Abstract
Calcium ions (Ca2+) play crucial roles in sperm motility and fertilization. The copine (CPNE) family comprises several Ca2+-dependent phospholipid-binding proteins. Of these, CPNE1 is extensively expressed in mammalian tissues; however, its precise role in testicular development and spermatogenesis is yet to be fully characterized. In this study, we used proteomics to analyze testicular biopsies and found that levels of CPNE1 were significantly reduced in patients with non-obstructive azoospermia (defective spermatogenesis) compared to those in patients with obstructive azoospermia (physiological spermatogenesis). In mice, CPNE1 is expressed at various stages of germ cell development and is associated with the Golgi apparatus. Ultimately, CPNE1 is expressed in the flagella of mature sperms. To further examine the role of CPNE1, we developed a Cpne1 knockout mouse model. Analysis showed that the loss of Cpne1 did not impair testicular development, spermatogenesis, or sperm morphology and motility in physiological conditions. When treated with gadolinium (III) chloride or 2-aminoethoxydiphenyl borate, known inhibitors of store-operated Ca2+ entry, Ca2+ signals and sperm motility were significantly compromised in wild-type mice; however, both mechanisms were conserved in KO mice. These results suggested that CPNE1 is dispensable for testicular development, spermatogenesis or sperm motility in physiological conditions. In addition, CPNE1 may represent a target of Ca2+ channel inhibitors and may therefore be implicated in the regulation of Ca2+ signaling and sperm motility.
Keywords: Calcium ion, Copine1, Male infertility, Spermatogenesis, Sperm motility
Mammalian sperms are highly specialized cells. To facilitate fertilization, all organelles, except the nucleus and mitochondria, are discarded during sperm differentiation. The endoplasm and Golgi apparatus are specialized to form the acrosome, whereas the cytoplasm is specialized to form the flagellum, which is the source of power for movement. These two structures are critical in sperms for robust fertilization. Notably, both acrosomal activity and flagellar movement depend on calcium ions (Ca2+). During the acrosome reaction, sperms release acidic substances, an event that involves the opening of Ca2+ channels and influx of Ca2+ into the sperm head [1]. After the sperm passes through the zona pellucida of the egg, the sperm membrane fuses with that of the egg, and this fusion activates the fertilization process, which induces a series of Ca2+ oscillations in the egg [2]. Additionally, Ca2+ and cyclic nucleotides control sperm movement [3,4,5]. Sperm activation in the female reproductive tract is triggered by hyperactivation, a process that is vital for sperms to penetrate the cumulus and zona pellucida surrounding the egg and initiate successful fertilization [6, 7]. Sperm hyperactivation is also dependent on Ca2+. Despite the significance of Ca2+ [8, 9], patch-clamp studies have detected few types of channels and the pH-regulated channel CatSper, a Ca2+-permeable channel, which is expressed only in the sperm flagellum [10]. Previous studies have shown that CatSper is located in the principal piece of the sperm tail and that direct impairment of the CatSper gene leads to compromised fertility in male mice, characterized by a decline in both sperm motility and the capacity of the sperm to fertilize eggs [11, 12]. Other studies have shown that the disruption of CatSper3 or CatSper4 in mice also eliminates the selective Ca2+ current, thus impairing the hyperactivated motility of sperm and male fertility but not spermatogenesis or the initial motility of sperm [13, 14].
The Copine (CPNE) family of proteins was first discovered during preparation of a Ca2+-dependent phospholipid-binding protein obtained from Paramecium tetraurelia [15]. Subsequent in-depth analyses of human cDNA and CPNE revealed nine different human CPNE genes. The expression of CPNE has been detected in many mammalian tissues, including the brain, heart, lungs, liver, and kidneys [16]. Screening of CPNE1–6 expression in human tissues revealed that CPNE1, CPNE2, and CPNE3 were extensively expressed; CPNE4 expression was limited to the brain, heart, and prostate; and that of CPNE6 was brain-specific [17]. CPNE proteins share a common structure, including two N-terminal C2 domains and a C-terminal von Willebrand factor A domain. The N-terminal C2 domain of CPNE proteins is similar to that of the C2 domain found in protein kinase C, phospholipase C, synapse binding protein, and rabphilin, and is known to be responsible for Ca2+-dependent phospholipid binding [18]. The potential target proteins of human CPNE1 include transcription factors, cytoskeleton-related proteins, phosphorylation regulators, ubiquitination-related proteins, and members of the Ca2+-binding protein family [19, 20]. The specific role of CPNE1 in mammals remains unclear, and its role in male fertility is yet to be investigated. In this study, we used proteomic analysis to investigate clinical testicular biopsy samples. We found that CPNE1 protein levels were reduced in the testes of patients with non-obstructive azoospermia (NOA, defective spermatogenesis) compared to those in patients with obstructive azoospermia (OA, physiological spermatogenesis). Next, we developed a Cpne1 knockout (KO) mouse model and investigated its role in spermatogenesis and sperm motility.
