Abstract
Non-small cell lung cancer (NSCLC), which accounts for up to 85 % of lung cancer cases, significantly impacts the health of individuals worldwide. While targeted therapy has played a crucial role, the emergence of EGFR resistance and adverse reactions has made it imperative to explore new medications. Natural products derived from plants became an important source of anti-tumor drugs. In this study, nine known compounds, including seven alkaloids (1–7) and two styryllactones (8 and 9) were isolated from twigs and leaves of Goniothalamus yunnanensis. Their structures were elucidated by their NMR spectroscopic data. Among them, griffithazanone A (1) showed the strongest inhibitory activity with the IC50 value of 6.775 μM. Our findings revealed that griffithazanone A treatment induced cytotoxicity, apoptosis, and ROS generation in A549 cells in a dose-dependent manner. It regulates the expression of apoptosis-related proteins Bax, Bcl-2, and cleaved-caspase3 both in vitro and in vivo. Further investigation demonstrated that griffithazanone A regulated the proteins involved in the ASK1/JNK/p38 and BAD/Bcl-2 pathways in A549 cells by targeting PIM1. Moreover, griffithazanone A treatment enhanced the efficacy of gefitinib and osimertinib and reversed osimertinib resistance. Overall, our study highlights the potential of griffithazanone A in inhibiting the progression of NSCLC by targeting PIM1 and reversing resistance to EGFR targeted drugs.
Keywords: Griffithazanone A, PIM1, Apoptosis, Osimertinib resistant
1. Introduction
Lung cancer (LC) accounts for a large proportion of cancer and is very common which causes nearly 1.8 million deaths every year, according to the global cancer statistics in 2020, lung cancer accounts for a high proportion of global incidence rate and mortality, 8.11 % and 6.18 % respectively [1]. The causes of cancer include smoking, living environment and lifestyle, lung disease, and other factors [2]. A few cases of LC are small cell lung cancers (SCLC), while the majority are non-small cell lung cancers (NSCLC) [3,4]. Targeted therapy for epidermal growth factor receptor (EGFR) has changed the treatment status of lung cancer, but only a small number of patients benefit, with the majority being NSCLC that cannot receive targeted therapy. Therefore, combination chemotherapy is mainly used in clinical practice, and drug resistance is prone to develop during the treatment process [5].
For decades, natural products derived from plants became an important source of anti-tumor drugs [6]. Goniothalamus yunnanensis W. T. Wang, belonging to the genus Goniothalamus of the family of Annonaceae, are distributed in Southern Yunnan province, China with different growth habits of small trees or shrubs [7]. Phytochemical studies on this plant species led to the isolation and identification of various classes of secondary metabolites, including alkaloids, styryllactones, dihydroflavones and triterpenoids, some of which showed the remarkable cytotoxic effects against HCC1806, HCT116, and HeLa tumor cells [8]. In summary, it is worth studying the anti-cancer active ingredients and their potential mechanisms in the Goniothalamus plants, which may lead to more discovery of antineoplastic.
The imbalance of cell apoptosis promotes many diseases, in cancer, cells do not receive apoptotic signals, leading to more cell proliferation than cell death. Thus, cancer could be treated by promoting cancer cell apoptosis [9]. The Bcl-2 protein family were composed of pro-apoptotic and anti-apoptotic proteins, which play a key role in apoptosis regulation [10]. In addition, studies have shown that regulating cell apoptosis may affect the sensitivity of tumor cells to chemotherapy [11].
EGFR tyrosine kinase inhibitors (EGFR-TKIs) have good initial efficacy in a small number of lung cancer patients with EGFR mutations [12,13]. However, More than 60 % of patients develop drug resistance after several months of medication [14]. Clinical trials are exploring the possibility of combining EGFR-TKIs with various other therapies, such as the use of chemotherapy drugs in combination [15].
Herein, we found that griffithazanone A (GA) extracted from G. yunnanensis promotes apoptosis of NSCLC cells and enhances the sensitivity of A549 cells to Osimertinib by targeting PIM1 to regulate downstream BAD/Bcl-2 and ASK1/JNK/p38 signaling pathways.
2. Materials and methods
2.1. Extraction and isolation
The detailed extraction and separation process can be found in supporting information.
2.2. Cell lines and cell culture
A549 cells were cultured in RPMI-1640 medium supplemented with 10 % FBS at 37 °C in a 5 % CO2 atmosphere.
2.3. Cell viability assay
The MTT assay was also employed to assess the cell viability of nine compounds extracted from Goniothalamus yunnanensis to lung cancer cells. A549 cells were treated with 50 μM compound 1–9 for 48h. Then, 20 μL MTT (5 mg/ml) was added to cells for 4h, the formed purple crystals were dissoved by DMSO and the absorbance was recorded at 570 nm (Mutiskan FC, Thermo, USA).
The MTT assay was also employed to assess the cytotoxic impact of griffithazanone A. A549 cells were treated with various concentrations of griffithazanone A (dissoved in DMSO) for 48 h. Subsequently, 5 mg/ml of MTT (Thiazolyl Blue) solution was introduced. Following a 4-h incubation period, absorbance was recorded at 570 nm (Mutiskan FC, Thermo, USA). The obtained data was analyzed for the IC50 of GA by GraphPad Prism 9.0.
2.4. Wound healing assay
A549 cells were seeded in 24-well plates and scratch wounds were created using sterile pipette tips. The cells were then treated with griffithazanone A at concentrations of 0.5, 1, and 2 μM. The progression of wound closure was monitored at various time points using an inverted microscope (Nikon, Japan) and subsequently quantified using Image J software (NIH USA).
2.5. Colony formation assay
A549 cells (300 per well) were cultured with varying concentrations of griffithazanone A (0, 0.5, 1, and 2 μM) for 10 days. The resulting cell colonies were fixed with 4 % formalin and then stained with a 1 % crystal violet solution (Solarbio, Beijing, China). Following a washing step, the colonies were photographed using a camera and enumerated under a microscope (Nikon, Japan).
2.6. Flow cytometry analysis
A549 cells in 6-well culture plates were exposed to griffithazanone A at final concentrations of 0, 0.5, 1, and 2 μM for 48 h. Subsequently, the cells were detached using EDTA-free pancreatin, washed with PBS, and stained with the Annexin V-FITC Apoptosis Detection Kit. The percentage of apoptotic cells (10,000 cells per sample) was quantified using a flow cytometer (BD LSRFortessa), with data analysis conducted using FlowJo software.
