Summary
Genome-wide association study loci likely influence disease risk through cis-regulation of nearby genes. We present a protocol for measuring the cis-regulatory activity of risk variants on specific gene promoters in human primary astrocytes using luciferase reporter assays. We describe steps for transfection, conducting the assay, and data analysis. The transfection could be adapted to enable validation of putative risk variants in any cell type.
For complete details on the use and execution of this protocol, please refer to Littleton et al.1
Subject areas: Cell culture, Genetics, Genomics, Molecular Biology, Neuroscience
Graphical abstract

Highlights
-
•
Strategy to generate reporter vectors to test regulatory activity of GWAS variants
-
•
Protocol to transfect human primary astrocytes
-
•
Guidance for collecting and analyzing dual-luciferase reporter assay data
Publisher’s note: Undertaking any experimental protocol requires adherence to local institutional guidelines for laboratory safety and ethics.
Genome-wide association study loci likely influence disease risk through cis-regulation of nearby genes. We present a protocol for measuring the cis-regulatory activity of risk variants on specific gene promoters in human primary astrocytes using luciferase reporter assays. We describe steps for transfection, conducting the assay, and data analysis. The transfection could be adapted to enable validation of putative risk variants in any cell type.
Before you begin
Luciferase reporter assays can be used to characterize cis-regulatory activity of non-coding DNA sequences. A putative cis-regulatory element (cRE) sequence can be cloned into a vector containing promoter and luciferase coding sequences. This promoter can be generic (e.g., SV40) or a promoter of interest to test specific cRE-promoter interactions. This vector can be transfected into an in vitro cell model and then cell lysates can be used for quantifying luciferase luminescence as a measure of gene expression. Here, we describe the use of a dual-luciferase reporter system, where firefly (Photinus pyralis) luciferase is a reporter for experimental vectors and sea pansy (Renilla reniformis) luciferase is an internal control.
Most variants identified by genome-wide association studies (GWAS) are non-coding. Therefore, their molecular mechanism is not obvious. However, these non-coding variants likely contribute to disease risk by functioning within cREs to regulate expression of nearby genes. The non-coding sequence to be tested for cis-regulatory activity can be chosen through a variety of ways. If the GWAS risk variant resides within a peak of open chromatin determined by ATAC-seq from the cell type that will be transfected, the sequence coordinates of this peak can be used. Alternatively, you can determine if the GWAS risk variant resides within an annotated putative regulatory element in publicly available data such as the ENCODE consortium’s ‘Registry of candidate cis-Regulatory Elements’.2 In our example, rs7132908 was within a cell type-agnostic regulatory element with a distal enhancer-like signature at chr12:50,262,620–50,263,581 (GRCh37) in version 1 of the registry.1,2
Most cis-regulatory interactions occur within a topologically associating domain (TAD) but TADs typically harbor multiple genes. It is not always feasible to study many cRE-promoter interactions due to the time and effort required for cloning. It is therefore useful to prioritize a shortlist of genes to study with a reporter assay. This can be accomplished through colocalization analysis with expression quantitative trait loci (eQTL) data to identify genes likely regulated by the GWAS risk variant in relevant tissues. Additionally, chromosome conformation capture-based methods can be used to identify promoters in close proximity to the GWAS variant in a relevant cell model, suggesting a possible regulatory relationship.
In this protocol, we describe methods to study the cis-regulatory activity of an obesity-associated GWAS locus with a specific promoter of interest in human primary astrocytes. We utilized a dual-luciferase reporter system where unmodified or modified pGL4.10[luc2] firefly luciferase vectors were co-transfected with the pRL-TK sea pansy luciferase vector at a ratio of 10:1, which can be optimized, if needed. The sea pansy luciferase vector is provided at a lower amount to prevent trans effects between promoters on co-transfected vectors. This method could be used to study any non-coding GWAS variant and in any cell model that can reliably tolerate transfection, which we have previously :described in greater detail.3 We have also performed this protocol using a modified transfection protocol and HEK293Ts, which is described in Littleton et al.1 We used Lipofectamine LTX for lipid-mediated transfection, but other methods of transfection could be used after optimization. For a full description of our transfection optimization experiment, please refer to Littleton et al.1 We recommend testing a range of transfection conditions using a vector encoding a fluorescent reporter protein and with a size comparable to the vectors that will be used for the luciferase assay.
-
1.
Identify putative cRE harboring a GWAS risk variant.
-
2.
Identify promoter(s) of interest.
-
3.Prepare glycerol stocks of E. coli containing pGL4.10[luc2] firefly luciferase or pRL-TK sea pansy luciferase reporter vectors.
-
a.Transform vectors into NEB Stable Competent E. coli (High Efficiency) following manufacturer’s instructions (https://www.neb.com/en-gb/protocols/2013/10/30/high-efficiency-transformation-protocol-c3040h) and plate on Lysogeny Broth (LB) agar plates with 100 μg/mL ampicillin.
-
b.Incubate at 37°C for 14–18 h.
-
c.Select individual colonies and expand in 5 mL LB broth with 100 μg/mL ampicillin at 30°C with shaking at 250 rpm for 14–18 h.
-
d.After expansion, prepare glycerol stocks by combining 500 μL bacterial culture and 500 μL 80% glycerol in a cryovial. Pipette to mix well and store at −80°C.
-
a.
CRITICAL: Use Sanger or commercial nanopore (e.g. whole plasmid sequencing by Plasmidsaurus) sequencing to verify vector sequences.
-
4.Clone putative cRE and promoter sequences into pGL4.10[luc2] reporter vector at the multiple cloning site upstream of the luciferase coding sequence to generate pGL4.10[luc2]+promoter, pGL4.10[luc2]+non-risk+promoter, and pGL4.10[luc2]+risk+promoter vectors (Figures 1A–1C).Note: Sub-steps below are for using the Gibson assembly cloning method but other cloning methods can also be used. We used PCR amplification to generate our fragments with NEBNext High-Fidelity 2X PCR Master Mix (https://www.neb.com/en-gb/protocols/2012/08/29/pcr-using-nebnext-high-fidelity-2x-pcr-master-mix-m0541) and cleaned up the PCR products using gel extraction with the NEB Monarch DNA Gel Extraction kit (https://www.neb.com/en-gb/protocols/2015/11/23/monarch-dna-gel-extraction-kit-protocol-t1020). For Gibson assembly, we used the Codex Gibson Assembly HiFi HC 1-Step kit (https://uk.vwr.com/assetsvc/asset/en_GB/id/18667554/contents/ga_hifi_detailed_manual.pdf). For further details, please refer to Littleton et al.1
-
a.Prepare cRE fragment with upstream overlap with pGL4.10[luc2] and downstream overlap with promoter of interest by PCR amplification or synthesis (Figure 1A).Note: If PCR amplification from a genomic DNA template is used, it’s likely that the GWAS variant’s allele with the highest frequency will be in the fragment. Sub-step l describes the process of introducing the other allele. If synthesis is used, two versions of the fragment can be produced so one contains the non-risk allele and the other contains the risk allele, in which case sub-step l can be ignored.
