was strongly reduced by the plant extract exposure as well.
We then analyzed the putative antifibrotic effect of SBG and BS in myofibroblasts from colonic mucosa (CCD‐18Co). Indeed, in the process of intestinal fibrosis, myofibroblasts are considered the pivotal effectors as appropriately programmed to secrete excessive amount of ECM components. Accordingly, in IBD patients, stromal cells, including pre‐existing myofibroblasts activated by inflammatory stimulants proliferate as a response to inflammation. 52 CCD‐18Co cells were pretreated with SBG and BS extracts and induced to develop fibrosis. We observed that myofibroblasts significantly increased the expression levels of fibrotic markers, SNAIL, αSMA, FAP, FN1 and ZNF281, that were likewise downregulated by the exposure to SBG or BS extracts. Moreover, the level of secreted COLA1 was also significantly reduced.
All these findings clearly demonstrate that SBG or BS extracts show anti‐fibrotic properties in different intestinal cell types. It is worth noting that SBG and BS are very effective in impairing fibrosis when administered alone, however, the combination of both has no further effect and no synergism has been revealed.
IBD causes relapsing gut inflammation with the common occurrence of serious complications, especially fibrosis, that result in a severe loss of patients’ quality of life. To introduce a new generation of treating regimen for managing inflammation and inflammatory‐derived fibrosis in IBD with fewer critical side effects, we have explored promising candidates from natural resources. This study shows that SBG and BS extracts significantly reduce inflammation in intestinal epithelial cells. More interestingly, they also display an evident anti‐fibrotic effect in both intestinal epithelial cells and myofibroblasts. Although actually based on in vitro models, this findings are particularly relevant since there are still very limited treatment options available for managing gut fibrosis. This limitation will be addressed in future research that will include in vivo models. Long‐term studies are necessary before SBG and BS can be translated from bench to bedside, however, we believe that this study will greatly contribute to elucidate the therapeutic potential of SBG to BS in IBD.
AUTHOR CONTRIBUTIONS
Ilaria Laudadio: Conceptualization; Investigation; Supervision; Writing—original draft; Writing—review and editing. Beatrice Leter: Investigation. Francesca Palone: Investigation. Salvatore Cucchiara: Data curation. Claudia Carissimi: Validation. Noemi Scafa: Validation. Daniela Secci: Methodology. Roberta Vitali: Methodology. Laura Stronati: Conceptualization; Funding acquisition; Supervision; Writing—original draft; Writing—review and editing.
CONFLICT OF INTEREST STATEMENT
The authors declare no conflicts of interest.
ACKNOWLEDGMENTS
This research was partially supported by Cadigroup Farmaceutici (Italy); in particular, we thank Dr. A. Caramelli and Dr. E. Covini who greatly assisted the research. Open access publishing facilitated by Universita degli Studi di Roma La Sapienza, as part of the Wiley ‐ CRUI‐CARE agreement.
Laudadio I, Leter B, Palone F, et al. Inhibition of intestinal inflammation and fibrosis by Scutellaria Baicalensis georgi and Boswellia serrata in human epithelial cells and fibroblasts. Immun Inflamm Dis. 2024;12:e70036. 10.1002/iid3.70036
Ilaria Laudadio and Beatrice Leter contributed equally to the work.
DATA AVAILABILITY STATEMENT
The data that support the findings of this study are available from the corresponding author upon reasonable request.