2.7. Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay
The TUNEL Assay kit (Solarbio) was employed to detect apoptotic cells in A549 cells. A549 cells (1 × 104 per 250 μL) were exposed to griffithazanone A for 48 h, followed by staining with a TUNEL reagent. Fluorescence analysis of the cells stained with DAPI post-treatment was conducted using laser scanning confocal microscopy (Leica, TCS SP8).
2.8. Cellular thermal shift assay (CETSA)
In the context of molecular biotechnology, Cellular Thermal Shift Assay (CETSA) is utilized to investigate interactions between intracellular proteins and ligands. This method involves subjecting cell lysates to varying temperatures and subsequently conducting Western blotting to assess alterations in protein thermal stability [16]. For the experiment with A549 cells, the procedure involved treating the cells with griffithazanone A (2 μM) for 4 h. Following this treatment, the cells were harvested by centrifugation, resuspended, and the cell lysate was divided into six equal portions. Each lysate was then exposed to different temperatures (45, 50, 55, 60, 65, and 70 °C) for 5 min. Following the heating process, the lysate were rapidly frozen in liquid nitrogen. This freezing and thawing process was repeated three times and then centrifuged for 20 min at 4 °C and 20,000×g. The thermal stability of proteins in the supernatant was evaluated using Western blot analysis.
2.9. Western blotting (WB) analysis
All proteins were extracted from A549 cells and processed as follows: the extracted proteins were separated by SDS-PAGE gel and then transferred to a polyvinylidene fluoride (PVDF) membrane. The PVDF membrane was blocked with 5 % fat-free milk for 1 h. Monoclonal antibodies against various proteins were used for incubation on the membrane. These antibodies included GAPDH (cat.AF7021), Tubulin (cat.AF7011), PIM (cat.AF08441), ASK1 (cat.AF6477), p-ASK1 (cat.AF3476), JNK (cat.AF6318), p-JNK (cat.AF3318), p38 (cat.AF6456), p-p38 (cat.AF4001), BAD (cat.AF6471), p-BAD (cat.AF7427), foxo3a (cat.AF6020), p-foxo3a (cat.AF3020), caspase3 (cat.AF6311), cleaved caspase3 (cat.AF7022), Bax (cat.AF0120), Bcl-2 (cat.AF6139), MDR-1 (cat.AF5185), and H2AX (cat.AF6187) from Affinity. The PVDF membrane was then washed with PBST three times. Subsequently, the membrane was incubated with a secondary antibody (diluted at 1:10,000) at 4 °C for 2 h. Finally, imaging was developed using chemiluminescence reagents (Affinity).
2.10. RNA extraction and quantitative real-time PCR (qRT-PCR)
The total RNA from A549 was extracted using the Trizol reagent. After extraction, the concentration of the RNA was measured using a microspectrophotometer, which enables precise quantification of nucleic acids by measuring their absorbance. Subsequently, cDNA was synthesized from the RNA samples. Quantitative real-time PCR was then conducted using unicon qPCR SYBR Green Master Mix (Yeason, Shanghai, China). Primer sequences of Bcl-2, Bax and GAPDH were shown in Table 1.
Table 1.
Primer sequence for qRT-PCR.
| Gene symbol | Forward primer | Reverse primer |
|---|---|---|
| Bcl-2 | AACATCGCCCTGTGGATGAC | AGAGTCTTCAGAGACAGCCAGGAG |
| Bax | AGACAGGGGCCTTTTTGCTA | AATTCGCCGGAGACACTCG |
| GAPDH | GCACCGTCAAGGCTGAGAAC | TGGTGAAGACGCCAGTGGA |
2.11. Determination of ROS production
To detect ROS generation in A549 cells, the Reactive Oxygen Species Assay Kit was utilized, employing the fluorescence probe DCFH-DA. A549 cells were collected and diluted to a concentration ranging from 1 × 106 to 2 × 107 cells/mL, followed by an incubation at 37 °C for 20 min. Subsequently, the cells were washed to eliminate unbound DCFH-DA. Next, 100 μL of the A549 cell suspension was added to each well of a 96-well plate and analyzed using a fluorescence enzyme-linked immunosorbent assay.
2.12. Construction of PIM1 knockdown and osimertinib-resistant cell lines
The shPIM1 (GeneCopoeia, Guangzhou, China) was transfected into A549 cells using a Liposome transfection reagent (Yeason, Shanghai, China). Subsequently, untransfected cells were eliminated through purinomycin selection. To establish a drug-resistant A549 cell line, cells were cultured in Osimertinib ranging from 0 to 12 μM for 48 h. Initially, cells were cultured with 1 μM Osimertinib, and surviving cells were collected and cultured for an additional 48 h. The Osimertinib dose was then incrementally increased using the same method until reaching 12 μM.
2.13. Animal studies
Female BALB/c nude mice (6–8 weeks old, weighing 20–25 g) were procured from Charles River Laboratories in Beijing, China. The animal experimental protocol adhered to the Health Guide for Care from the National Institutes of Health (NIH Publications No. 8023, revised 1978). All animal care and experimental procedures were conducted in accordance with the guidelines approved by the Institutional Animal Care and Use Committee (IACUC) of Nankai University (Permit No. SYXK 2014–0003). 1 × 106 A549 cells were injected subcutaneously into the dorsal side of mice using a sterile syringe to construct a xenograft tumor model. After the tumor volume reached 100 mm3, the mice were randomly divided into 3 groups: control group, Cisplatin (1.5 mg/kg) group and griffithazanone (1.5 mg/kg) group. Intraperitoneal injection was used to treat mice with normal saline, DDP (Cisplatin, 1.5 mg/kg) and griffithazanone A(1.5 mg/kg) every other day, respectively. The treatment lasted for 28 days, during which the tumor volume and body weight of the mice were recorded every other day.
2.14. Immunohistochemistry
The tumor tissue was fixed in 4 % tissue fixative for 48 h. Subsequently, the tissue underwent dehydration, soaking, and embedding in molten paraffin. Once solidified, the paraffin block was sliced into thin sections with a thickness of 4 μm. Following dewaxing, the sections were hydrated in various concentrations of ethanol. The slices were then immersed in citric acid antigen repair solution and subjected to batch heating in a microwave for 30 min. After a 10-min soak in hydrogen peroxide, they were washed with PBS, sealed with 3 % BSA for 30 min, and exposed to the antibody diluted with BSA at a ratio of 1:200 overnight at 4 °C. Following three times PBS washes, the sections were incubated with the secondary antibody at room temperature for 1 h. DAB staining was employed on the sections, followed by hematoxylin staining and mounting with neutral resin. Images were captured using a microscope (Olympus).