-
b.Prepare promoter fragment with downstream overlap with pGL4.10[luc2] by PCR amplification or synthesis (Figure 1A).
-
c.Prepare promoter fragment with upstream overlap with pGL4.10[luc2] and downstream overlap with pGL4.10[luc2] by PCR amplification or synthesis (Figure 1B).Note: If PCR amplification is challenging using a genomic DNA template, you can purchase a pre-existing promoter vector (e.g. FAIM2 promoter clone in pEZX-PG02 reporter vector sold by GeneCopoeia or a similar manufacturer) and use this vector as a template.
-
d.Digest pGL4.10[luc2] reporter vector with XhoI restriction enzyme following manufacturer’s instructions (https://nebcloner.neb.com/#!/protocol/re/single/XhoI).
- e.
-
f.Transform vectors into NEB Stable Competent E. coli (High Efficiency) following manufacturer’s instructions (same as step 3a) and plate on LB agar plates with 100 μg/mL ampicillin.
-
g.Incubate at 37°C for 14–18 h.
-
h.Select individual colonies and expand in 5 mL LB broth with 100 μg/mL ampicillin at 30°C with shaking at 250 rpm for 14–18 h (troubleshooting 1).
-
i.After expansion, prepare glycerol stocks by combining 500 μL bacterial culture and 500 μL 80% glycerol in a cryovial. Pipette to mix well and store at −80°C.
-
j.Use the rest of the bacterial culture to extract vector DNA for sequence verification using the QIAGEN QIAprep Spin Miniprep kit following manufacturer’s instructions (https://www.qiagen.com/us/Resources/ResourceDetail?id=22df6325-9579-4aa0-819c-788f73d81a09&lang=en).
-
k.Sanger sequence DNA using primers that cover both the forward and reverse strands throughout the cRE and promoter region and identify vectors with correct sequences. Discard all glycerol stocks containing vectors that failed sequence verification (troubleshooting 1).
-
l.If vectors containing the cRE fragment only represent one GWAS variant allele, perform site-directed mutagenesis using the NEB Q5 Site-Directed Mutagenesis kit to introduce the other allele following manufacturer’s instructions (https://www.neb.com/en-gb/protocols/2013/01/26/q5-site-directed-mutagenesis-kit-protocol-e0554) and validate with Sanger sequencing (Figure 1C).
CRITICAL: It is important that the sequences of the cRE and promoter vectors only differ at the GWAS variant. Any other mutation in the cRE or promoter sequences would confound the experiment.
-
a.
-
5.Prepare endotoxin-free vector DNA for all experimental and control vectors.
-
a.Take a small sample of each glycerol stock and expand in 250 mL LB broth with 100 μg/mL ampicillin at 30°C with shaking at 250 rpm for 14–18 h.
-
b.After expansion, use the bacterial culture to extract vector DNA using the QIAGEN EndoFree Plasmid Maxi Kit following manufacturer’s instructions (https://www.qiagen.com/us/resources/download.aspx?id=a48e64ab-27cf-4576-bb93-98bbd0e1229e&lang=en).
-
a.
Optional: Optimize the transfection to define optimal doses of vector DNA, Lipofectamine LTX, and PLUS Reagent.
CRITICAL: Test the cell line to ensure it is free of mycoplasma contamination using the Sigma-Aldrich LookOut Mycoplasma PCR Detection Kit following manufacturer’s instructions (https://www.sigmaaldrich.com/deepweb/assets/sigmaaldrich/product/documents/213/434/mp0035bul.pdf).
Figure 1.
Cloning of vectors for luciferase assay
(A) Schematic of Gibson assembly where PCR fragments containing the cRE and promoter sequences and a digested luciferase reporter vector assemble due to overlapping sequences. The allele with highest frequency (red) at the GWAS variant of interest will likely be represented in the cRE.
(B) Schematic of Gibson assembly where a PCR fragment containing the promoter sequence and a digested luciferase reporter vector assemble due to overlapping sequences.
(C) Schematic of site-directed mutagenesis where the vector generated in panel A is modified to contain the less frequent allele (green) at the GWAS variant of interest.
Institutional permissions
All experimental procedures require compliance to the safety guidelines of the institution or laboratory. Most cell culture labs should be at least rated as Biosafety Level 2, but the exact requirements depend on the cell line used and type of work conducted.4
Astrocyte growth media preparation
Timing: 15 min
-
6.
Thaw AGM Astrocyte Growth Medium SingleQuots Supplements and Growth Factors at 4°C for 14–18 h or briefly at 20°C–25°C.
Note: Thawed supplements can be stored at 4°C for up to 3 days.
-
7.
Decontaminate the external surfaces of the ABM Basal Medium and all individual supplement vials with 70% ethanol.
CRITICAL: Perform the following steps in a cell culture hood with proper aseptic technique to prevent contamination.
-
8.
Add the contents of each supplement vial to the ABM Basal Medium and rinse each vial with medium to recover the entire volume, if possible.
Note: Small losses, even up to 10%, should not affect the cell growth characteristics of the supplemented medium.
-
9.
Transfer the label provided with the supplements kit to the ABM Basal Medium bottle and label with your initials, the date and expiration date (one month from date completed).
-
10.
Store media at 4°C.
Human primary astrocyte thawing
Timing: 45 min
-
11.
Decontaminate the external surfaces of the astrocyte growth media bottle and a sterile bag containing at least two 75 cm2 flasks with 70% ethanol.
CRITICAL: Perform the following two steps in a cell culture hood with proper aseptic technique to prevent contamination.
-
12.
Remove two 75 cm2 flasks from the bag.
-
13.
Add 15 mL astrocyte growth media to each flask and incubate in a humidified incubator at 37°C with 5% CO2 for at least 30 min.
-
14.