Materials and Methods
Selection of patients and testicular biopsy collection
Patients with nonobstructive azoospermia (NOA) were identified using microscopy and computer-assisted semen analysis (CASA) in combination with testicular biopsy for testicular histology examination. Patients with obstructive azoospermia (OA) and who exhibited physiological spermatogenesis were used as controls. Patients with the following characteristics were excluded: 1) severe chronic or acute diseases, including those of the cardiovascular, cerebrovascular, hepatorenal, or hematological origins; 2) psychopathy; 3) ejaculatory dysfunction, including non- or retrograde ejaculation; 4) chromosomal abnormalities or congenital malformations; and 5) history of testicular surgery or injury, cryptorchidism, genital tract infection, or positive anti-sperm antibody. Patients included were between 20–39 years; the median age for the NOA group was 31 years, and that for the OA group was 30 years. Experiments with human samples were approved by the Ethics Committee of the Third Affiliated Hospital of Guangzhou Medical University (2017-055).
Proteomics analysis
Three testis biopsy samples from each group were subjected to isobaric labelling for relative and absolute quantification (iTRAQ screening) of differentially expressed proteins, as described in our previous report [5].
Generation of mutant mice and genotyping
Heterozygous Cpne1 deleted C57BL/6J mice (Cpne1+/–) were generated using CRISPR/Cas9 at the Shanghai Model Organisms Center (Shanghai, China). This strategy is illustrated in Fig. 2A. Homogeneous male Cpne1 knockout (Cpne1–/–, KO) mice were generated by mating male and female Cpne1+/– mice; male wild type (Cpne1+/+, WT) littermates were used as controls. DNA isolated from tail biopsies was used to genotype mice via PCR. For the F1 generation, we used primers 1 and 2, generating a PCR product of 4325 bp for the WT allele and 634 bp for the KO allele, respectively, and primers 1 and 3 generated a product of 684 bp for the WT allele to verify the appropriate genotype (primer sequences are listed in Table 3). Thus, for the F2 generation and thereafter, we only detected the 684 bp PCR product for the WT mice and the 634 bp product for the KO mice. All animal experiments were approved by the Southern Medical University Committee on the Use and Care of Animals (L2020217) and were performed in accordance with the committee’s guidelines and regulations.
Table 3. Primers used for genotyping or qRT-PCR.
| Gene name | Primer Type | Primer sequence (5’→3’) | |
|---|---|---|---|
| Cpne1 WT and KO allele | I | GTCCTGCTTCTGCTTCCTGT | WT: 4325 bp KO: 634 bp |
| II | ATTTCCAGGGGTCTGATGCC | ||
| I | GTCCTGCTTCTGCTTCCTGT | WT: 684 bp | |
| III | GAGTGGGTCAGACTTGGAGC | ||
| Cpne1 (qPCR) | Forward | TCCGTATTGCAGGCATCC | |
| Reverse | TGGTAGTAGTGTGTGCACC | ||
| Gapdh (qPCR) | Forward | AGACAGCCGCATCTTCTTGT | |
| Reverse | ACACTTCCTAAACCGGGCAT | ||
| Cpne2 (qPCR) | Forward | GAAACAGCCGTCAACAACCTC | |
| Reverse | GGAAATCATGCTCATCCAACTGG | ||
| Cpne3 (qPCR) | Forward | GCAGGGAAAGGGAGTATTACGA | |
| Reverse | GTTCGGTGAACCATCAGCCA | ||
| Cpne4 (qPCR) | Forward | GGTCCAACGTCTCCGGTTTG | |
| Reverse | TCATTGCCCGATAATTCTTCAGC | ||
| Cpne5 (qPCR) | Forward | GATCACGGTGTCATGCAGGAA | |
| Reverse | CTCTCGCCATTGCTTGTTCTC | ||
| Cpne6 (qPCR) | Forward | AAGGTCACTAAGCCATTACTGC | |
| Reverse | GTAAGTTGCACATAGTCGTTGGT | ||
| Cpne7 (qPCR) | Forward | CGGGACCCATTGACCAAGTC | |
| Reverse | CATACACCTCAAACCGTAGCTTC | ||
| Cpne8 (qPCR) | Forward | CGGGACAAGTGCTCCGTTC | |
| Reverse | AACGATGTAATGGCTCTTCCAG | ||
| Cpne9 (qPCR) | Forward | AAGATCGACGTATATGACTGGGA | |
| Reverse | GGTTAAGTACCTCGTACACTGTG | ||
Tissue collection, histology and immunofluorescence
Testes and epididymides of mice were obtained, weighed after euthanasia, and fixed for 24 h in improved Davidson’s fixative. Tissues were paraffinized, embedded, and sectioned. At least three sections (5 μm, taken 100 μm apart) of each testis and epididymis were stained with hematoxylin-eosin (H&E) for regular histological examination.
Immunohistochemistry was performed using the 5 μm sections with an anti-CPNE1 antibody (HPA006456; Sigma-Aldrich, Shanghai, China) and horseradish peroxidase (HRP)-conjugated anti-IgG secondary antibodies (111-035-003; Jackson Immunoresearch, West Grove, PA, USA). Sections were visualized using diaminobenzidine and counterstained using hematoxylin.
Immunofluorescence was performed per the method described for IHC, except the anti-GM130 primary antibody was used for labeling the Golgi apparatus and PNA was used to label acrosomes (MA5-47668 and L21409, both reagents were procured from ThermoFisher Scientific, Waltham, MA, USA). Alexa-Fluor-488- or Alexa-Fluor-594-labeled secondary antibodies (111-545-003, 115-545-003, 111-585-003, 115-585-003, Jackson Immunoresearch) were used against primary antibodies, and 4,6-diamidino-2-phenylindole (DAPI, D9542, Sigma-Aldrich, Shanghai, China) was used to visualize nuclei. Images were acquired using a FluoView FV1000 confocal microscope (Olympus, Tokyo, Japan).