2.15. Statistical analysis
All experiments were conducted in triplicates at minimum, and all statistical analyses were carried out using GraphPad Prism 8.0. The data are presented as mean ± standard deviation (SD). The t-test was employed to compare the significant difference of the means between the two groups. Quantification of all results was performed using ImageJ software (NIH, Bethesda, MD, USA). ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001, ∗∗∗∗p < 0.0001, #p < 0.05, ##p < 0.01, ###p < 0.001, and ####p < 0.0001 were considered statistically significant.
3. Results
3.1. Structural identification of compounds 1–9
The EtOAc-soluble layer from the methanol extract of the twigs and leaves of G. yunnanensis yielded seven known alkaloids (1–7) and two known styryllactones (8 and 9) (Fig. 1). The known compounds were identified as griffithazanone A (1)[17], squamolone (2)[18], piperumbellactam A (3)[19], aristolactam AⅡ (4)[20], goniopedaline (5)[21], enterocarpam-II (6)[21], noraristolodione (7)[22], 7, 8-di-O-acetylgoniodiol (8)[23], and (+)-goniodiol (9)[23] by comparison of experimental and reported NMR data. Compounds 1–3, 5, 7–9 were isolated from G. yunnanensis for the first time.
Fig. 1.
Chemical structures of compounds 1–9.
3.2. Griffithazanone A inhibited the proliferation, migration, colony formation and promoted apoptosis of A549 cells
In order to determine the antitumor activity of nine compounds isolated from the twigs and leaves of G. yunnanensis, MTT assay was used to detect the effect of compounds 1–9 on the viability of A549 cells. The results were shown in Fig. 2a. Among them, griffithazanone A (compound 1) showed the most significant inhibitory activity with the IC50 value of 6.775 μM (Fig. 2b). Subsequently, we cultured A549 cells with different concentrations of griffithazanone A (0.5, 1, and 2 μM) for 0, 24, 48, and 72 h, and made proliferation curve. As shown in Fig. 2c, the proliferation of A549 cells was inhibited, and the inhibitory effect increased significantly with concentration. Data of 24 h wound healing showed the inhibitory effect of the griffithazanone A on cell migration (Fig. 2d and e). The migration ability of A549 cells was significantly inhibited after treatment of griffithazanone A compared with the blank group. The effect of inhibitory was enhanced with the increase of concentration. Then the results revealed the inhibitory effect of griffithazanone A on the colony formation ability of A549 cells, the colony counts of the A549 cells treated with the griffithazanone A are less than that of the blank group (Fig. 2f and g). Taken together, these data indicated that griffithazanone A could inhibit the proliferation, migration, and colony formation of A549 cells.
Fig. 2.
Effect of griffithazanone A on proliferation and apoptosis of A549 cells. (a) Detect the effect of compounds 1–9 on the cell viability of A549 cells. (b) MTT assay was used to determine the IC50 value of griffithazanone A on A549 cells. (c) Evaluate the effect of griffithazanone A on proliferation in A549 cells by MTT, treated with griffithazanone A (0, 0.5, 1, 2 μM) for 0, 24, 48, and 72 h. (d, e) Cell migration was detected by wound healing assay. (f, g) The colony formation of A549 cells was inhibited upon exposure to griffithazanone A. (h, i) Flow cytometric detection of apoptosis in griffithazanone A-treated A549 cells. The percentages of cells in each quadrant were calculated. (j, k) TUNEL staining shows the number of apoptotic cells, and counted the proportion of apoptotic cells to all cells. ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001, ∗∗∗∗p < 0.0001.
For further evaluate the anti-apoptosis ability of griffithazanone A, flow cytometry was used to detect the apoptosis rate of A549 cells treated with griffithazanone A. As shown in Fig. 2h and i, the percentage of apoptosis of A549 cells treated with 0.5, 1, and 2 μM griffithazanone A was 21.90 %(9.9 % early phase apoptotic and 12 % late phase apoptotic), 24.10 % (12.5 % early phase apoptotic and 11.6 % late phase apoptotic)and 25 %(17.8 % early phase apoptotic and 7.2 % late phase apoptotic), respectively. Moreover, the results of the TUNEL assay intuitively showed that griffithazanone A promoted apoptosis of A549 cells. Compared with the control group, griffithazanone A significantly increased the number of TUNEL positive cells, and the number increased with increasing concentration (Fig. 2j and k). Accordingly, these results indicated that griffithazanone A promoted apoptosis in A549 cells.
3.3. Griffithazanone A promotes the ASK1/JNK/p38 pathway mediated cell apoptosis by targeting PIM1
In order to explore the molecular mechanism of griffithazanone A acting on A549 cells, the target of griffithazanone A were predicted by the PharmMapper websites, and the results showed that PIM1 was the most potential target. Further, the molecular docking results of Fig. 3a showed that griffithazanone A bind to PIM1 at the PHE-254/PRO-241/GLU-247/GLN-252/ARG-250. And the docking score, calculated by autodock software, was −7.69, which predicted a strong combination of griffithazanone A and PIM1. Based on these results, CETSA experiments were used to verify the binding of griffithazanone A to PIM1. In Fig. 3b and c, the combination of griffithazanone A and PIM1 makes the PIM1 protein more difficult to degrade at the same temperature than the DMSO group because the binding of the target protein to the drug molecule became stable.
Fig. 3.
Griffithazanone A targeted PIM1, regulated downstream ASK1/JNK/p38 and BAD/Bcl-2 pathways, and promoted apoptosis in A549 cells. (a) The docking stick model of griffithazanone A combining with the PHE-254/PRO-241/GLU-247/GLN-252/ARG-250 domain of PIM1. Molecular docking score achieved −7.69. (b, c) Cellular thermal shift assay (CETSA): Used PBS as a negative control, quantitatively analyzed of the binding of griffithazanone A and PIM1 in A549 cells at different temperatures, and evaluated the expression using grayscale analysis. (d–g) Western blot analysis: p-ASK1, ASK1, p-JNK, JNK, p-p38, p38, p-BAD, BAD, p-foxo3a, foxo3a, Bax, Bcl-2, caspase 3 and cleaved-caspase 3 expression and its gray level in A549 cells. Take Tubulin as the internal parameter. (h) qRT-PCR showed the mRNA expression levels of Bax and Bcl-2 in A549 cells. (i) A549 cells were incubated with griffithazanone A (0.5 1 and 2 μM), and then detect the ROS level using a fluorescence enzyme-linked immunosorbent assay. ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001, ∗∗∗∗p < 0.0001.