Retrieve one cryovial of 1 million Lonza Clonetics normal human astrocytes (NHAs) from liquid nitrogen storage and keep on dry ice during transportation.
CRITICAL: NHAs can only be used through passage 10 so you must thaw cells that are at a low passage number.
Note: If performing a replicate experiment, choose a cryovial of cells frozen at a similar passage number as previous experiments.
-
15.
Move the warmed flasks with media from the incubator into the cell culture hood.
-
16.
Thaw NHAs in a 37°C water bath with gentle agitation until one small ice crystal remains. To reduce the possibility of contamination, make sure to keep the cap of the cryovial out of the water.
Note: Thawing should be rapid and take approximately 2 min.
-
17.
Decontaminate the external surfaces of the cryovial with 70% ethanol.
CRITICAL: Perform the following steps in a cell culture hood with proper aseptic technique to prevent contamination.
-
18.
Using a p1000 pipette, gently pipette up and down to resuspend the thawed cells.
-
19.
Slowly and down the side of the flask, add 500 μL cell suspension to each flask.
Note: This will seed each flask at a density of approximately 650,000 cells/cm2.
Note: The cells must be thawed into a 75 cm2 flask to provide an excess of media to dilute the DMSO in the cryopreservation media from 10% to 0.32%. Centrifugation should not be used to remove the cells from the cryopreservation media; this action is more damaging than the effects of residual DMSO in the culture
-
20.
Label the flasks with the cell line name, passage number, date, flask number, and your initials.
-
21.
Gently rock the flasks back and forth to evenly distribute the cells.
-
22.
Incubate in a humidified incubator at 37°C with 5% CO2.
Human primary astrocyte maintenance
Timing: Variable
-
23.
Warm an appropriate volume of astrocyte growth media to 37°C in a water bath before use.
Note: Avoid repeated warming and cooling of the media. If the entire contents are not needed for a single procedure, transfer and warm only the required volume in a secondary sterile container.
-
24.
Decontaminate the external surface of the astrocyte growth media bottle with 70% ethanol.
CRITICAL: Perform the following step in a cell culture hood with proper aseptic technique to prevent contamination.
-
25.
Aspirate the spent media and replace with warmed, fresh astrocyte growth media the day after thawing and then every other day thereafter. Increase the volume of media as the cells become more confluent, as follows: 1 mL per 5 cm2 when <25% confluent, 1.5 mL per 5 cm2 when 25%–45% confluent, and 2 mL per 5 cm2 when >45% confluent. Passage the cells when 70% confluent.
Human primary astrocyte passaging
Timing: 1 h
-
26.
Warm an appropriate volume of astrocyte growth media to 37°C in a water bath before use.
Note: Avoid repeated warming and cooling of the media. If the entire contents are not needed for a single procedure, transfer and warm only the required volume in a secondary sterile container.
-
27.
Warm 0.025% trypsin-EDTA, 30 mM HEPES, and trypsin neutralizing solution to 20°C–25°C before use.
-
28.
Cool a centrifuge to 4°C before use.
-
29.
Decontaminate the external surface of the astrocyte growth media bottle, 0.025% trypsin-EDTA, 30 mM HEPES, and trypsin neutralizing solution tubes with 70% ethanol.
CRITICAL: Perform the following steps in a cell culture hood with proper aseptic technique to prevent contamination.
-
30.
Aspirate the spent media from cells at 70% confluence to be passaged.
-
31.
Rinse with 30 mM HEPES (15 mL for a 75 cm2 flask or 2 mL/well for a 6-well plate).
-
32.
Aspirate HEPES.
-
33.
Add 0.025% trypsin-EDTA (6 mL for a 75 cm2 flask or 1 mL/well for a 6-well plate).
-
34.
Incubate in a humidified incubator at 37°C with 5% CO2 for 3–4 min.
Note: Examine the cells with a bright-field microscope and allow the trypsinization to continue until approximately 90% of the cells have rounded up.
-
35.
If lifting from a 75 cm2 flask, rap the edge of the flask against the palm of your hand to release the majority of cells from the culture surface then add 12 mL trypsin neutralizing solution. If lifting from a 6-well plate, add 2 mL/well trypsin neutralizing solution and quickly pipette with a p1000 several times to rinse each well and release the majority of cells from the culture surface.
Note: If the majority of the cells do not detach, the enzymatic activity of the trypsin has been compromised by low temperature or an overextended shelf life. You may re-trypsinize with fresh trypsin solution or rinse with trypsin neutralizing solution and then add media and return the cells to the incubator until new reagents are available.
-
36.
Quickly transfer the detached cells to a conical tube.
-
37.
Rinse with 30 mM HEPES to collect residual cells and add this rinse to the same conical tube (6 mL for a 75 cm2 flask or 1 mL/well for a 6-well plate).
Note: You can examine the flask or plate with a brightfield microscope to ensure that the lift was successful. There should be less than 5% of cells remaining
-
38.
Quantify the cells to determine the concentration of cells in the cell suspension.
-
39.
Add an appropriate amount of cell suspension to a conical tube to pellet 600,000 cells which can be seeded at 100,000 cells/well in a 6-well plate or 480,000 cells which can be seeded at 20,000 cells/well in a 24-well plate.
Note: These are the recommended seeding densities but we have successfully used higher and lower seeding densities (10,000–60,000 cells/well) to prepare multiple 24-well plates for transfection, where each plate will reach 70% confluence on a different day for independent transfections.
-
40.
Centrifuge the cell suspension at 160 × g for 5 min at 4°C to pellet.
-
41.
Aspirate the supernatant.
-
42.
Resuspend the cell pellet in warmed astrocyte growth media (12 mL for a 6-well plate and 24 mL for a 24-well plate).
-
43.
Add cell suspension to each well of a new plate (2 mL/well for a 6-well plate and 1 mL/well for a 24-well plate).
-
44.
Label the plate with the cell line name, passage number, date, plate number, and your initials.
-
45.
Gently rock the plate back and forth to evenly distribute the cells.
-
46.
Incubate in a humidified incubator at 37°C with 5% CO2.
-
47.
Maintain cells until they reach 70% confluence and are ready for transfection.