Fertility analysis
Eight to twelve-week-old Cpne1 KO and WT male mice were mated with adult C57Bl/6J female mice with proven fertility at a ratio of 1:2 for 1 month. The following morning, the presence of a vaginal plug in the female was regarded as an indicator of successful copulation. Plug-positive females were separated, and pregnancy rate and litter size were recorded.
Quantitative reverse-transcription PCR
Total testicular RNA was purified using the Trizol Reagent (15596026CN, Invitrogen, Carlsbad, CA, USA), and processed to generate cDNA using the Hifair™ II 1st Strand cDNA Synthesis Kit, followed by amplification and quantification using the Hieff® qPCR SYBR Green Master Mix (11141ES60 and 11201ES08, YEASEN Biotech Co., Ltd., Shanghai, China) using a StepOne Plus Real-Time PCR System (Applied Biosystems, Waltham, MA, USA). Gapdh was used as an endogenous control. Three technical replicates were analyzed for each transcript. Primer sequences are listed in Table 3.
Sperm counting, motility analysis, and Ca2+ fluorescence probing
One epididymis was obtained from each mouse and minced in 1.5 ml potassium simplex optimized medium (KSOM, MR-106-D, Millipore, Darmstadt, Germany) containing 3% bovine serum albumin, and incubated at 37°C for 20 min to allow the sperm to be released into the medium. The total number of sperms in the final suspension was counted using a hemocytometer. Sperm motility was measured using microscopy and computer-assisted semen analysis (CASA) based on parameters specific to mice as described in our previous study [5].
A portion of the sperm suspension was then smeared onto glass slides. After air-drying, sperms were fixed with 70% ethanol (analytical reagent grade, Guangzhou Chemical Reagent Factory, Guangzhou, Guangdong, China), incubated with a Ca2+ fluorescence probe (Fluo-4 AM, S1060, Beyotime, Shanghai, China), and sperm nuclei were labeled using DAPI. Images were acquired using the FluoView FV1000 confocal microscope.
In vivo treatment with calcium channel inhibitors
Eight-week-old WT and KO mice were intraperitoneally administered 80 mg·kg–1·d–1 Gadolinium (III) chloride (GdCl3·6H2O; G7532, Sigma-Aldrich), or with 50 mg·kg–1·d–1 2-aminoethoxydiphenyl borate (2-APB; D9754, Sigma-Aldrich), for 30 consecutive days, respectively. The mice were then subjected to the analyses described above.
Statistical analysis
All experiments were performed in triplicates. Data are expressed as mean values ± standard deviation. For measurable data, after tests of normality and homogeneity of variance, differences between groups were analyzed using t-tests for two groups and one-way ANOVA for more than two groups, followed by Dunnett’s test. The chi-squared test (SPSS 13.0; SPSS, Chicago, IL, USA) was used for percentage data. P < 0.05 was considered statistically significant. For proteomics data, relative levels of identified proteins were regarded as statistically significant if P < 0.05, in addition to fold-change (OA vs. NOA) > 1.5 for upregulation or < 1.5 for downregulation.
Results
Expression levels of CPNE1 were significantly reduced in testes of NOA patients
To identify differentially expressed proteins related to spermatogenic defects, we collected testicular biopsies from patients with NOA or OA (Table 1, Fig. 1) for proteomic analyses using isobaric labelling for relative and absolute quantification (iTRAQ). Of all the differentially expressed proteins, CPNE1 levels were significantly downregulated in the testes of patients with NOA when compared to those in patients with OA (fold_change: −1.71; Table 2). These results suggested that reduced CPNE1 levels may be related to spermatogenic disorders.
Table 1. Pathological information of 6 cases for proteomic analysis.
| Group | Age | Pathological description | |
|---|---|---|---|
| NOA | |||
| Case 1 | 28 | Semen analysis indicated no sperm. Testicular biopsy showed that germ cells were largely decreased, indicating disrupted spermatogenesis. | |
| Case 2 | 27 | ||
| Case 3 | 31 | ||
| OA | |||
| Case 1 | 28 | Semen analysis indicated no sperm. Testicular biopsy showed that all stages of sperm cells were visible, and the lumen was blocked. | |
| Case 2 | 35 | ||
| Case 3 | 31 | ||
Fig. 1.

Morphological examination of testicular puncture samples from patients with OA and NOA. OA, obstructive azoospermia; NOA, non-obstructive azoospermia. Scale bars = 100 μm.
Table 2. Relative protein levels of CPNE1 in patient testes observed using iTRAQ proteomic analyses (NOA vs. OA).
| Test-1 | Test-2 | Test-3 | Average | Coefficient of variation | Fold_change |
|---|---|---|---|---|---|
| 0.56 | 0.57 | 0.62 | 0.58 | 0.05 | –1.71 |
Fold_change ≤ −1.5 (downregulated) or ≥ 1.5 (upregulated) was considered significant. “–” indicates downregulation.