It has been reported that PIM1 promotes cell apoptosis by acting on downstream factors such as ASK1/JNK/p38 and BAD/Bcl-2 pathways [24], so we detected the phosphorylation levels of ASK1/JNK/p38 pathway proteins by Western blot. The results showed that phosphorylation of ASK1 and BAD was significantly reduced, and correspondingly, phosphorylation of JNK, p38, and foxo3a was increased in concentrations-depended manner in A549 cells after treated with griffithazanone A (0.5 μM, 1 μM, 2 μM) for 48 h (Fig. 3d and e). In addition, as shown in Fig. 3f and g, griffithazanone A promoted the expression of Bax and the generation of cleaved-caspase3. Furthermore, the qRT-PCR results in Fig. 3h also suggested that griffithazanone A promoted the mRNA expression of Bax and reduced the mRNA of Bcl-2. ROS generation is an important marker of oxidative damage and apoptosis in cells, the treatment of griffithazanone A promoted the generation of ROS in A549 cells and in a dose-dependent manner (Fig. 3i). Accordingly, griffithazanone A may target PIM1, and inhibit the progression of NSCLC by affecting the downstream ASK1/JNK/p38 pathway and BAD, promoting apoptosis and oxidative stress in A549 cells.
Moreover, aim to validate our findings, PIM1 was knocked down by shRNA in A549 cells for further verification experiments, the results of transfection were shown in Fig. 4a. Then, sh-PIM1-1 and sh-PIM1-2 groups, which showed better knockdown effects, were used for further experiments. MTT assay was used to detect cell viability at 0, 24, 48, and 72 h, respectively. As shown in Fig. 4b, knockdown of PIM1 and treatment with griffithazanone A inhibited the proliferation of A549 cells, as we expected, in A549 cells with low expression of PIM1, the inhibitory effect of griffithazanone A on proliferation was not enhanced. In addition, the results showed that griffithazanone A had no significant effect on cell migration ability in A549 cells with low expression of PIM1(Fig. 4c and d). Similarly, colony formation ability of A549 cells were decreased following PIM1 knockdown and treatment of griffithazanone A, however, there is no significant difference in the sh-PIM1 and griffithazanone A group compared with the sh-PIM1 group (Fig. 4e and f).
Fig. 4.
Griffithazanone A targeted PIM1, inhibited the proliferation, migration, and cloning of A549 cells. (a) Western blot analysis was used to detect the expression of PIM1 in A549 cells and verify the transfection effect. (b) MTT assay for evaluating the effects of griffithazanone A and PIM1 knockout on the proliferation of A549 cells. (c, d) Cell migration was detected by wound healing assay. Take images of the wound at 0, 12, and 24 h respectively, and measure the migration percentage. (e, f) The colony formation of A549 cells was detected exposure to griffithazanone A (2 μM). sh-PIMI-1, 2, 3 are parallel conditions. +, add a certain processing. -, not add a certain processing. ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001, ∗∗∗∗p < 0.0001.
Furthermore, the effect of apoptosis-related downstream pathways in A549 cells was also verified. The Western blot revealed that both PIM1 knockdown and griffithazanone A promoted the expression of Bax and cleaved-caspase3 and inhibited the expression of Bcl-2, and griffithazanone A did not enhance this effect in A549 cells with PIM1 knockdown (Fig. 5a and b). Accordingly, in terms of the ASK1-JNK/p38 and BAD/Bcl-2 pathways, the effect of griffithazanone A on PIM1 knockdown A549 cells was not significantly different from that of PIM1 knockdown only (Fig. 5c and d). From studies in Fig. 5e, the treatment of PIM1 knockdown A549 cells with griffithazanone A for 48 h and PIM1 knockdown both promoted ROS generation and had the similar effect. Additionally, the qRT-PCR results in Fig. 5f indicated that the mRNA level of Bax increased and Bcl-2 reduced after the knockdown of PIM1. There was no significant regulatory effect in PIM1 knockdown A549 cells treated with griffithazanone A. These findings indicate that griffithazanone A may inhibit NSCLC survival by targeting the PIM1 and facilitating cell apoptosis and affected downstream pathways.
Fig. 5.
Griffithazanone A targeted PIM1, regulated the ASK1/JNK/p38 and BAD/Bcl-2 pathways and promoted apoptosis. (a–d) Western blot analysis: p-ASK1, ASK1, p-JNK, JNK, p-p38, p38, p-BAD, BAD, Bax, Bcl-2, caspase 3 and cleaved-caspase 3 expression and its gray level in A549 cells. Take Tubulin and GAPDH as the internal parameter. (e) A549 cells and PIM1 knockout A549 cells were treated with. griffithazanone A (2 μM), and then detect the ROS level using a fluorescence enzyme-linked immunosorbent assay. (f) qRT-PCR showed the mRNA expression levels of Bax and Bcl-2 in A549 cells. sh-PIMI-1, 2 are parallel conditions. +, add a certain processing. -, not add a certain processing. ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001, ∗∗∗∗p < 0.0001.
3.4. EGFR-TKIs combined with griffithazanone A significantly suppressed the proliferation, migration, and colony formation and promoted apoptosis of A549 cells
EGFR-TKIs had been approved for the treatment of NSCLC patients with EGFR-activated mutations, however, their side effects and drug resistance have attracted attention. As previous studies, the combination of EGFR-TKIs with other medicines can enhance the therapeutic effect and reduce the side effects [25]. In this study, the effects of griffithazanone A combined with gefitinib and osimertinib, respectively, were investigated. Firstly, proliferation curve assay was used to verify the proliferation of A549 cells. The results in Fig. 6a reported that the proliferation of A549 cells was noticeably slowed down when treated with a combination of gefitinib or osimertinib with griffithazanone A, compared to the group treated with only gefitinib or osimertinib. Then, the results of Fig. 6b revealed that gefitinib or osimertinib combined with griffithazanone A can significant increase ROS levels in A549 cells compared to gefitinib or Osimertinib alone. Next, we examined the effect of the combination of griffithazanone A with EGFR-TKIs on cell migration, the results were showed in Fig. 6c and d. The combination of EGFR-TKIs and griffithazanone A markedly increased the anti-migration effect on A549 cells. Consistently, gefitinib and osimertinib prevented colony formation of A549, and the efficacy was enhanced when combined with griffithazanone A (Fig. 6e and f). In addition, we detect the apoptosis rate of A549 cells co-treated with griffithazanone A and EGFR-TKIs (Fig. 6g and h). According to the results of the Annexin V-FITC/PI assay, the combined use of griffithazanone A and EGFR-TKIs resulted in a more potent promotion of cell apoptosis, with a significantly higher rate of apoptosis observed. The results also demonstrated that the combination of griffithazanone A with gefitinib or osimertinib had an amplified effect on inhibiting cell proliferation and migration, inducing apoptosis, and promoting the production of ROS. Altogether, these data suggests that griffithazanone A can increase the sensitivity of A549 cells to gefitinib and osimertinib, currently used in clinical practice, which is conducive to the further clinical application of griffithazanone A.