Key resources table
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Chemicals, peptides, and recombinant proteins | ||
| 1 M HEPES, pH 6–8 | Gibco | Cat# 15630-080 |
| 0.25% trypsin-EDTA | Gibco | Cat# 25200-056 |
| Dulbecco’s phosphate-buffered saline (DPBS) without calcium and magnesium | Corning | Cat# 21-031-CV |
| Opti-MEM reduced serum media | Gibco | Cat# 31985-062 |
| XhoI | NEB | Cat# R0146S |
| Miller’s LB broth | Corning | Cat# 46-050-CM |
| LB + ampicillin (100 mg/mL) agar plates | University of Pennsylvania Cell Center Services Facility |
Cat# 6005 |
| Ampicillin | Corning | Cat# 61-238-RH |
| Fetal bovine serum (FBS) | Gibco | Cat# 16000-044 |
| UltraPure DNase/RNase-free distilled water | Invitrogen | Cat# 10977015 |
| Critical commercial assays | ||
| AGM astrocyte growth medium BulletKit | Lonza | Cat# CC-3186 |
| LookOut mycoplasma PCR detection kit | Sigma-Aldrich | Cat# MP0035-1KT |
| Lipofectamine LTX reagent with PLUS reagent | Invitrogen | Cat# 15338030 |
| Gibson Assembly HiFi HC 1-Step kit | Codex | Cat# GA1100-4X10 |
| NEB stable competent E. coli (high efficiency) | NEB | Cat# C3040H |
| NEBNext high-fidelity 2X PCR master mix | NEB | Cat# M0541S |
| Monarch DNA gel extraction kit | NEB | Cat# T1020S |
| QIAprep spin miniprep kit | QIAGEN | Cat# 27106 |
| EndoFree plasmid maxi kit | QIAGEN | Cat# 12362 |
| Q5 site-directed mutagenesis kit | NEB | Cat# E0552S |
| Dual-Luciferase reporter assay system | Promega | Cat# E1960 |
| Experimental models: Cell lines | ||
| NHA – human astrocytes | Lonza | Cat# CC-2565 |
| Oligonucleotides | ||
| PCR primer: rs7132908 putative enhancer region with upstream pGL4.10[luc2] and downstream FAIM2 promoter overlaps for Gibson Assembly Forward: CTGGCCTAACTGGCCGGTACCTGAGCTCGCT AGCCTCGAGccgggtcatgacagagctct |
Littleton et al.1 | N/A |
| PCR primer: rs7132908 putative enhancer region with upstream pGL4.10[luc2] and downstream FAIM2 promoter overlaps for Gibson Assembly Reverse: CTCCTGAGTAGCTGGGATTACAGGCGCGCAC CACCACGCCccagcacacagtgggcatct |
Littleton et al.1 | N/A |
| PCR primer: FAIM2 promoter with downstream pGL4.10[luc2] overlap for Gibson Assembly Forward: GGCGTGGTGGTGCGCGCCTG | Littleton et al.1 | N/A |
| PCR primer: FAIM2 promoter with downstream pGL4.10[luc2] overlap for Gibson Assembly Reverse: CAGTACCGGATTGCCAAGCTTGGCCGCCG AGGCCAGATCTgcccgggtggccgcttgggt |
Littleton et al.1 | N/A |
| PCR primer: FAIM2 promoter with upstream and downstream pGL4.10[luc2] overlaps for Gibson Assembly Forward: CTGGCCTAACTGGCCGGTACCTG AGCTCGCTAGCCTCGAGGGCGTGGTGGTGCGCGCCTG |
Littleton et al.1 | N/A |
| PCR primer: FAIM2 promoter with upstream and downstream pGL4.10[luc2] overlaps for Gibson Assembly Reverse: CAGTACCGGATTGCCAAGCTTGG CCGCCGAGGCCAGATCTgcccgggtggccgcttgggt |
Littleton et al.1 | N/A |
| Sanger primer: Luciferase vectors region 1: CTAGCAAAATAGGCTGTCC | Littleton et al.1 | N/A |
| Sanger primer: Luciferase vectors region 2: AAGGGACTCCCACACAG | Littleton et al.1 | N/A |
| Sanger primer: Luciferase vectors region 3: TGTGTGGGAGTCCCTTCTGC | Littleton et al.1 | N/A |
| Sanger primer: Luciferase vectors region 4: CCTCCTCCCTCTTTGGATG | Littleton et al.1 | N/A |
| Sanger primer: Luciferase vectors region 5: CATCCAAAGAGGGAGGAGG | Littleton et al.1 | N/A |
| Sanger primer: Luciferase vectors region 6: TCTGCCTAAAAGAAGTATC TGAACCTG |
Littleton et al.1 | N/A |
| Sanger primer: Luciferase vectors region 7: CAGGTTCAGATACTTCTTTT AGGCAG |
Littleton et al.1 | N/A |
| Sanger primer: Luciferase vectors region 8: GCACGTTGAGGATCTTTTGC | Littleton et al.1 | N/A |
| Site-directed mutagenesis primer: rs7132908 non-risk to risk allele forward: TCACTCAGCCtAGAGTCCCTA | Littleton et al.1 | N/A |
| Site-directed mutagenesis primer: rs7132908 non-risk to risk allele reverse: GTGGCCAGTGAAGCTAGA | Littleton et al.1 | N/A |
| Recombinant DNA | ||
| pGL4.10[luc2] reporter vector | Promega | Cat# E6651 |
| pRL-TK reporter vector | Promega | Cat# E2241 |
| FAIM2 promoter clone in pEZX-PG02 reporter vector | GeneCopoeia | Cat# HPRM47354-PG02 |
| pGL4.10[luc2]-rs7132908G-FAIM2 | Littleton et al.1 | N/A |
| pGL4.10[luc2]-rs7132908A-FAIM2 | Littleton et al.1 | N/A |
| pGL4.10[luc2]-FAIM2 | Littleton et al.1 | N/A |
| Software and algorithms | ||
| SoftMax Pro v7.0.3 | Molecular Devices | https://support.moleculardevices.com/s/article/SoftMax-Pro-7-0-software-Download-page; RRID: SCR_014240 |
| Excel v2202 | Microsoft | RRID: SCR_016137 |
| Prism v10.0.0 | GraphPad |
https://www.graphpad.com/features; RRID: SCR_002798 |
| Other | ||
| Nunc cell-culture treated 6-well plates | Thermo Fisher Scientific | Cat# 140675 |
| Costar 24-well clear TC-treated multiple well plates |
Corning | Cat# 3524 |
| 75 cm2 U-shaped canted neck cell culture flask with plug seal cap |
Corning | Cat# 430720U |
| White 96-well Immuno Microlite 1+ plates | Thermo Scientific | Cat# 7571 |
| Nunc biobanking and cell culture cryogenic tubes | Thermo Scientific | Cat# 368632 |
| SpectraMax iD5 multi-mode microplate reader | Molecular Devices | N/A |
| PCR machine | N/A | N/A |
| Gel electrophoresis equipment | N/A | N/A |
| Vortex | N/A | N/A |
| Plate rocker | N/A | N/A |
| Bacteria plate incubator | N/A | N/A |
| Shaking bacteria incubator | N/A | N/A |
| Cell culture biological safety cabinet | N/A | N/A |
| Humidified cell culture incubator with 5% CO2 | N/A | N/A |
| Water bath | N/A | N/A |
| Bright-field microscope | N/A | N/A |
| Hemacytometer or cell counter | N/A | N/A |
| Centrifuge | N/A | N/A |
| 17 × 100 mm tubes with snap caps | N/A | N/A |
| Microcentrifuge tubes (1.5 mL) | N/A | N/A |
| Conical tubes (15 mL, 50 mL, 250 mL) | N/A | N/A |
Materials and equipment
0.025% Trypsin-EDTA
| Reagent | Final concentration | Amount |
|---|---|---|
| Trypsin-EDTA (0.25%) | 0.025% | 5 mL |
| DPBS (1X) | N/A | 45 mL |
| Total | 50 mL |
Store at 4°C for up to 2 weeks.