Generation of Cpne1 KO mice and effects of Cpne1 deletion on spermatogenesis
To determine whether CPNE1 is involved in spermatogenesis, we first performed immunohistochemical staining for CPNE1 using testicular sections prepared from healthy postnatal mice tissues. Expression of CPNE1 was weak on postnatal day 1. However, levels of CPNE1 were significantly increased in the cytoplasm of germ cells after 15 days, and appeared dot-like. After 28 days, the cytoplasmic signals of CPNE1 appeared as dots concentrated around the nuclei of the germ cells (Fig. 3A). This expression pattern indicated presence of the Golgi apparatus, found in all germ cell stages and plays a crucial role in sperm maturation by directing acrosomal biogenesis. The colocalization of CPNE1 and GM130, a marker of the Golgi apparatus, confirmed its association with the Golgi apparatus (Fig. 3B). However, CPNE1 did not co-localize with PNA, which specifically labeled the acrosome (Fig. 3C). These data indicate that CPNE1 is involved in spermatogenesis by associating with the Golgi apparatus in germ cells but not with the acrosome.
Fig. 3.
Histomorphology of testis and epididymi in Cpne1 KO and WT mice. (A) IHC staining showing CPNE1 expression profiles in testes of mice. (B) Visualization of co-localization of CPNE1 (red) and the Golgi apparatus marker GM130 (green) using immunofluorescence. (C) Visualization of co-localization of CPNE1 (red) and the acrosome marker PNA (green) using immunofluorescence. (D) Immunofluorescence results showed that CPNE1 expression was completely abolished in KO testes. (E and F) Histomorphology of testis and epididymi in WT and KO mice based on H&E staining. (G–I) Comparison of weight of testis and epididymi and sperm density between the WT and KO mice (n = 6). (J and K) Fertility analysis of Cpne1 KO mice visualized based on mean pregnancy rate (%) and litter size in comparison to those resulting from WT matings (n = 6). Scale bars = 20 μm in A, 50 μm in B and C, 100 μm in D and E. ns, not significant.
To identify the role of CPNE1 in spermatogenesis, we generated Cpne1 knockout (KO) mice by deleting exons 2–14 of the Cpne1 gene using CRISPR/Cas 9 (Fig. 2A). This region does not contain any functional elements such as genes or non-coding RNAs. After genotyping using PCR, we obtained the F2 generation for each genotype in which the mice from the F2 generation complied with the principles of Mendelian inheritance (WT: HE: KO = 26:42:22 during the study). F2 mice with a homozygous Cpne1 mutant allele were designated as KO mice, and litters with the wild-type (WT) allele were used as controls (Fig. 2B). qRT-PCR results showed that Cpne1 RNA was absent in the testes of KO mice (Fig. 2C). No immunofluorescent CPNE1 signals were detected in the sections prepared from the testes of KO mice, indicating that Cpne1 was successfully deleted (Fig. 3D).
Fig. 2.
Generation of Cpne1 KO mice. (A) Schematic showing strategy of generation of Cpne1 KO mice by removing exons 2 to 14 of the CPNE1 gene using CRISPR/Cas9. Sequences for primers I, II and III are listed in Table 3. (B) PCR genotyping of F2 offspring. WT, wild-type; HO, homozygote; HE, heterozygote. (C) qRT-PCR analyses for validation of deletion of the Cpne1 gene. *** P < 0.001.
Next, we investigated the effects of Cpne1 deletion on spermatogenesis. No significant histomorphological differences were observed between seminiferous tubules of the testes from WT and KO mice. All sperm stages were observed in the KO mouse testes, and cell hierarchy and number of germ cells were comparable to those of WT mice upon testing at 8 and 12 weeks of age (Fig. 3E). No significant differences were observed between the KO and WT mice epididymi, and epididymal tubules contained the same density of sperm (Figs. 3F and I). Furthermore, weights of the testes and epididymi were comparable between WT and KO mice (Figs. 3G and H). Fertility testing also revealed that Cpne1 KO male mice showed no significant differences in pregnancy rates and mean litter size compared to those in WT males (Figs. 3J and K). These results suggest that Cpne1 deficiency does not impair testicular development or spermatogenesis in mice.
Loss of Cpne1 did not impair sperm motility
Next, we investigated whether CPNE1 was required for sperm motility. We used computer-assisted semen analysis (CASA) to determine sperm motility and movement patterns. As shown in Fig. 4A, loss of Cpne1 led to reduced sperm motility, although this change was not statistically significant. A moderate reduction in the proportion of sperms exhibiting rapid movement (type a) and a slight increase in the proportion of immobile sperms (type d) was observed in KO mice (Figs. 4B–E). Furthermore, no significant differences were observed in terms of other movement parameters of sperms, including the average path velocity (VAP), curvilinear velocity (VCL), straight-line velocity (VSL), amplitude of lateral head displacement (ALH), beat cross frequency (BCF), straightness (STR, VSL/VAP), linearity (LIN, VSL/VCL), sperm head area, and elongation ratio (Figs. 4F–N). These results suggest that the loss of Cpne1 does not induce significant changes in sperm motility or motility patterns in physiological conditions.
Fig. 4.