Fig. 6.
The combination of griffithazanone A and EGFR-TKIs in A549 cells enhanced drug efficacy, inhibited cell proliferation and migration, and promoted cell apoptosis. (a) Evaluate the effect of griffithazanone A combined with gefitinib or osimertinib on proliferation in A549 cells by MTT. (b) Evaluate the effect of griffithazanone A combined with gefitinib or osimertinib on ROS production in A549 cells through fluorescence enzyme-linked immunosorbent assay. (c, d) The wound-healing assay that the effect of griffithazanone A on A549-shPIM1 cells after 24 h. Figure below: Representative images selected from each of the four groups in the scratch test. Figure above: Quantitative analysis of changes in wound length. (e, f) Colony formation indicates the effect of griffithazanone A on the cloning ability of A549-shPIM1 cells. (g, h) Effect of griffithazanone A on apoptosis of A549-shPIM1 cells and A549 cells detected by flow cytometry. ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001, ∗∗∗∗p < 0.0001, #p < 0.05, ##p < 0.01, ###p < 0.001, and ####p < 0.0001.
3.5. Griffithazanone A can enhance the sensitivity of A549/OS cells to osimertinib
Here, we investigated the role of griffithazanone A in TKI resistance and selected osimertinib, which is widely used in clinical practice, as the representative inhibitor in this study. Thus, we established an osimertinib-resistant A549 cell line. Western blot was used to evaluate the effect of griffithazanone A on the expression of resistance marker protein MDR-1 and H2AX in A549 and A549/OS cells, respectively. The levels of MDR-1 and H2AX were not affected by griffithazanone A in normal A549 cells, however, compared with A549 cells, the expression of MDR1 was significantly increased in A549/OS cells but decreased after 2 μM griffithazanone A treatment, and griffithazanone A markedly upregulated the expression of H2AX in A549/OS cells (Fig. 7a and b). Subsequently, we measured the viability of A549 cells and osimertinib-resistant A549 cells exposed to varying osimertinib concentrations for 48 h. The results showed that at the same concentration of osimertinib, A549/OS cells showed higher cell viability than A549 cells (Fig. 7c), which indicates that compare to A549 cells, A549/OS cells were resistant to osimertinib treatment. Then, based on this condition, griffithazanone A significantly increased sensitivity of A549/OS cells to osimertinib-induced cytotoxicity (Fig. 7d). To further clarify the role of griffithazanone A in enhancing the sensitivity of A549/OS cells to osimertinib, we observed the morphology of osimertinib-resistant A549 cells under different conditions under the microscope and verified it by TUNEL assay and colony formation experiment. According to the morphological display of osimertinib-resistant A549 cancer cells, griffithazanone A treatment enhanced osimertinib-induced toxicity in vitro (Fig. 7e). Cell proliferation was inhibited by griffithazanone A-osimertinib combination detected by colony formation assay. The results showed that, the ability of osimertinib to inhibit cloning became more significant in A549/OS cells through treatment of griffithazanone A (Fig. 7g and h). Similarly, TUNEL assay results showed that the combination of griffithazanone A and osimertinib significant promote the apoptosis of A549/OS cells compared to osimertinib group (Fig. 7f–i). Together, the findings above showed that griffithazanone A greatly enhanced the sensitivity of resistant cells to osimertinib.
Fig. 7.
The combination of griffithazanone A and osimertinib in A549/OS cells enhanced the sensitivity of A549/OS cells to Osimertinib, inhibited cell proliferation, and promoted cell apoptosis. (a, b) Western blot analysis was used to detected MDR-1 and H2AX expression and its gray level in A549 and A549/OS cells. Take Tubulin as the internal parameter. (c, d) MTT was used to detect the cell viability of A549 and A549/OS cells in different concentration gradients of osimertinib. A549/OS cells were incubated with griffithazanone A (2 μM) for 48 h, and the cell viability was observed in different concentrations of osimertinib by MTT compared to the control group. (e) The morphology of A549/OS cells under different conditions were observed under the microscope. (f, i) TUNEL staining shows the number of apoptotic cells, and counted the proportion of apoptotic cells to all cells. (g, h) Colony formation is used to detect the ability of griffithazanone A to reverse the clonal ability of A549/OS cells against osimertinib resistance. ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001, ∗∗∗∗p < 0.0001.
3.6. Griffithazanone A suppresses NSCLC tumor growth and promotes the apoptosis of tumor cells in vivo
For further revealing the efficacy of griffithazanone A in vivo, we established a xenograft tumor model by injecting A549 cells subcutaneously into the nude mice. In our research, we found that griffithazanone A inhibited tumor growth and and had almost no effect on mice weight, reduce the protein level of PIM1 in tumors, regulated the ASK1/JNK/p38 and BAD/Bcl-2 pathways and promoted tumor cell apoptosis. Tumor xenografts treated with griffithazanone A grew slower than those treated with normal saline, and similar to those treated with DDP. On 21st day of administration, the tumor volumes and weight of griffithazanone A treatment group were smaller than those treated with normal saline, indicating a potential role of griffithazanone A in inhibiting tumor progression (Fig. 8a–d). Furthermore, IHC staining was used to detect the expression levels of PIM1, p-JNK, p-ASK1, p-BAD, p-p38, and Bcl-2 in tumor tissues. As shown in Fig. 8e, the expression level of p-JNK and p-p38 increased, the expression levels of PIM1 and Bcl-2 decreased, and the phosphorylation level of ASK1 and BAD reduced. In summary, griffithazanone A suppressed the progression of NSCLC by reducing the level of PIM1 and affecting ASK1/JNK/p38 and BAD/Bcl-2 pathways in vivo.
Fig. 8.
Griffithazanone A suppresses NSCLC tumor growth and promotes the apoptosis of tumor cells in vivo. (a) Image of tumor tissue in model (A549), DDP (1.5mpk) group and griffithazanone A (1.5mpk) treated group. (b) Comprehensive statistics and comparison of average tumor volume in the model group, cisplatin group, and griffithazanone A treatment group. (c) Statistical chart of changes in mice body weight during administration. (d) Statistics and comparison of tumor weight between model group, DDP group and griffithazanone A-treated group. (e) Immunohistochemical staining analysis of PIM1, Bcl-2, p-ASK1, p-JNK, p-p38 and p-BAD in the tumor tissues. ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001, ∗∗∗∗p < 0.0001.