30 mM HEPES
| Reagent | Final concentration | Amount |
|---|---|---|
| HEPES (1 M, pH 6–8) | 30 mM | 1.5 mL |
| Nuclease-free water | N/A | 48.5 mL |
| Total | 50 mL |
Store at 4°C for up to 1 month.
Trypsin neutralizing solution
| Reagent | Final concentration | Amount |
|---|---|---|
| FBS (100%) | 5% | 2.5 mL |
| DPBS (1X) | N/A | 47.5 mL |
| Total | 50 mL |
Store at 4°C for up to 1 month.
Alternatives: We strongly recommend using the pGL4.10[luc2] and pRL-TK reporter vectors and the Dual-Luciferase Reporter Assay System manufactured by Promega and AGM Astrocyte Growth Medium BulletKit for use with human primary astrocytes manufactured by Lonza. However, alternatives may be appropriate for all other materials, including, but not limited to, the other cell culture reagents, buffer components, E. coli, DNA extraction kits, Gibson assembly kit, and site-directed mutagenesis kit.
The most convenient method of performing luciferase reporter assays is to use a luminometer capable of processing assays in a 96-well plate. Further, to perform a dual-luciferase assay, a plate-reading luminometer must be equipped with two reagent injectors, as one substrate is required to activate the firefly luciferase and another to quench this reaction and then activate the sea pansy luciferase. We used a SpectraMax iD5 Multi-Mode Microplate Reader with SoftMax Pro v7.0.3 software (RRID: SCR_014240) but any other machine and software with the same capabilities can be used.
Step-by-step method details
Transfection of primary astrocytes
Timing: 2 h
This protocol explains the process of transfecting primary astrocytes in a 24-well plate with 750 ng pGL4.10[luc2] vector (experimental or control) and 75 ng pRL-TK vector per well in triplicate.
-
1.
Thaw pGL4.10[luc2] and pRL-TK vector DNA samples at 20°C–25°C.
-
2.
Warm Opti-MEM Reduced Serum Media, Lipofectamine LTX, PLUS Reagent, and Astrocyte Growth Media to 20°C–25°C.
-
3.
Dilute each pGL4.10[luc2] vector (pGL4.10[luc2], pGL4.10[luc2]+promoter, pGL4.10[luc2]+non-risk+promoter, and pGL4.10[luc2]+risk+promoter) to 1,000 ng/μL with nuclease-free water in a sterile microcentrifuge tube.
-
4.
Dilute pRL-TK vector to 100 ng/μL with nuclease-free water in a sterile microcentrifuge tube.
CRITICAL: Perform all following steps in a cell culture hood with proper aseptic technique to prevent contamination.
-
5.
For each pGL4.10[luc2] vector (pGL4.10[luc2], pGL4.10[luc2]+promoter, pGL4.10[luc2]+non-risk+promoter, and pGL4.10[luc2]+risk+promoter), combine 3 μL pGL4.10[luc2] vector at 1,000 ng/μL, 3 μL pRL-TK vector at 100 ng/μL, and 394 μL Opti-MEM Reduced Serum Media in a sterile microcentrifuge tube.
Note: This will provide 750 ng pGL4.10[luc2] and 75 ng pRL-TK to each well.
-
6.
Add 400 μL Opti-MEM Reduced Serum Media to a sterile microcentrifuge tube to serve as a negative control.
-
7.
Mix PLUS Reagent just before use by flicking.
-
8.
Add 3 μL PLUS Reagent to each sample, including the negative control, and mix by flicking.
Note: This will provide 1 μL PLUS Reagent per μg pGL4.10[luc2] vector DNA.
-
9.
Incubate at 20°C–25°C for 5 min.
-
10.
Mix Lipofectamine LTX just before use by flicking.
-
11.
Add 7.5 μL Lipofectamine LTX to each sample, including the negative control, and mix by flicking.
Note: This will provide 2.5 μL Lipofectamine LTX per μg pGL4.10[luc2] vector DNA.
-
12.
Incubate at 20°C–25°C for 30 min.
-
13.
During the incubation, aspirate spent media from all wells of primary astrocytes in a 24-well plate at 70%–80% confluence and add 1 mL/well warmed Astrocyte Growth Media.
Optional: Take brightfield images of all wells to record variations in confluence and to compare to post-transfected cells to document changes in cell viability.
Note: If the 30 min incubation is not almost complete, return the plate to a 37°C humidified cell culture incubator with 5% CO2.
-
14.
After the incubation, drop-wise, add 100 μL/well each DNA-lipid complex and negative control sample to 3 wells for 3 technical replicates (Figure 2).
-
15.
Gently rock the plate back and forth to evenly distribute the DNA-lipid complexes.
-
16.
Incubate the plate in a 37°C humidified cell culture incubator with 5% CO2 for 18–20 h (troubleshooting 2).
Note: We noticed decreased cell viability after 20 h.
Figure 2.
Plate map for transfection
Diagram of a 24-well plate where cells are cultured until they reach 70% confluence and then are transfected with luciferase assay vectors in triplicate.