CASA analyses to determine sperm motility and movement of epididymal sperms obtained from WT and KO mice. (A) Comparison of total sperm motility. (B–E) Comparison of sperm movement. type a motility (rapid progression, B), type b motility (low and sluggish progression, C), type c motility (non-progression, D), type d motility (non-motile, E). Scale bars represent percentages. (F–N) Comparison of other parameters of sperm movement. VAP, average path velocity; VCL, curvilinear velocity; VSL, straight line velocity; ALH, amplitude of lateral head displacement; BCF, beat cross frequency; STR, straightness; LIN, linearity. n = 6 for each group, at least 200 sperm from each mouse were analyzed. ns, not significant.
Ablation of Cpne1 preserved motility and calcium signals in sperms after treatment with Ca2+ channel inhibitors
To further investigate the function of CPNE1 in sperm motility, adult KO and WT mice were administered gadolinium (III) chloride (GdCl3) or 2-aminoethoxydiphenyl borate (2-APB), inhibitors of store-operated Ca2+ entry [21, 22]. Because Ca2+ flux is essential for sperm activation and acrosome reactions [1, 2], we used these two chemicals to impede the Ca2+ flux and tested whether CPNE1 was involved. After treatment, epididymal sperms were collected for morphological and motility analyses. No significant differences were observed in sperm counts or morphology of sperms from either the WT or KO mice after treatment (Fig. 5A), indicating that these two inhibitors did not affect spermatogenesis or sperm maturation. Although sperm motility of WT mice was significantly compromised by the inhibitors (P < 0.01), KO mice sperms were resistant to the inhibitors and maintained their motility (Fig. 5B). The proportion of sperms with type A and B motility in WT mice was notably reduced (P < 0.05), whereas type D motility increased (P < 0.05) in response to the inhibitors. However, there were no significant changes in these parameters in KO sperms (Figs. 5C–F). These results suggest that deletion of Cpne1 prevented changes in sperm motility after Ca2+ deprivation as a result of GdCl3 or 2-APB administration.
Fig. 5.
Sperm morphology and motility in WT and KO mice after inhibitor treatment. (A) Morphological examination of sperms using H&E staining. (B–F) Analyses of sperm motility using CASA. n = 6 for each group, at least 200 sperm from each mouse were analyzed. * P < 0.05. ** P < 0.01. ns, not significant. Scale bars = 100 μm.
Our analysis showed that CPNE1 was strongly expressed in sperm flagella (Fig. 6A); therefore, we used a fluorescent probe to visualize Ca2+ signals in sperm smears. Ca2+ signals were concentrated in the sperm midpiece of WT and KO mice, and there were no differences in signal intensity between sperms from the two groups (Fig. 6B), which was consistent with the observation that WT and KO sperms exhibited similar motility. Following treatment with GdCl3 and 2-APB, Ca2+ signals in WT sperms were significantly reduced, however, were significantly preserved in KO sperms (P < 0.05; Fig. 6C). These results suggest that the absence of Cpne1 prevented Ca2+ deprivation upon GdCl3 and 2-APB treatment, thereby preserving sperm motility.
Fig. 6.
Detection of Ca2+ fluorescence signals in WT and KO sperms after inhibitor treatment. (A) Immunofluorescence for CPNE1 in WT and KO sperms. (B) Ca2+ fluorescence signals in sperms obtained from WT and KO mice after inhibitor treatment. (C) Quantification of results in B. n = 6 for each group, at least 200 sperm from each mouse were analyzed. Scale bars = 10 μm. (D) qRT-PCR analyses for Cpne genes in WT and KO mice testes. n = 3 for each group.
Discussion
In this study, we collected testicular biopsy samples from patients with clinical OA and NOA for iTRAQ proteomic analysis. We detected marked reduction in CPNE1 protein levels in the testes of patients with NOA, indicating that reduced CPNE1 expression may be implicated in spermatogenic disorders. Immunohistochemistry results showed that CPNE1 was expressed in the testicular germ cells. CPNE1 was specifically associated with the Golgi apparatus, however, was not expressed in mature acrosomes. We found that KO mice did not exhibit significant defects in testicular development, spermatogenesis, sperm maturation, or motility (Fig. 7). However, KO mice were resistant to the Ca2+ channel inhibitors GdCl3 and 2-APB and maintained physiological sperm motility (Fig. 7). These results demonstrate that the loss of Cpne1 does not disrupt spermatogenesis or sperm motility, and preserves sperm motility upon Ca2+ deprivation via GdCl3 and 2-APB administration (Fig. 7).
Fig. 7.
Diagram showing the potential role of CPNE1 and function of inhibitors in WT and Cpne1 KO mice. (A) In WT mice, the activity of calcium-dependent CPNE1 and other CPNEs plays a crucial role in sensing calcium signals and regulating sperm motility in physiological conditions. (B) In Cpne1-KO mice, other CPNEs (e.g., CPNE4 and CPNE8, which are upregulated) may compensate for the effect of Cpne1 deficiency on sperm motility. (C) In WT mice, when store-operated Ca2+ entry was blocked upon administration of GdCl3 or 2-APB, Ca2+ binding to CPNEs was decreased, leading to reduction in sperm motility. (D) While in Cpne1-KO mice, increased expression of other CPNEs may maintain calcium signaling and sperm motility.
