Isolation and characterization of lytic bacteriophage vB_KpnP_23: A promising antimicrobial candidate against carbapenem-resistant Klebsiella pneumoniae

Highlights

• •Phage vB_KpnP_23 lyses nine different capsule types of CRKP.
• •Phage vB_KpnP_23 lacks virulence/resistance genes, ideal for clinical use.
• •Phage vB_KpnP_23 represents a new species within the genus Przondovirus.
• •Phage vB_KpnP_23 and antibiotics synergistically reduce MIC values against CRKP.

Abstract

The global health threat posed by carbapenem-resistant Klebsiella pneumoniae (CRKP) is exacerbated by the limited availability of effective treatments. Bacteriophages are promising alternatives to conventional antimicrobial agents. However, current phage databases are limited. Thus, identifying and characterizing new phages could provide biological options for the treatment of multi-drug resistant bacterial infections. Here, we report the characterization of a novel lytic phage, vB_KpnP_23, isolated from hospital sewage. This phage exhibited potent activity against carbapenemase-producing CRKP strains and was characterised by an icosahedral head, a retractable tail, and a genome comprising 40,987 base pairs, with a G + C content of 51 %. Capable of targeting and lysing nine different capsule types (K-types) of CRKP, including the clinically relevant ST11-K64, it demonstrated both high bacteriolytic efficiency and stability in various environmental contexts. Crucially, vB_KpnP_23 lacks virulence factors, antimicrobial resistance genes, or tRNA, aligning with the key criteria for therapeutic application. In vitro evaluation of phage-antibiotic combinations revealed a significant synergistic effect between vB_KpnP_23 and meropenem, levofloxacin, or amikacin. This synergy could lead to an 8-fold reduction in the minimum inhibitory concentration (MIC), suggesting that integrated treatments combining this phage with the aforementioned antibiotics may substantially enhance drug effectiveness. This approach not only extends the clinical utility of these antibiotics but also presents a strategic advance in combating antibiotic resistance. Specifically, it underscores the potential of phage-antibiotic combinations as a powerful tool in the treatment of infections caused by CRKP, offering a promising avenue to mitigate the public health challenges of antibiotic-resistant pathogens.

1. Introduction

Klebsiella pneumoniae (K. pneumonia), a common gram-negative bacterium belonging to the family Enterobacteriaceae, is a major human multidrug-resistant (MDR) pathogen. It is considered one of the most common causes of community-acquired infections, such as urinary tract infections (UTIs), pneumonia, bloodstream infections, liver abscesses, wound infections, and sepsis (Bengoechea and Sa Pessoa, 2019; Feng et al., 2023). K. pneumoniae can cause serious infections of the urinary tract, lungs, abdominal cavity, intravascular devices, surgical sites, and soft tissues (Shon et al., 2013).

Carbapenem-resistant K. pneumoniae (CRKP) originated from the widespread use of carbapenem antibiotics (Yigit et al., 2001). CRKP has been listed as a “critical” priority pathogen by the World Health Organization and poses a great threat to human health (Tacconelli et al., 2018). It has spread globally and poses a significant threat because of the very limited therapeutic options against it (McKenna, 2013). Therefore, researchers have focused on developing novel antimicrobial agents. Recently, phage therapy was identified as an alternative approach for treating infections caused by antimicrobial-resistant bacteria, including CRKP (Chang et al., 2022).

Phages have been used to treat lung infections in patients with transplants, as well as bone and joint infections caused by MDR pathogens (Van Nieuwenhuyse et al., 2022; Ferry et al., 2022). Successful cases using phages to treat patients with CRKP infections have been reported worldwide in the last few years; therefore, phages have the potential to solve the issues faced in the post-antibiotic era (Nir-Paz and Kuijper, 2023). Bacteriophages are viruses that can effectively infect and lyse bacteria (Van Nieuwenhuyse et al., 2022). However, the current phage databases are still limited (Parmar et al., 2017). Identifying and studying new phages could enrich phage databases and provide biological options for the treatment of MDR bacterial infections.

Here, we isolated a novel lytic phage, vB_KpnP_23, from hospital sewage using the CRKP clinical strain JNKPN23 as the host bacterium and explored its potential suitability for use as a biocontrol agent against CRKP infections.