Luciferase assay
Timing: 2.5 h
This protocol explains the process of collecting cell lysates and quantifying luciferase protein luminescence using a dual-luciferase reporter assay system.
-
17.
Thaw Stop & Glo Buffer and Luciferase Assay Buffer II at 20°C–25°C or in a 20°C–25°C water bath.
-
18.
Prepare three 50 mL tubes: one containing distilled water, one containing 70% ethanol, and one to be used for waste.
-
19.
Prepare 1X Passive Lysis Buffer by combining 1 volume of 5X Passive Lysis Buffer with 4 volumes of distilled water.
Note: 500 μL is required for each well of transfected cells and some excess is require to be used as a plate blank.
Note: 1X Passive Lysis Buffer may be stored at 4°C for up to one month but it is recommended to prepare it just before use.
-
20.
Prepare Stop & Glo Reagent by combining 50 volumes of Stop & Glo Buffer with 1 volume of 50X Stop & Glo Substrate in a 15 mL tube.
Note: 100 μL is required for each luciferase assay reaction.
Note: This reagent should be at ambient temperature prior to performing the assay.
Note: If the Stop & Glo Buffer has precipitated, it can be vortexed or incubated at 37°C for up to 2 h.
Note: Stop & Glo Reagent can be stored at −20°C for up to 15 days and thawed at 20°C–25°C. Mix prior to use after thawing.
-
21.
Prepare Luciferase Assay Reagent II by resuspending lyophilized Luciferase Assay Substrate in 10 mL Luciferase Assay Buffer II in a 15 mL tube.
Note: 100 μL is required for each luciferase assay reaction.
Note: This reagent should be at ambient temperature prior to performing the assay
Note: Luciferase Assay Reagent II can be stored at −20°C for up to one month or at −80°C for up to one year. Repeated freeze-thawing may decrease assay performance so it is recommended to freeze in aliquots. Thaw at 20°C–25°C and mix by inverting prior to use after thawing.
-
22.Prepare plate reader.
-
a.Perform washing of injector probes with distilled water and 70% ethanol according to manufacturer’s instructions (https://www.moleculardevices.com/sites/default/files/en/assets/user-guide/br/spectramax-id5-user-guide-5059784h.pdf).
-
b.Prime injector probe 1 with Luciferase Assay Reagent II according to manufacturer’s instructions.
-
c.Prime injector probe 2 with Stop & Glo Reagent according to manufacturer’s instructions.
-
d.Set up the software to know the location of experimental wells and wells with lysis buffer to serve as a plate blank (Figure 3). Set the assay workflow to inject 100 μL with injector probe 1, wait 2 s, measure luminescence for 10 s, inject 100 μL with injector probe 2, wait 2 s, and measure luminescence for 10 s.
-
a.
Note: Other settings such as plate type, plate height, read depth etc. may need to be modified depending on plate, machine, and software used.
Note: We used a SpectraMax iD5 machine and modified the Dual Luciferase Reporter Assay (iD5) protocol template provided by SoftMax Pro 7.0.3 software (RRID: SCR_014240).
Optional: Take brightfield images of all wells to record variations in confluence and to compare to post-transfected cells to document changes in cell viability.
-
23.
Aspirate media from each well.
-
24.
Wash each well with 1 mL DPBS and be sure to completely remove DPBS before adding lysis buffer.
-
25.
Add 500 μL 1X Passive Lysis Buffer to each well.
Note: Less 1X Passive Lysis Buffer can be added, as little as 100 μL/well, if the cell line is easy to lyse. We have observed that human primary astrocytes require 500 μL/well and additional mechanical lysis after incubation.
-
26.
Rock the plate gently and incubate at 20°C–25°C for 15 min.
-
27.
After the incubation, observe the wells using a brightfield microscope to determine if the cells have lysed. If not, use a p1000 pipette to pipette each sample up and down to mechanically lyse the cells. Be very careful to not contaminate other wells with the cell lysate.
-
28.
Transfer each cell lysate to a microcentrifuge tube.
Optional: Observe the wells using a brightfield microscope to determine if the majority of cells have been lysed and collected.
-
29.
Vortex each lysate for 10 s.
-
30.
Transfer 20 μL of each cell lysate in triplicate to wells of a white, opaque, flat-bottom 96-well plate (Figure 3).
Note: Check for plate compatibility with the plate reader machine beforehand.
Note: This volume will not fully cover the bottom of each well.
-
31.
Transfer 20 μL 1X Passive Lysis Buffer to at least three wells of the 96-well plate to serve as a plate blank (Figure 3).
Note: This volume will not fully cover the bottom of each well.
-
32.
Place the 96-well plate in the plate reader machine and begin assay program (troubleshooting 3).
-
33.
After the program has run, discard the 96-well plate, and clean the injector probes with distilled water and 70% ethanol, according to manufacturer’s instructions.
Figure 3.
Plate map for luciferase assay
Diagram of a 96-well plate where cell lysates from each transfection replicate are assayed in triplicate and additional wells are filled with lysis buffer to serve as a plate black for data normalization.
Data analysis
Timing: 15 min
This protocol explains the process of normalizing and analyzing luminescence data from a dual-luciferase reporter assay and was informed by guidance from Promega.5
-
34.
In the SoftMax Pro software (RRID: SCR_014240), select “Reduction” in the “Home” tab, check “Use Plate Blank” and set the “Wavelength Options” to “!Lm1”.
Note: This will automatically average the luminescence value across the wells with only lysis buffer which served as a plate blank and subtract this value from all other results to correct for background luminescence in the assay plate and lysis buffer.
-
35.
Export the results to an Excel workbook (.xlsx) and open with Microsoft Excel software (RRID: SCR_016137).
-
36.
Divide the firefly relative luciferase unit (RLU) (first measurement) from each well by its sea pansy RLU (second measurement) to calculate the normalized luciferase activity for each sample.
Note: This normalization will control for differences in cell plating, transfection efficiency, pipetting inconsistencies, and toxicity.
-
37.
Calculate the average normalized luciferase activity for each experimental condition (pGL4.10[luc2], pGL4.10[luc2]+promoter, pGL4.10[luc2]+non-risk+promoter, pGL4.10[luc2]+risk+promoter, and mock transfection) by averaging the nine technical replicates.
-
38.