4. Discussion
Medicinal plants were rich in natural products, which had important guiding significance for the discovery of new drugs. Indeed, in recent years, more and more anticancer drugs designed, synthesized, and discovered based on natural products had been applied in clinical treatment [26]. Many studies have suggested that many of the components extracted from Goniothalamus plants showed activities of anticancer, such as significant selective cytotoxicity toward the nasopharyngeal carcinoma cell line [27]. It has been reported that the Goniothalamus extract promotes the apoptosis of human bladder cancer cells [28]. Therefore, the chemical constituents from G. yunnanensis and those anticancer activities were investigated. As a result, nine compounds were isolated from the G. yunnanensis methanol extract. Among them, griffithazanone A, an azaanthraquinones derivative, demonstrated the highest cytotoxicity with an IC50 value of 6.775 μM. In previous report, the cytotoxicity of griffithazanone A was tested in oral cancer cells (KB) and cervical cancer cells (HeLa), and it showed a good inhibitory effect, suggesting its potential in anti-cancer, but its pharmacological effects and target had not been explored in depth [29]. In this study, we found that griffithazanone A significantly inhibited the proliferation, migration and colony formation and promoted cell apoptosis of NSCLC. Besides, we found that PIM1 may be the target of griffithazanone A by molecular docking and CETSA experiments.
PIM1 is a serine/threonine kinase that can regulate carcinogenic processes, such as hypoxia, cell cycle, migration, and apoptosis [24]. As a potent oncogene, PIM1 is overexpressed in cancers such as gastrointestinal cancer, head and neck cancer and lung cancer [[30], [31], [32]]. Furthermore, according to reports, PIM1 may also be a factor leading to resistance to radiotherapy and chemotherapy in pancreatic and lung cancer [33]. It has reported that PIM1 can inactivate ASK1 through phosphorylation, which reduces the activity of stress kinases JNK and p38, this ultimately leads to a reduction in caspase 3 activation and cell death [24]. Therefore, research on the properties, functions, and promotion of various cancer processes by PIM1 suggests that it may be a promising new drug target. In our study, we found that griffithazanone A regulated the BAD/Bcl-2 and ASK1/JNK/p38 pathways downstream of PIM1, and regulated apoptosis-related factors Bcl-2, Bax, and caspase 3, promoting apoptosis and ROS generation in A549 cells. Accordingly, knocking down PIM1 in A549 cells inhibited the proliferation, migration and colony formation and promoted cell apoptosis, but the above effects were not enhanced after the treatment of griffithazanone A in PIM1 knockdown A549 cells, indicating that the effect of griffithazanone A may be achieved by targeting PIM1. All in all, PIM1 might be a promising target for the clinical treatment of NSCLC.
Epidermal growth factor receptor (EGFR) mutations were recognized as the major target in NSCLC, and for patients with clinical NSCLC carrying EGFR-activating mutations, TKIs have been approved for treatment [34]. Firstly, the first-generation of EGFR-TKIs such as erlotinib and gefitinib were developed, followed by improvements to the second generation of EGFR-TKIs such as afatinib and dacomitinib, as well as the widely used third generation of osimertinib [35]. Targeted therapy for cancer carrying oncogenic gene mutations in clinical practice has improved the treatment status of advanced NSCLC and improved treatment prospects, however, the development of resistance was almost universal, so it is important and urgent to find new treatment strategies [35]. The drug combination was a potential therapeutic strategy. Many studies had found that the combination of chemotherapy drugs and EGFR-TKIs could enhance efficacy and reduce drug resistance during drug treatment[[36], [37], [38]]. In this study, we found the synergistic sensitization of griffithazanone A with EGFR-TKIs in vitro. Combination with EGFR-TKIs could indeed inhibit the proliferation and migration of A549, promote ROS production, and promote cell apoptosis. Furthermore, our results also showed that griffithazanone A reversed the resistance of A549/OS cells to osimertinib, and A549/OS cells were more sensitive to the effects of osimertinib on promoting apoptosis, ROS production, and inhibiting cell proliferation by downregulating MDR-1 expression and upregulating H2AX expression. In summary, our results suggest that the combination of griffithazanone A and EGFR-TKIs is an effective and promising treatment method and strategy for advanced EGFR-mutated NSCLC, and providing new possibilities for the design of future clinical treatment.
5. Conclusion
In this research, we first found the target of griffithazanone A. Griffithazanone A inhibits proliferation, migration, colony formation and promotes apoptosis through ASK1/JNK/P38 and BAD/Bcl-2 pathways by targeting PIM1. Griffithazanone A also enhance sensitization of EGFR-TKIs and reverse EGFR-TKIs resistant. Overall, we point out the clinical potential of griffithazanone A in the treatment of NSCLC.
Ethics approval and consent to participate
All animal care and experimental procedures conformed to guidelines approved by the Institutional Animal Care and Use Committee (IACUC) of Nankai University (Permit No. SYXK 2014-0003).
Consent for publication
All authors agree to publish all data.
Funding
This study was supported by the National Natural Science Foundation of China [Grant 82203779]; the National Natural Science Foundation of China [Grant 8237112165] and the Foundation of Organ Fibrosis Drug Ability Joint Research Centre of Nankai and Guokaixingcheng [Grant 735-F1040051].
Data availability statement
No data was used for the research described in the article.
CRediT authorship contribution statement
Ting Xiao: Writing – review & editing, Writing – original draft, Project administration, Investigation, Funding acquisition, Data curation. Yuxin Zhu: Writing – original draft, Investigation, Formal analysis, Data curation. Liang Zhang: Investigation, Formal analysis, Data curation. Kaidi Xiao: Investigation, Formal analysis, Data curation. Xiao Jia: Investigation, Formal analysis, Data curation. Yashu Liu: Formal analysis, Data curation. Junfang Bi: Formal analysis, Data curation. Xiaoping Li: Supervision, Conceptualization. Honggang Zhou: Supervision. Cheng Yang: Supervision, Project administration, Funding acquisition, Conceptualization.
Declaration of competing interest
The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.
Acknowledgments
This study was supported by the 111 Project B20016. This study was also partially supported by a grant from The Program of Science and Technology Plan of the City of Tianjin (No. 24JRRCRC00040).
Footnotes
Supplementary data to this article can be found online at https://doi.org/10.1016/j.heliyon.2024.e38489.
Contributor Information
Ting Xiao, Email: tingxiao@nankai.edu.cn.