CPNE1 is a calcium-dependent phospholipid-binding protein that is ubiquitously expressed in various tissues and organs [16]. Previous functional studies showed that CPNE1 is implicated in proliferation, colony formation, invasion and metastasis of various cancer cells [23,24,25,26,27,28], in which, the PI3K/AKT/HIF-1α [23], MET [24] and the AKT-GLUT1/HK2 signaling [26] pathways are involved. CPNE1 regulates neuronal cell differentiation [29,30,31] and myogenesis [32]. However, no previous study has characterized the expression and function of CPNE1 in male germ cells. Thus, we knocked out Cpne1 in mice and found that systematic deletion of Cpne1 did not perturb physical or testicular development, indicating that the loss of Cpne1 did not disturb histogenesis or organogenesis, despite its extensive distribution. There were also no significant differences in sperm counts, morphology, or motility between sperms from WT and KO mice, although CPNE1 was specifically expressed in spermatocytes, indicating that deletion of Cpne1 did not affect spermatogenesis, sperm maturation, or motility in physiological conditions. These results indicate differential requirements of CPNE1 in germ cells and somatic or cancerous cells. This also suggests that downregulation of CPNE1 in testes of patients with NOA is a secondary effect of spermatogenic disorders. This phenomenon may also be attributed to compensation by other CPNE subtypes. qRT-PCR results revealed that Cpne4 and Cpne8 were upregulated, while Cpne7 was downregulated in Cpne1-KO mice (Fig. 6D), indicating that CPNE4 and CPNE8 may compensate for the loss of Cpne1 and that CPNE7 may be associated with CPNE1 function. Therefore, it would be interesting to examine the roles of these three subtypes in spermatogenesis and motility [33].
Capacitative Ca2+ entry, the process by which mobilization of stored Ca2+ induces Ca2+ influx into the plasmalemma [34], may contribute to testosterone activity. Capacitive Ca2+ entry requires both, a Ca2+-permeable channel and a mechanism by which the concentration of Ca2+ in the storage is monitored. In somatic cells, the stromal interaction molecule (STIM) is expressed in the membrane of the endoplasmic reticulum and can detect the luminal concentration of Ca2+. Upon storage mobilization, STIM is redistributed into the ‘puncta’ adjacent to the plasma membrane, where it activates Ca2+-permeable store-operated channels (SOCs) [35]. SOC proteins include the Orai family (also known as the CRACM family) and possibly members of the transient receptor potential canonical family, which may form heterologous tetramers with Orai protein subunits [36,37,38]. It has been established that 2-APB inhibits store-operated Ca2+ entry predominantly by disrupting STIM1/Orai1 coupling and signaling [39, 40]. Consistent with these reports, Ca2+ signals in sperms of WT mice were significantly reduced upon 2-APB treatment, which was accompanied by a significant decline in sperm motility. Although Cpne1 deletion did not alter Ca2+ signaling in sperm flagella in physiological conditions, it preserved Ca2+ concentration and sperm motility in the presence of 2-APB and GdCl3. These results suggest that CPNE1 is not necessary for maintaining calcium homeostasis in germ cells in physiological conditions; however, it potentially acts in response to external stimuli, such as Ca2+ deprivation. CPNE1 is presumably required for STIM ‘puncta’ formation along the plasma membrane to mediate calcium-dependent targeting of proteins to various intracellular locations, including the plasma membrane and the nucleus. Supporting this, we found that CPNE1 is expressed in the Golgi apparatus and mediates the translocation of STIM to the plasma membrane. It is possible that 2-APB directly inhibits CPNE1, thereby interfering with CPNE1-mediated STIM translocation and subsequent activity of Ca2+-permeable channels (Fig. 7). We observed that Ca2+ signals were significantly reduced in WT sperms following 2-APB treatment, however, not in KO sperms. In addition, it is probable that CatSper is activated and functionally compensates for the loss of Cpne1, thereby preserving Ca2+ concentration and motility of sperms in a manner resistant to the inhibitory effects of 2-APB. Furthermore, although GdCl3 is a known mechanosensitive Ca2+ channel blocker [21], in our experiments, the administration of GdCl3 induced effects similar to those of 2-APB. Therefore, these compounds share the same pharmacological targets or signaling pathways within sperms.
In conclusion, we found that CPNE1 protein levels were significantly reduced in the testes of patients with NOA compared to those in patients with OA. By generating Cpne1 KO mice, we found that loss of Cpne1 did not lead to defects in testicular development, spermatogenesis, or sperm motility. However, Cpne1 deficiency notably preserved Ca2+ signals and sperm motility upon treatment with Ca2+ channel inhibitors (2-APB and GdCl3). In this study we characterized roles of CPNE1 in male fertility and will help us understand the regulation of Ca2+ signals and motility in sperms.
Conflict of interests
The authors declare no conflict of interest.
Acknowledgments
This work was supported by the National Natural Science Foundation of China [32171113, 31972910, 32200931], Guangdong Basic and Applied Basic Research Foundation [2023B1515020017, 2022A1515110513, 2021A1515010774], The Science and Technology Project of Guangzhou [2023A03J0376], Foshan Science and Technology Innovation Project [2220001005685], The Science and Technology Project of Panyu District [2021-Z04-062], and The Scientific Program of Dongguan People’s Hospital [K202022].