Calculate the normalized fold change in luciferase activity for each experimental condition (pGL4.10[luc2], pGL4.10[luc2]+promoter, pGL4.10[luc2]+non-risk+promoter, pGL4.10[luc2]+risk+promoter, and mock transfection) by dividing the average normalized luciferase activity for that sample by the average normalized luciferase activity for the pGL4.10[luc2]+promoter sample.
Note: Although the transfection and luciferase assay are both performed in triplicate, these results only represent a sample size of one. For statistical comparisons, the transfection and luciferase assay must be repeated.
-
39.
Graph the normalized fold change in luciferase activity for each experimental condition (pGL4.10[luc2], pGL4.10[luc2]+promoter, pGL4.10[luc2]+non-risk+promoter, pGL4.10[luc2]+risk+promoter, and mock transfection) (Figure 4A).
-
40.
Repeat all major steps to replicate the transfection, luciferase assay, and data analysis.
-
41.
After additional assays are completed, calculate the average normalized fold change in luciferase activity and standard error across all experiments.
Note: The standard error for the pGL4.10[luc2]+promoter condition will be 0 because each dataset is normalized to this sample and its normalized fold change is always 1.
-
42.
Graph the average normalized fold change in luciferase activity and standard error for each experimental condition (pGL4.10[luc2], pGL4.10[luc2]+promoter, pGL4.10[luc2]+non-risk+promoter, pGL4.10[luc2]+risk+promoter, and mock transfection) (Figure 4B).
Figure 4.
Visualization of luciferase assay data
(A) Example graph of normalized fold change data from one luciferase assay (n = 1) where fold changes are relative to the pGL4.10[luc2] condition.
(B) Example graph of average normalized fold change and standard error data from multiple luciferase assays where fold changes are relative to the pGL4.10[luc2] condition for each separate assay, resulting in no standard error for this condition. After nine independent assays are performed (n = 9), some data may be excluded from the final analysis based on the described exclusion criteria resulting in a smaller sample size (e.g., n = 7–9).
Expected outcomes
The transfection of human primary astrocytes using our methods should have a transfection efficiency of approximately 11%.1 While this value is not generally high, others have shown that expected transfection efficiencies for primary astrocytes range from 5 to 12%.6 The viability of the transfected cells should be around 86%1 if the cells are not incubated for longer than 22 h. It is expected that if the putative cRE is an enhancer, the presence of this region should increase luciferase expression in comparison to the promoter only control (normalized fold change > 1) (Figures 4A and 4B). Conversely, if the putative cRE is a silencer, this region should decrease luciferase expression in comparison to the promoter only control (normalized fold change < 1). If the GWAS variant has an effect on gene expression, there will be a significant difference between the normalized fold changes from cells transfected with a vector containing the cRE with the risk allele compared to the non-risk allele (Figures 4A and 4B). We have observed that the unmodified pGL4.10[luc2] vector will also produce some low level of luciferase expression even though this vector does not contain a promoter upstream of the luciferase coding sequence (Figures 4A and 4B). This could be a result of there being a weak promoter somewhere else in the vector backbone or trans effects from the co-transfected pRL-TK sea pansy luciferase plasmid. The mock transfection condition should produce no luciferase activity (Figures 4A and 4B).
Quantification and statistical analysis
Assays should be excluded from statistical analysis if there was luminescence detected (normalized fold change > 0.1) in either the mock transfection or lysis buffer negative controls. Assays should also be excluded if at least one normalized fold change value was greater than two standard deviations away from the mean of all other assays performed. For each cRE-promoter pair we’ve tested, we’ve performed nine independent luciferase assays and excluded 0–2 assays using these criteria.1 To determine if normalized fold change differences between experimental conditions are statistically significant, perform an ordinary one-way ANOVA test with Tukey’s correction for multiple comparisons. p-values < 0.05 should be considered significant. This statistical analysis can be easily performed using GraphPad Prism (RRID: SCR_002798) software.
Limitations
Limitations of this method are largely due to the properties of an in vitro reporter assay. The cRE and promoter sequences being tested are introduced side-by-side into a reporter vector and these sequences likely exist farther apart in the genome. Luciferase luminescence is being measured and interpreted as a proxy for gene expression but the amount of luciferase mRNA transcribed in the cell is not directly quantified. The chosen cell line, in this case, human primary astrocytes, may also not accurately represent their cell type in vivo. The regulatory activity of cREs largely involves the activity of transcription factor proteins. For this assay to accurately test the effect of a cRE or GWAS variant on gene expression, the transfected cell type must express the transcription factor(s) involved in this process. A benefit of this method is that subtle changes in gene expression may be more easily detected using a luciferase reporter, however further experiments are needed to functionally validate the effect of a GWAS variant endogenously or in vivo.1,3
Troubleshooting
Problem 1
Gibson assembly failure, including lack of E. coli colonies grown on ampicillin selection plates after transformation (before you begin step 4h) or lack of inserted fragments determined by Sanger sequencing (before you begin step 4k).
Potential solution
To improve the efficiency of the Gibson assembly reaction to generate the experimental vectors, the length of the overlap sequences on each fragment can be modified. These lengths are determined based on the length and number of fragments being inserted and vary based on which Gibson assembly reagents are being used. To insert two fragments with an average length of 1,382 bp using the Codex Gibson Assembly HiFi HC 1-Step kit, we used 40 bp overlaps. A useful resource is the Gibson Assembly Cloning Guide (2nd edition).7
If most or all of the Gibson assembly products are the unmodified pGL4.10[luc2] vector, it is useful to run the digested pGL4.10[luc2] product on a 1% agarose gel after incubation with the XhoI restriction enzyme. If the digestion was successful, there will be one band that is approximately 4 kb in size (Figure 5A). If the digestion was unsuccessful, there will be bands that appear smaller than 4 kb because the circular vector can supercoil and travel through the gel faster than a linear fragment or appear larger than 4 kb because the circular vector can exist in a more open form and travel through the gel more slowly (Figure 5A). If the digestion is unsuccessful, purchase a new stock of XhoI and ensure it is stored and used properly. If the digestion is partially successful (Figure 5B), use gel extraction to extract only the successfully digested DNA band that is approximately 4 kb in size.
Figure 5.
1% agarose gels with undigested and digested pGL4.10[luc2] vectors
(A) Representative image of a 1% agarose gel showing a pGL4.10[luc2] vector that was successfully digested with the XhoI restriction enzyme with a band at approximately 4.2 kb (bottom lane) compared to a 1 kb DNA ladder (top lane) and an undigested pGL4.10[luc2] vector existing as both open circles and a supercoiled vector (middle lane). The gel was run at constant 100 V until the dye front reached at least halfway across the gel in 1X TAE buffer.