Yuxin Zhu, Email: z15265724088@163.com.
Liang Zhang, Email: 07190818@163.com.
Kaidi Xiao, Email: xiaokaidi2022@163.com.
Xiao Jia, Email: 1120210643@mail.nankai.edu.cn.
Yashu Liu, Email: liuyashu99@163.com.
Junfang Bi, Email: feiyufeiyou@126.com.
Xiaoping Li, Email: horaceli@nankai.edu.cn.
Honggang Zhou, Email: honggang.zhou@nankai.edu.cn.
Cheng Yang, Email: cheng.yang@nankai.edu.cn.
Appendix A. Supplementary data
The following are the Supplementary data to this article:
References
- 1.Sung H., Ferlay J., Siegel R.L., Laversanne M., Soerjomataram I., Jemal A., Bray F. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA A Cancer J. Clin. 2021;71:209–249. doi: 10.3322/caac.21660. [DOI] [PubMed] [Google Scholar]
- 2.Bade B.C., Dela Cruz C.S. Lung cancer 2020. Clin. Chest Med. 2020;41:1–24. doi: 10.1016/j.ccm.2019.10.001. [DOI] [PubMed] [Google Scholar]
- 3.Travis W.D., Brambilla E., Burke A.P., Marx A., Nicholson A.G. Introduction to the 2015 world health organization classification of tumors of the lung, pleura, thymus, and heart. J. Thorac. Oncol. 2015;10:1240–1242. doi: 10.1097/JTO.0000000000000663. [DOI] [PubMed] [Google Scholar]
- 4.Gridelli C., Rossi A., Carbone D.P., Guarize J., Karachaliou N., Mok T., Petrella F., Spaggiari L., Rosell R. Non-small-cell lung cancer. Nat. Rev. Dis. Prim. 2015;1 doi: 10.1038/nrdp.2015.9. [DOI] [PubMed] [Google Scholar]
- 5.Wang M., Herbst R.S., Boshoff C. Toward personalized treatment approaches for non-small-cell lung cancer. Nat. Med. 2021;27:1345–1356. doi: 10.1038/s41591-021-01450-2. [DOI] [PubMed] [Google Scholar]
- 6.Yang Y., Liu Q., Shi X., Zheng Q., Chen L., Sun Y. Advances in plant-derived natural products for antitumor immunotherapy. Arch Pharm. Res. (Seoul) 2021;44:987–1011. doi: 10.1007/s12272-021-01355-1. [DOI] [PubMed] [Google Scholar]
- 7.Editorial Committee of the Flora of China Chinese Academy of Sciences . vol. 30. Science Press; Beijing: 1979. p. 70. (Flora of China). [Google Scholar]
- 8.Ji H., Zhang J., Wang Q., Zhang X., Zuo A., Wang H. Chemical constituents and their antitumor activity from Goniothalamus yunnanensis. Tianran Chanwu Yanjiu Yu Kaifa. 2021;33:1871–1879. [Google Scholar]
- 9.Wong R.S.Y. Apoptosis in cancer: from pathogenesis to treatment. J. Exp. Clin. Cancer Res. 2011;30 doi: 10.1186/1756-9966-30-87. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.O'Neill J., Manion M., Schwartz P., Hockenbery D.M. Promises and challenges of targeting Bcl-2 anti-apoptotic proteins for cancer therapy. Biochim. Biophys. Acta Rev. Canc. 2004;1705:43–51. doi: 10.1016/j.bbcan.2004.09.004. [DOI] [PubMed] [Google Scholar]
- 11.Minn A.J., Rudin C.M., Boise L.H., Thompson C.B. Expression of bcl-xL can confer a multidrug resistance phenotype. Blood. 1995;86:1903–1910. [PubMed] [Google Scholar]
- 12.Rossi A., Pasquale R., Esposito C., Normanno N. Should epidermal growth factor receptor tyrosine kinase inhibitors be considered ideal drugs for the treatment of selected advanced non-small cell lung cancer patients? Cancer Treat Rev. 2013;39:489–497. doi: 10.1016/j.ctrv.2012.09.001. [DOI] [PubMed] [Google Scholar]
- 13.Santarpia M., Menis J., Chaib I., Gonzalez Cao M., Rosell R. Dacomitinib for the first-line treatment of patients with EGFR-mutated metastatic non-small cell lung cancer. Expet Rev. Clin. Pharmacol. 2019;12:831–840. doi: 10.1080/17512433.2019.1649136. [DOI] [PubMed] [Google Scholar]
- 14.Iwama E., Nakanishi Y., Okamoto I. Combined therapy with epidermal growth factor receptor tyrosine kinase inhibitors for non–small cell lung cancer. Expet Rev. Anticancer Ther. 2018;18:267–276. doi: 10.1080/14737140.2018.1432356. [DOI] [PubMed] [Google Scholar]
- 15.Patil V.M., Noronha V., Joshi A., Choughule A.B., Bhattacharjee A., Kumar R., Goud S., More S., Ramaswamy A., Karpe A., Pande N., Chandrasekharan A., Goel A., Talreja V., Mahajan A., Janu A., Purandare N., Prabhash K. Phase III study of gefitinib or pemetrexed with carboplatin in EGFR-mutated advanced lung adenocarcinoma. ESMO Open. 2017;2 doi: 10.1136/esmoopen-2017-000168. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Molina D.M., Jafari R., Ignatushchenko M., Seki T., Larsson E.A., Dan C., Sreekumar L., Cao Y., Nordlund P. Monitoring drug target engagement in cells and tissues using the cellular thermal shift assay. Science. 2013;341:84–87. doi: 10.1126/science.1233606. [DOI] [PubMed] [Google Scholar]
- 17.Zhang Y.-J., Kong M., Chen R.-Y., Yu D.-Q. Alkaloids from the roots of goniothalamus griffithii. J. Nat. Prod. 1999;62:1050–1052. doi: 10.1021/np990004l. [DOI] [PubMed] [Google Scholar]
- 18.Zhao G.X., Rieser M.J., Hui Y.H., Miesbauer L.R., Smith D.L., McLaughlin J.L. Biologically active acetogenins from stem bark of Asimina triloba. Phytochemistry. 1993;33:1065–1073. doi: 10.1016/0031-9422(93)85024-l. [DOI] [PubMed] [Google Scholar]
- 19.Tabopda T.K., Ngoupayo J., Liu J., Mitaine-Offer A.-C., Tanoli S.A.K., Khan S.N., Ali M.S., Ngadjui B.T., Tsamo E., Lacaille-Dubois M.-A., Luu B. Bioactive aristolactams from Piper umbellatum. Phytochemistry. 2008;69:1726–1731. doi: 10.1016/j.phytochem.2008.02.018. [DOI] [PubMed] [Google Scholar]