References
- 1.O’Toole CM, Arnoult C, Darszon A, Steinhardt RA, Florman HM. Ca(2+) entry through store-operated channels in mouse sperm is initiated by egg ZP3 and drives the acrosome reaction. Mol Biol Cell 2000; 11: 1571–1584. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Wassarman PM, Jovine L, Litscher ES. A profile of fertilization in mammals. Nat Cell Biol 2001; 3: E59–E64. [DOI] [PubMed] [Google Scholar]
- 3.Darszon A, Nishigaki T, Wood C, Treviño CL, Felix R, Beltrán C. Calcium channels and Ca2+ fluctuations in sperm physiology. Int Rev Cytol 2005; 243: 79–172. [DOI] [PubMed] [Google Scholar]
- 4.Cisneros-Mejorado A, Sánchez Herrera DP. cGMP and cyclic nucleotide-gated channels participate in mouse sperm capacitation. FEBS Lett 2012; 586: 149–153. [DOI] [PubMed] [Google Scholar]
- 5.Xie M, Zhang G, Zhang H, Chen F, Chen Y, Zhuang Y, Huang Z, Zou F, Liu M, An G, Kang X, Chen Z. Adenylate kinase 1 deficiency disrupts mouse sperm motility under conditions of energy stress. Biol Reprod 2020; 103: 1121–1131. [DOI] [PubMed] [Google Scholar]
- 6.Suarez SS, Pacey AA. Sperm transport in the female reproductive tract. Hum Reprod Update 2006; 12: 23–37. [DOI] [PubMed] [Google Scholar]
- 7.Okabe M. Sperm-egg interaction and fertilization: past, present, and future. Biol Reprod 2018; 99: 134–146. [DOI] [PubMed] [Google Scholar]
- 8.Suarez SS, Ho HC. Hyperactivation of mammalian sperm. Cell Mol Biol (Noisy-le-grand) 2003; 49: 351–356. [PubMed] [Google Scholar]
- 9.Olson SD, Fauci LJ, Suarez SS. Mathematical modeling of calcium signaling during sperm hyperactivation. Mol Hum Reprod 2011; 17: 500–510. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Ren D, Navarro B, Perez G, Jackson AC, Hsu S, Shi Q, Tilly JL, Clapham DE. A sperm ion channel required for sperm motility and male fertility. Nature 2001; 413: 603–609. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Carlson AE, Westenbroek RE, Quill T, Ren D, Clapham DE, Hille B, Garbers DL, Babcock DF. CatSper1 required for evoked Ca2+ entry and control of flagellar function in sperm. Proc Natl Acad Sci USA 2003; 100: 14864–14868. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Carlson AE, Quill TA, Westenbroek RE, Schuh SM, Hille B, Babcock DF. Identical phenotypes of CatSper1 and CatSper2 null sperm. J Biol Chem 2005; 280: 32238–32244. [DOI] [PubMed] [Google Scholar]
- 13.Jin J, Jin N, Zheng H, Ro S, Tafolla D, Sanders KM, Yan W. Catsper3 and Catsper4 are essential for sperm hyperactivated motility and male fertility in the mouse. Biol Reprod 2007; 77: 37–44. [DOI] [PubMed] [Google Scholar]
- 14.Qi H, Moran MM, Navarro B, Chong JA, Krapivinsky G, Krapivinsky L, Kirichok Y, Ramsey IS, Quill TA, Clapham DE. All four CatSper ion channel proteins are required for male fertility and sperm cell hyperactivated motility. Proc Natl Acad Sci USA 2007; 104: 1219–1223. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Creutz CE, Tomsig JL, Snyder SL, Gautier MC, Skouri F, Beisson J, Cohen J. The copines, a novel class of C2 domain-containing, calcium-dependent, phospholipid-binding proteins conserved from Paramecium to humans. J Biol Chem 1998; 273: 1393–1402. [DOI] [PubMed] [Google Scholar]
- 16.Tomsig JL, Creutz CE. Biochemical characterization of copine: a ubiquitous Ca2+-dependent, phospholipid-binding protein. Biochemistry 2000; 39: 16163–16175. [DOI] [PubMed] [Google Scholar]
- 17.Cowland JB, Carter D, Bjerregaard MD, Johnsen AH, Borregaard N, Lollike K. Tissue expression of copines and isolation of copines I and III from the cytosol of human neutrophils. J Leukoc Biol 2003; 74: 379–388. [DOI] [PubMed] [Google Scholar]
- 18.Rizo J, Südhof TC. C2-domains, structure and function of a universal Ca2+-binding domain. J Biol Chem 1998; 273: 15879–15882. [DOI] [PubMed] [Google Scholar]
- 19.Tomsig JL, Snyder SL, Creutz CE. Identification of targets for calcium signaling through the copine family of proteins. Characterization of a coiled-coil copine-binding motif. J Biol Chem 2003; 278: 10048–10054. [DOI] [PubMed] [Google Scholar]
- 20.Perestenko PV, Pooler AM, Noorbakhshnia M, Gray A, Bauccio C, Jeffrey McIlhinney RA. Copines-1, -2, -3, -6 and -7 show different calcium-dependent intracellular membrane translocation and targeting. FEBS J 2010; 277: 5174–5189. [DOI] [PubMed] [Google Scholar]
- 21.Sakamoto Y, Ishijima M, Kaneko H, Kurebayashi N, Ichikawa N, Futami I, Kurosawa H, Arikawa-Hirasawa E. Distinct mechanosensitive Ca2+ influx mechanisms in human primary synovial fibroblasts. J Orthop Res 2010; 28: 859–864. [DOI] [PubMed] [Google Scholar]