(B) Representative image of a 1% agarose gel showing a pGL4.10[luc2] vector that was partially digested with the XhoI restriction enzyme with a band at approximately 4.2 kb and also a band of larger size that represents an undigested pGL4.10[luc2] vector existing as an open circle (top lane) compared to a 1 kb DNA ladder (bottom lane). The gel was run at constant 100 V until the dye front reached at least halfway across the gel in 1X TAE buffer.
Include a positive control reaction (DNA for this reaction is included with some Gibson assembly kits) to ensure that the Gibson assembly protocol is being performed correctly and that the reagents are functioning properly.
Problem 2
Cell death after transfection (step 16).
Potential solution
Many aspects of the transfection protocol can be optimized, including the doses of vector DNA, Lipofectamine LTX, and PLUS Reagent, ratio of firefly luciferase vector to sea pansy luciferase vector, cell confluence, and incubation time. In our experience with human primary astrocytes, increased vector DNA, Lipofectamine LTX, PLUS Reagent, and incubation time increased cell death. Transfection reagents other than Lipofectamine LTX or methods other than lipid-mediated transfection can also be used to introduce the vectors.
Cell death after the transfection can also result from using vector DNA that is not free of endotoxins. Use an appropriate vector DNA extraction protocol that includes an endotoxin removal step.
Problem 3
Low luminescence values (step 32).
Potential solution
Low luminescence values could be due to low or inconsistent transfection efficiency. Many aspects of the transfection protocol can be optimized, including the doses of vector DNA, Lipofectamine LTX, and PLUS Reagent, ratio of firefly luciferase vector to sea pansy luciferase vector, cell confluence, and incubation time. Transfection reagents other than Lipofectamine LTX or methods other than lipid-mediated transfection can also be used to introduce the vectors.
The 96-well plate used in the luciferase assay could not be compatible with the plate reader machine or have too much background fluorescence. Check with the manufacturer of the plate reader machine to ensure that you use a validated 96-well plate.
If low levels of luciferase are expressed, the recommended volume of lysis buffer used to prepare the cell lysates could be too high, making the luciferase luminescence difficult to detect. It is acceptable to use as little as 100 μL lysis buffer per well of a 24-well plate, which would increase the concentration of luciferase protein fivefold.
Determine if the cell line is contaminated with mycoplasma and, if contaminated, thaw or purchase an uncontaminated stock of frozen cells.
Resource availability
Lead contact
Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Struan F.A. Grant (grants@chop.edu).
Technical contact
Technical questions on executing this protocol should be directed to and will be answered by the technical contact, Sheridan H. Littleton (sl2225@cam.ac.uk).
Materials availability
Vectors (pGL4.10[luc2]-rs7132908G-FAIM2, pGL4.10[luc2]-rs7132908A-FAIM2, and pGL4.10[luc2]-FAIM2) generated in this study will be available from the lead contact with a completed Materials Transfer Agreement.
Data and code availability
For access to raw data, please contact the lead contact, Struan F.A. Grant (grants@chop.edu). No new code was developed as part of this project.
Acknowledgments
We thank the University of Pennsylvania Genomic and Sequencing Core DNA Sequencing Laboratory for their services. S.H.L. is supported by the NICHD (F31HD105404). S.F.A.G. is supported by the NICHD (R01 HD056465), the NIDDK (UM1 DK126194), and the Daniel B. Burke Endowed Chair for Diabetes Research. Some figures were created with Biorender.com.
Author contributions
S.H.L. designed the experiment, wrote the original draft, and prepared all figures. S.H.L. and S.F.A.G. reviewed and edited the final manuscript.
Declaration of interests
The authors declare no competing interests.
Contributor Information
Sheridan H. Littleton, Email: sl2225@cam.ac.uk.
Struan F.A. Grant, Email: grants@chop.edu.
References
- 1.Littleton S.H., Trang K.B., Volpe C.M., Cook K., DeBruyne N., Maguire J.A., Weidekamp M.A., Hodge K.M., Boehm K., Lu S., et al. Variant-to-function analysis of the childhood obesity chr12q13 locus implicates rs7132908 as a causal variant within the 3' UTR of FAIM2. Cell Genom. 2024;4 doi: 10.1016/j.xgen.2024.100556. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.ENCODE Project Consortium. Moore J.E., Purcaro M.J., Pratt H.E., Epstein C.B., Shoresh N., Adrian J., Kawli T., Davis C.A., Dobin A., et al. Expanded encyclopaedias of DNA elements in the human and mouse genomes. Nature. 2020;583:699–710. doi: 10.1038/s41586-020-2493-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Littleton S.H., Grant S.F.A. Strategies to identify causal common genetic variants and corresponding effector genes for paediatric obesity. Pediatr. Obes. 2022;17 doi: 10.1111/ijpo.12968. [DOI] [PubMed] [Google Scholar]
- 4.Meechan P.J., Potts J. U.S. Department of Health and Human Services, Public Health Service, Centers for Disease Control and Prevention, National Institutes of Health; 2020. Biosafety in Microbiological and Biomedical Laboratories. HHS Publication No. (CDC) 300859; pp. 1–574. [Google Scholar]
- 5.Schagat T.L., Paguio A., Kopish K. Normalizing genetic reporter assays: approaches and considerations for increasing consistency and statistical significance. Cell Notes. 2007;17:9–12. http://www.promega.com/∼/media/Files/Resources/Cell%20Notes/cn017/Normalizing%20Genetic%20Reporter%20Assays.ashx [Google Scholar]
- 6.Alabdullah A.A., Al-Abdulaziz B., Alsalem H., Magrashi A., Pulicat S.M., Almzroua A.A., Almohanna F., Assiri A.M., Al Tassan N.A., Al-Mubarak B.R. Estimating transfection efficiency in differentiated and undifferentiated neural cells. BMC Res. Notes. 2019;12:225. doi: 10.1186/s13104-019-4249-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Synthetic Genomics Inc. 2017. Gibson Assembly Cloning Guide 2nd Edition; pp. 1–43.https://www.biocat.com/bc/files/Gibson_Guide_V2_101417_web_version_8.5_x_11_FINAL.pdf [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
For access to raw data, please contact the lead contact, Struan F.A. Grant (grants@chop.edu). No new code was developed as part of this project.


Timing: 15 min