2. Materials and methods

2.1. Bacterial strains

The CRKP clinical strain, JNKPN23, was used for phage isolation. To examine the lysis spectrum of this phage, 57 CRKP strains isolated from various clinical sources were used.

2.2. Phage isolation

Wastewater samples were collected from Shandong Province Hospital using capsular type K64 K. pneumoniae JNKPN23 as the host strain. Host bacteriophages were isolated using a double-layer agar (DLA) technique. To prepare the samples, 100 mL of wastewater was added to 0.6 g CaCl₂ for 10 min, followed by centrifugation at 12,000 × g for 10 min at 4 °C. The supernatant was filtered through a 0.22 μm filter to remove bacterial debris. Then, 400 μL of host culture at the logarithmic phase and 20 mL of LB broth were added to 20 mL of filtered sewage supernatants. The co-culture was incubated at 160 rpm and 37 °C for 4 h and then centrifuged at 12,000 × g for 5 min at 4 °C. Then, the supernatants were filtered through 0.22 µm filters. The filtered supernatant (100 µL) was mixed with 900 µL of a K. pneumoniae JNKPN23 culture at the logarithmic phase (10-fold dilution) and incubated at 37 °C for 10 min. The mixture was then added to 9 mL of top agar (0.7 %) and poured onto a 1.5 % LB agar plate. After overnight incubation at 37 °C, the phage plaques were formed. A single plaque was picked and soaked in SM buffer. The DLA method was repeated at least three times until the purified phage was obtained, which was stored at 4 °C.

2.3. Transmission electron microscopy (TEM)

Phage particles (1 × 10⁹ PFU/ml) were dropped onto carbon-coated copper grids for 10 min and then stained with a drop of 2.0 % phosphotungstic acid. The morphology of vB_KpnP_23 was visualised using a transmission electron microscope (JEM-1200EX, JEOL, Japan) at an acceleration voltage of 80 kV.

2.4. Expression and purification of the phage depolymerase

TFP (Dep_46), a putative phage depolymerase, was amplified from the purified phage vB_KpnP_23 by PCR using the primers TFP_E_F (5′- CCGGAATTC ATGGACCAAGATACTAAAACAATCAT −3′) and TFP_H_R (5′- CCCAAGCTTTTATGCGTTCAGGTACACCC −3′). The PCR fragment was excised with EcoRI and HindⅢ and inserted into the pET-28a expression vector. The constructed plasmid was used to transform E. coli BL21 cells. The TFP protein was expressed under 0.1 mM isopropyl β-d-1-thiogalactopyranoside (IPTG) induction at 16 °C overnight. Cells were pelleted and suspended in lysis buffer (50 mM Tris–HCl [pH 8.0], 300 mM NaCl) and disrupted by three freeze-thaw cycles and sonication (8 to 10 cycles with 30-s pulses and 30-s pauses). The protein was purified from the soluble fraction using a Ni-NTA column according to the manufacturer's instructions, and then analyzed using sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE).

2.5. Phage and depolymerase activity spectrum

To assess the host range of activity of vB_KpnP_23 and its recombinant depolymerase, Dep_46, spot assays were conducted using 57 different K. pneumoniae strains characterized by various sequence types (STs). The bacteria were grown to the logarithmic phase, and then 100 μL of this culture was combined with 9 mL of 0.7 % top agar and spread on a solid medium base. This setup created a double-layered agar plate within minutes. Subsequently, 10 μL of either the phage vB_KpnP_23 at a concentration of 10⁸ PFU/mL or the purified enzyme at 1 μM was applied to the top agar layer. These plates were then incubated overnight at 37 °C. The next day, the formation of clear or opaque zones on the bacterial layer indicated the antibacterial effects of the phage and the enzyme, respectively.

2.6. Determination of the optimal multiplicity of infection (MOI)

The MOI is the number of bacteriophages and host bacteria at the time of infection. At the optimal MOI, the phage produces the highest number of progeny phages. The optimal plural infection for the phages and host bacteria was determined as previously described (Li et al., 2022). Briefly, the host bacterial strain JNKPN23 was grown to logarithmic phase, and the colony number was adjusted to approximately 10⁸ CFU/mL. Then, the vB_KpnP_23 and host solutions were mixed (100 μL each) and incubated at 37 °C for 10 min at different MOIs (0, 0.01, 0.1, 1, 10, 100), added to 5 mL LB liquid medium, incubated at 160 rpm for 4 h, and centrifuged at 10,000 rpm for 10 min.