- 22.DeHaven WI, Smyth JT, Boyles RR, Bird GS, Putney JW, Jr. Complex actions of 2-aminoethyldiphenyl borate on store-operated calcium entry. J Biol Chem 2008; 283: 19265–19273. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Cao J, Cao R, Liu Y, Dai T. CPNE1 mediates glycolysis and metastasis of breast cancer through activation of PI3K/AKT/HIF-1α signaling. Pathol Res Pract 2023; 248: 154634. [DOI] [PubMed] [Google Scholar]
- 24.Wang A, Yang W, Li Y, Zhang Y, Zhou J, Zhang R, Zhang W, Zhu J, Zeng Y, Liu Z, Huang JA. CPNE1 promotes non-small cell lung cancer progression by interacting with RACK1 via the MET signaling pathway. Cell Commun Signal 2022; 20: 16. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Choi HY, Lee HJ, Moon KM, Moon DK, Lee S, Park H, Hong J, Park MJ, Woo DK, Yoo JC. Up-regulation of CPNE1 appears to enhance cancer progression in HER2-positive and luminal a breast cancer cells. Anticancer Res 2022; 42: 3445–3452. [DOI] [PubMed] [Google Scholar]
- 26.Wang Y, Pan S, He X, Wang Y, Huang H, Chen J, Zhang Y, Zhang Z, Qin X. CPNE1 enhances colorectal cancer cell growth, glycolysis, and drug resistance through regulating the AKT-GLUT1/HK2 pathway. OncoTargets Ther 2021; 14: 699–710. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Jiang Z, Jiang J, Zhao B, Yang H, Wang Y, Guo S, Deng Y, Lu D, Ma T, Wang H, Wang J. CPNE1 silencing inhibits the proliferation, invasion and migration of human osteosarcoma cells. Oncol Rep 2018; 39: 643–650. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Liu S, Tang H, Zhu J, Ding H, Zeng Y, Du W, Ding Z, Song P, Zhang Y, Liu Z, Huang JA. High expression of Copine 1 promotes cell growth and metastasis in human lung adenocarcinoma. Int J Oncol 2018; 53: 2369–2378. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Choi HY, Park N, Lee B, Choe YI, Woo DK, Park JY, Yoo JC. CPNE1-mediated neuronal differentiation can be inhibited by HAX1 expression in HiB5 cells. Biochem Biophys Res Commun 2020; 533: 319–324. [DOI] [PubMed] [Google Scholar]
- 30.Kim TH, Sung SE, Cheal Yoo J, Park JY, Yi GS, Heo JY, Lee JR, Kim NS, Lee DY. Copine1 regulates neural stem cell functions during brain development. Biochem Biophys Res Commun 2018; 495: 168–173. [DOI] [PubMed] [Google Scholar]
- 31.Park N, Yoo JC, Ryu J, Hong SG, Hwang EM, Park JY. Copine1 enhances neuronal differentiation of the hippocampal progenitor HiB5 cells. Mol Cells 2012; 34: 549–554. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Chen L, Pan L, Zeng Y, Zhu X, You L. CPNE1 regulates myogenesis through the PERK-eIF2α pathway mediated by endoplasmic reticulum stress. Cell Tissue Res 2023; 391: 545–560. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Tomsig JL, Creutz CE. Copines: a ubiquitous family of Ca(2+)-dependent phospholipid-binding proteins. Cell Mol Life Sci 2002; 59: 1467–1477. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Putney JW. Capacitative calcium entry: from concept to molecules. Immunol Rev 2009; 231: 10–22. [DOI] [PubMed] [Google Scholar]
- 35.Cahalan MD. STIMulating store-operated Ca(2+) entry. Nat Cell Biol 2009; 11: 669–677. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Yuan JP, Zeng W, Huang GN, Worley PF, Muallem S. STIM1 heteromultimerizes TRPC channels to determine their function as store-operated channels. Nat Cell Biol 2007; 9: 636–645. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Liao Y, Plummer NW, George MD, Abramowitz J, Zhu MX, Birnbaumer L. A role for Orai in TRPC-mediated Ca2+ entry suggests that a TRPC:Orai complex may mediate store and receptor operated Ca2+ entry. Proc Natl Acad Sci USA 2009; 106: 3202–3206. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Cheng KT, Liu X, Ong HL, Ambudkar IS. Functional requirement for Orai1 in store-operated TRPC1-STIM1 channels. J Biol Chem 2008; 283: 12935–12940. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Yamashita M, Somasundaram A, Prakriya M. Competitive modulation of Ca2+ release-activated Ca2+ channel gating by STIM1 and 2-aminoethyldiphenyl borate. J Biol Chem 2011; 286: 9429–9442. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Wei M, Zhou Y, Sun A, Ma G, He L, Zhou L, Zhang S, Liu J, Zhang SL, Gill DL, Wang Y. Molecular mechanisms underlying inhibition of STIM1-Orai1-mediated Ca2+ entry induced by 2-aminoethoxydiphenyl borate. Pflugers Arch 2016; 468: 2061–2074. [DOI] [PMC free article] [PubMed] [Google Scholar]