REFERENCES
- 1. Kofla‐Dłubacz A, Pytrus T, Akutko K, Sputa‐Grzegrzółka P, Piotrowska A, Dzięgiel P. Etiology of IBD—Is it still a mystery. Int J Mol Sci. 2022;23:12445. 10.3390/ijms232012445 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2. D'Alessio S, Ungaro F, Noviello D, Lovisa S, Peyrin‐Biroulet L, Danese S. Revisiting fibrosis in inflammatory bowel disease: the gut thickens. Nat Rev Gastroenterol Hepatol. 2022;19:169‐184. 10.1038/s41575-021-00543-0 [DOI] [PubMed] [Google Scholar]
- 3. Yoo JH, Holubar S, Rieder F. Fibrostenotic strictures in crohn's disease. Intest Res. 2020;18:379‐401. 10.5217/ir.2019.09148 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4. Solitano V, Dal Buono A, Gabbiadini R, et al. Fibro‐Stenosing crohn's disease: what is new and what is next? J Clin Med. 2023;12:3052. 10.3390/jcm12093052 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5. Bamias G, Pizarro TT, Cominelli F. Immunological regulation of intestinal fibrosis in inflammatory bowel disease. Inflamm Bowel Dis. 2022;28:337‐349. 10.1093/ibd/izab251 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. de Bruyn JR, Meijer SL, Wildenberg ME, Bemelman WA, van den Brink GR, D'Haens GR. Development of fibrosis in acute and longstanding ulcerative colitis. J Crohn's Colitis. 2015;9:966‐972. 10.1093/ecco-jcc/jjv133 [DOI] [PubMed] [Google Scholar]
- 7. Rimola J, Capozzi N. Differentiation of fibrotic and inflammatory component of crohn's disease‐associated strictures. Intest Res. 2020;18:144‐150. 10.5217/ir.2020.00015 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Lenti MV, Santacroce G, Broglio G, Rossi CM, Di Sabatino A. Recent advances in intestinal fibrosis. Mol Aspects Med. 2024;96:101251. 10.1016/j.mam.2024.101251 [DOI] [PubMed] [Google Scholar]
- 9. Li S, Zhang F, Zhang Q. Pathological features‐based targeted delivery strategies in IBD therapy: a mini review. Biomed Pharmacother. 2022;151:113079. 10.1016/j.biopha.2022.113079 [DOI] [PubMed] [Google Scholar]
- 10. Mao R, Hu P‐J. The future of IBD therapy: where are we and where should we go next. Dig Dis. 2016;34:175‐179. 10.1159/000443135 [DOI] [PubMed] [Google Scholar]
- 11. Wang Y, Huang B, Jin T, Ocansey DKW, Jiang J, Mao F. Intestinal fibrosis in inflammatory bowel disease and the prospects of mesenchymal stem cell therapy. Front Immunol. 2022;13:835005. 10.3389/fimmu.2022.835005 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Wang J, Lin S, Brown JM, van Wagoner D, Fiocchi C, Rieder F. Novel mechanisms and clinical trial endpoints in intestinal fibrosis. Immunol Rev. 2021;302:211‐227. 10.1111/imr.12974 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Andoh A, Nishida A. Molecular basis of intestinal fibrosis in inflammatory bowel disease. Inflamm Intest Dis. 2023;7:119‐127. 10.1159/000528312 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Santacroce G, Lenti MV, Di Sabatino A. Therapeutic targeting of intestinal fibrosis in crohn's disease. Cells. 2022;11:429. 10.3390/cells11030429 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Argollo M, Gilardi D, Roda G, Fiorino G, Peyrin‐Biroulet L, Danese S. Anti‐fibrotic drugs for crohn's disease: ready for prime time. Curr Pharm Des. 2019;25:47‐56. 10.2174/1381612825666190308100844 [DOI] [PubMed] [Google Scholar]
- 16. El Menyiy N, El Allam A, Aboulaghras S, et al. Inflammatory auto‐immune diseases of the intestine and their management by natural bioactive compounds. Biomed Pharmacother. 2022;151:113158. 10.1016/j.biopha.2022.113158 [DOI] [PubMed] [Google Scholar]
- 17. Li W, Xiang Z, Yu W, et al. Natural compounds and mesenchymal stem cells: implications for inflammatory‐impaired tissue regeneration. Stem Cell Res Ther. 2024;15:34. 10.1186/s13287-024-03641-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Jang JY, Im E, Kim ND. Therapeutic potential of bioactive components from scutellaria baicalensis georgi in inflammatory bowel disease and colorectal cancer: A review. Int J Mol Sci. 2023;24:1954. 10.3390/ijms24031954 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. Fu Y, Xu B, Huang S, et al. Baicalin prevents LPS‐induced activation of TLR4/NF‐κB p65 pathway and inflammation in mice via inhibiting the expression of CD14. Acta Pharmacol Sin. 2021;42:88‐96. 10.1038/s41401-020-0411-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20. Liao H, Ye J, Gao L, Liu Y. The main bioactive compounds of scutellaria baicalensis georgi. for alleviation of inflammatory cytokines: a comprehensive review. Biomed Pharmacother. 2021;133:110917. 10.1016/j.biopha.2020.110917 [DOI] [PubMed] [Google Scholar]