- 20.Liu X., Chen Z., Li X., Xu Q., Yang S. Chemical constituents from leaves of Uvaria microcarpa. Zhongcaoyao. 2011;42:2197–2199. [Google Scholar]
- 21.Yang X.-N., Jin Y.-S., Zhu P., Chen H.-S. Amides from uvaria microcarpa. Chem. Nat. Compd. 2010;46:324–326. [Google Scholar]
- 22.Thienthiti K., Tuchinda P., Wongnoppavich A., Anantachoke N., Soonthornchareonnon N. Cytotoxic effect of compounds isolated from Goniothalamus marcanii Craib stem barks. Pharm Sci Asia. 2017;44:86–95. [Google Scholar]
- 23.Surivet J.-P., Goré J., Vatèle J.-M. Enantioselective synthesis of (+)-goniodiol and of its naturally occurring acetylated analogs. Tetrahedron. 1996;52:14877–14890. [Google Scholar]
- 24.Merkel A.L., Meggers E., Ocker M. PIM1 kinase as a target for cancer therapy. Expet Opin. Invest. Drugs. 2012;21:425–436. doi: 10.1517/13543784.2012.668527. [DOI] [PubMed] [Google Scholar]
- 25.Vicencio J.M., Evans R., Green R., An Z., Deng J., Treacy C., Mustapha R., Monypenny J., Costoya C., Lawler K., Ng K., De-Souza K., Coban O., Gomez V., Clancy J., Chen S.H., Chalk A., Wong F., Gordon P., Savage C., Gomes C., Pan T., Alfano G., Dolcetti L., Chan J.N.E., Flores-Borja F., Barber P.R., Weitsman G., Sosnowska D., Capone E., Iacobelli S., Hochhauser D., Hartley J.A., Parsons M., Arnold J.N., Ameer-Beg S., Quezada S.A., Yarden Y., Sala G., Ng T. Osimertinib and anti-HER3 combination therapy engages immune dependent tumor toxicity via STING activation in trans. Cell Death Dis. 2022;13 doi: 10.1038/s41419-022-04701-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Balunas M.J., Kinghorn A.D. Drug discovery from medicinal plants. Life Sci. 2005;78:431–441. doi: 10.1016/j.lfs.2005.09.012. [DOI] [PubMed] [Google Scholar]
- 27.Lan Y.-H., Chang F.-R., Yu J.-H., Yang Y.-L., Chang Y.-L., Lee S.-J., Wu Y.-C. Cytotoxic styrylpyrones from goniothalamus amuyon. J. Nat. Prod. 2003;66:487–490. doi: 10.1021/np020441r. [DOI] [PubMed] [Google Scholar]
- 28.Zhang R., Che X., Zhang J., Li Y., Li J., Deng X., Zhu J., Jin H., Zhao Q., Huang C. vol. 7. 2016. (Cheliensisin A (Chel A) Induces Apoptosis in Human Bladder Cancer Cells by Promoting PHLPP2 Protein Degradation). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Tip-pyang S., Limpipatwattana Y., Khumkratok S., Siripong P., Sichaem J. A new cytotoxic 1-azaanthraquinone from the stems of Goniothalamus laoticus. Fitoterapia. 2010;81:894–896. doi: 10.1016/j.fitote.2010.05.019. [DOI] [PubMed] [Google Scholar]
- 30.Holder L.S., Abdulkadir A.S. PIM1 kinase as a target in prostate cancer: roles in tumorigenesis, castration resistance, and docetaxel resistance. Curr. Cancer Drug Targets. 2014;14:105–114. doi: 10.2174/1568009613666131126113854. [DOI] [PubMed] [Google Scholar]
- 31.Nawijn M.C., Alendar A., Berns A. For better or for worse: the role of Pim oncogenes in tumorigenesis. Nat. Rev. Cancer. 2010;11:23–34. doi: 10.1038/nrc2986. [DOI] [PubMed] [Google Scholar]
- 32.Shah N., Pang B., Yeoh K.-G., Thorn S., Chen C.S., Lilly M.B., Salto-Tellez M. Potential roles for the PIM1 kinase in human cancer – a molecular and therapeutic appraisal. European Journal of Cancer. 2008;44:2144–2151. doi: 10.1016/j.ejca.2008.06.044. [DOI] [PubMed] [Google Scholar]
- 33.Wanyeon K., HyeSook Y., Ki Moon S., Hee Jung Y., Young Ju Y., TaeWoo K., Young Ha K., Ji Young L., Young-Woo J., BuHyun Y. PIM1-Activated PRAS40 regulates radioresistance in non-small cell lung cancer cells through interplay with FOXO3a, 14-3-3 and protein phosphatases. Radiat. Res. 2011;176:539–552. doi: 10.1667/rr2609.1. [DOI] [PubMed] [Google Scholar]
- 34.Ohmori T., Yamaoka T., Ando K., Kusumoto S., Kishino Y., Manabe R., Sagara H. Molecular and clinical features of EGFR-TKI-associated lung injury. Int. J. Mol. Sci. 2021;22 doi: 10.3390/ijms22020792. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Sankar K., Gadgeel S.M., Qin A. Molecular therapeutic targets in non-small cell lung cancer. Expet Rev. Anticancer Ther. 2020;20:647–661. doi: 10.1080/14737140.2020.1787156. [DOI] [PubMed] [Google Scholar]
- 36.Lei T., Xu T., Zhang N., Zou X., Kong Z., Wei C., Wang Z. Anlotinib combined with osimertinib reverses acquired osimertinib resistance in NSCLC by targeting the c-MET/MYC/AXL axis. Pharmacol. Res. 2023;188 doi: 10.1016/j.phrs.2023.106668. [DOI] [PubMed] [Google Scholar]
- 37.Twum Y., Marshall K., Gao W. Caffeic acid phenethyl ester surmounts acquired resistance of AZD9291 in non-small cell lung cancer cells. BioFactors n/a. 2023 doi: 10.1002/biof.1983. [DOI] [PubMed] [Google Scholar]
- 38.Zhou, Y., Huang, S., Guo, Y., Ran, M., Shan, W., Chen, W.-H., Tam, K. Y., 2023. Epigallocatechin gallate circumvents drug-induced resistance in non-small-cell lung cancer by modulating glucose metabolism and AMPK/AKT/MAPK axis. Phytother Res. n/a. [DOI] [PubMed]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
No data was used for the research described in the article.