- 21. Roy NK, Parama D, Banik K, et al. An update on pharmacological potential of boswellic acids against chronic diseases. Int J Mol Sci. 2019;20:4101. 10.3390/ijms20174101 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Duan C, Matsumura S, Kariya N, Nishimura M, Shimono T. In vitro antibacterial activities of scutellaria baicalensis georgi against cariogenic bacterial. Pediatric Dental Journal. 2007;17:58‐64. 10.1016/S0917-2394(07)70096-4 [DOI] [Google Scholar]
- 23. Gao Z, Huang K, Xu H. Protective effects of flavonoids in the roots of scutellaria baicalensis georgi against hydrogen peroxide‐induced oxidative stress in HS‐SY5Y cells. Pharmacol Res. 2001;43:173‐178. 10.1006/phrs.2000.0761 [DOI] [PubMed] [Google Scholar]
- 24. Dou J, Wang Z, Ma L, et al. Baicalein and baicalin inhibit colon cancer using two distinct fashions of apoptosis and senescence. Oncotarget. 2018;9:20089‐20102. 10.18632/oncotarget.24015 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25. Han C, Xing G, Zhang M, et al. Wogonoside inhibits cell growth and induces mitochondrial‐mediated autophagy‐related apoptosis in human colon cancer cells through the PI3K/AKT/mTOR/p70S6K signaling pathway. Oncol Lett. 2018;15:4463‐4470. 10.3892/ol.2018.7852 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26. Wang J, Chen S, Zhang J, Wu J. Scutellaria baicalensis georgi is a promising candidate for the treatment of autoimmune diseases. Front Pharmacol. 2022;13:946030. 10.3389/fphar.2022.946030 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27. Kunnumakkara AB, Banik K, Bordoloi D, et al. Googling the guggul (Commiphora and Boswellia) for prevention of chronic diseases. Front Pharmacol. 2018;9:686. 10.3389/fphar.2018.00686 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Solanki N, Gupta G, Chellappan DK, et al. Boswellic acids: a critical appraisal of their therapeutic and nutritional benefits in chronic inflammatory diseases. Endocr Metab Immune Disorders ‐ Drug Targets. 2024;24:116‐129. 10.2174/1871530323666230512154634 [DOI] [PubMed] [Google Scholar]
- 29. Rajabian A, Farzanehfar M, Hosseini H, Arab FL, Nikkhah A. Boswellic acids as promising agents for the management of brain diseases. Life Sci. 2023;312:121196. 10.1016/j.lfs.2022.121196 [DOI] [PubMed] [Google Scholar]
- 30. Roy NK, Deka A, Bordoloi D, et al. The potential role of boswellic acids in cancer prevention and treatment. Cancer Lett. 2016;377:74‐86. 10.1016/j.canlet.2016.04.017 [DOI] [PubMed] [Google Scholar]
- 31. Rodansky ES, Johnson LA, Huang S, Spence JR, Higgins PDR. Intestinal organoids: A model of intestinal fibrosis for evaluating anti‐fibrotic drugs. Exp Mol Pathol. 2015;98:346‐351. 10.1016/j.yexmp.2015.03.033 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32. Laudadio I, Bastianelli A, Fulci V, et al. ZNF281 promotes colon fibroblast activation in TGFβ1‐Induced gut fibrosis. Int J Mol Sci. 2022;23:10261. 10.3390/ijms231810261 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.<Inflammatory auto‐immune diseases of the intestine and their management by natural bioactive compounds ‐ ScienceDirect, https://www.sciencedirect.com/science/article/pii/S0753332222005479?via%3Dihub#bib11. (accessed September 3, 2024) (n.d.). [DOI] [PubMed]
- 34. Chang Y, Zhai L, Peng J, Wu H, Bian Z, Xiao H. Phytochemicals as regulators of Th17/Treg balance in inflammatory bowel diseases. Biomed Pharmacother. 2021;141:111931. 10.1016/j.biopha.2021.111931 [DOI] [PubMed] [Google Scholar]
- 35. Dejban P, Nikravangolsefid N, Chamanara M, Dehpour A, Rashidian A. The role of medicinal products in the treatment of inflammatory bowel diseases (IBD) through inhibition of TLR4/NF‐kappaB pathway. Phytother Res. 2021;35:835‐845. 10.1002/ptr.6866 [DOI] [PubMed] [Google Scholar]
- 36. Torres J, Ellul P, Langhorst J, et al. European crohn's and colitis organisation topical review on complementary Medicine and psychotherapy in inflammatory bowel disease. J Crohn's Colitis. 2019;13:673‐685e. 10.1093/ecco-jcc/jjz051 [DOI] [PubMed] [Google Scholar]
- 37. Ganji‐Arjenaki M, Rafieian‐Kopaei M. Phytotherapies in inflammatory bowel disease. J Res Med Sci. 2019;24:42. 10.4103/jrms.JRMS_590_17 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38. Zhu M, Yang M, Song Y, et al. Exploring the efficacy of herbal medicinal products as oral therapy for inflammatory bowel disease. Biomed Pharmacother. 2023;165:115266. 10.1016/j.biopha.2023.115266 [DOI] [PubMed] [Google Scholar]
- 39. Santilli A, Stefanopoulos S, Cresci GAM. The gut barrier and chronic diseases. Curr Opin Clin Nutr Metab Care. 2022;25:178‐185. 10.1097/MCO.0000000000000820 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40. Stolfi C, Maresca C, Monteleone G, Laudisi F. Implication of intestinal barrier dysfunction in gut dysbiosis and diseases. Biomedicines. 2022;10:289. 10.3390/biomedicines10020289 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41. Cui L, Guan X, Ding W, et al. Scutellaria baicalensis georgi polysaccharide ameliorates DSS‐induced ulcerative colitis by improving intestinal barrier function and modulating gut microbiota. Int J Biiol Macromol. 2021;166:1035‐1045. 10.1016/j.ijbiomac.2020.10.259 [DOI] [PubMed] [Google Scholar]
- 42. Zhong X, Surh Y‐J, Do S‐G, et al. Baicalein inhibits dextran sulfate sodium‐induced mouse colitis. J Cancer Prev. 2019;24:129‐138. 10.15430/JCP.2019.24.2.129 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43. Chou Y‐C, Suh JH, Wang Y, et al. Boswellia Serrata resin extract alleviates azoxymethane (AOM)/dextran sodium sulfate (DSS)‐induced colon tumorigenesis. Mol Nutr Food Res. 2017;61:1600984. 10.1002/mnfr.201600984 [DOI] [PubMed] [Google Scholar]
- 44. Luo X, Yu Z, Deng C, et al. Baicalein ameliorates TNBS‐induced colitis by suppressing TLR4/MyD88 signaling cascade and NLRP3 inflammasome activation in mice. Sci Rep. 2017;7:16374. 10.1038/s41598-017-12562-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45. Cui L, Wang W, Luo Y, et al. Polysaccharide from scutellaria baicalensis georgi ameliorates colitis via suppressing NF‐κB signaling and NLRP3 inflammasome activation. Int J Biiol Macromol. 2019;132:393‐405. 10.1016/j.ijbiomac.2019.03.230 [DOI] [PubMed] [Google Scholar]
- 46. Liu C, Li Y, Chen Y, et al. Baicalein restores the balance of Th17/Treg cells via aryl hydrocarbon receptor to attenuate colitis. Mediators Inflamm. 2020;2020:e5918587. 10.1155/2020/5918587 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47. Deng J, Liu J, Chen W, Liang Q, He Y, Sun G. Effects of natural products through inhibiting endoplasmic reticulum stress on attenuation of idiopathic pulmonary fibrosis. DDDT. 2024;18:1627‐1650. 10.2147/DDDT.S388920 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48. Wenbo Z, Jianwei H, Hua L, Lei T, Guijuan C, Mengfei T. The potential of flavonoids in hepatic fibrosis: a comprehensive review. Phytomedicine. 2024;133:155932. 10.1016/j.phymed.2024.155932 [DOI] [PubMed] [Google Scholar]
- 49. Latella G, Sferra R, Vetuschi A, et al. Prevention of colonic fibrosis by boswellia and scutellaria extracts in rats with colitis induced by 2,4,5‐trinitrobenzene sulphonic acid. Eur J Clin Investig. 2008;38:410‐420. 10.1111/j.1365-2362.2008.01955.x [DOI] [PubMed] [Google Scholar]
- 50. Lovisa S, Genovese G, Danese S. Role of Epithelial‐to‐Mesenchymal transition in inflammatory bowel disease. J Crohn's Colitis. 2019;13:659‐668. 10.1093/ecco-jcc/jjy201 [DOI] [PubMed] [Google Scholar]
- 51. Macias‐Ceja DC, Mendoza‐Ballesteros MT, Ortega‐Albiach M, Barrachina MD, Ortiz‐Masià D. Role of the epithelial barrier in intestinal fibrosis associated with inflammatory bowel disease: relevance of the epithelial‐to mesenchymal transition. Front Cell Dev Biol. 2023;11:1258843. 10.3389/fcell.2023.1258843 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52. Andoh A, Fujino S, Okuno T, Fujiyama Y, Bamba T. Intestinal subepithelial myofibroblasts in inflammatory bowel diseases. J Gastroenterol. 2002;37(suppl 14):33‐37. 10.1007/BF03326410 [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The data that support the findings of this study are available from the corresponding author upon reasonable request.