The supernatant was filtered through a 0.22 μm filter membrane. The MOI resulting in the highest titre was considered the optimal MOI, and each independent experiment was repeated three times.

2.7. Phage adsorption and one-step growth

The one-step growth curve was determined as follows: bacterial and phage solutions were mixed at the optimal MOI of 0.1, cultured at 37 °C for 10 min, and then centrifuged at 12,000 × g for 5 min to remove the unabsorbed phage in the supernatant. The precipitate was then resuspended in LB broth three times. The washed mixture was placed in 20 mL of LB broth at 37 °C, and a 1 mL samples was taken and filtered, which was labelled as 0 min. The remaining mixture was incubated at 37 °C and 160 rpm in a shaker. Samples were taken at 10 min intervals within 110 min and then centrifuged to obtain the supernatant. The supernatant was filtered through a 0.22 μm filter and the phage titres were measured using the DLA method. Each independent experiment was repeated thrice.

2.8. Effects of pH and temperature on activity

To test the effects of different temperatures and pH values on the activity of phage vB_KpnP_23, we exposed the phage to different pH and temperature values. 1) Effect of temperature on phage stability: 1 mL samples of the prepared phage solution in 1.5 mL EP tubes were placed in a water bath at different temperatures (37 °C, 50 °C, 60 °C, and 70 °C) and in a 4 °C refrigerator or at −20 °C or −80 °C. After temperature stabilisation for 1 h, the titre was determined by the DLA method. To determine the pH stability, a 10⁹ PFU/mL phage solution was prepared and 100 μL of the solution was added to 900 μL LB of different pH (2–13). The mixture was placed in a 37 °C water bath for 1 h, with phage titre of each pH group on the side. Each independent experiment was repeated thrice.

2.9. Phage genomic DNA extraction, sequencing, and analysis

We extracted the genome of the isolated phage using the QIAamp1 DNA Mini Kit (QIAGEN, Germany). The phage genome was sequenced using an Illumina HiSeq 2500 platform (Berry Genomics Corp., China). Clean reads were de novo assembled using MetaviralSPAdes. One contig identified as complete viral genome by the Viralverify v1.1 and Viralcomplete underwent a BLASTn search against the Pfam-A database v35.0 (Antipov et al., 2020). To identify putative transfer RNA (tRNA) genes, tRNA scan-SE 2.0 was used (Chan et al., 2021). Sequence annotation of the resulting open reading frames was performed using RAST (https://rast.nmpdr.org), and Blastp was used to identify putative homologies with predicted phage proteins. The virulence factor and drug resistance genes of the phage were analysed using the Abricate v1.0.0 software (https://github.com/tseemann/abricate) in the virulence factor database (VFDB v2024) and comprehensive antibiotic resistance database (CARD v2023), respectively. CGView was used to construct a circular genome map (Grant and Stothard, 2008). The physicochemical properties of the endolysin, holin, and Rz-like lysis proteins from phage vB_KpnP_23 were assessed through ProtParam (Gasteiger et al., 2005). Additionally, the transmembrane domains and signal peptides of these proteins were predicted using THMMM-2.0 (Möller et al., 2001) and SignalP-6.0 (Teufel et al., 2022), respectively. The protein sequence of Dep_46 was analyzed using PHYRE2 (Kelley et al., 2015).

Phage sequences from the NCBI database were analyzed to explore evolutionary connections with phage vB_KpnP_23. Species identity was confirmed by calculating the shared average nucleotide identity (ANI) between genomes using FastANI v1.34 (Jain et al., 2018). Phylogenetic trees for tail fibre proteins were generated using MEGA 11 (Tamura et al., 2021). Additionally, genome analysis identified orthologous gene groups with OrthoFinder (Emms and Kelly, 2019). A maximum likelihood tree, supported by 1000 bootstrap replicates, was constructed using RAxML-NG (Kozlov et al., 2019). Phage genomes were classified using Centrifuge (Kim et al., 2016) and taxonomically visualized with the Pavian (Breitwieser and Salzberg, 2020).

2.10. Phage-antibiotic synergy assay

By calculating the fractional inhibitory concentration index (FICI), the synergistic effect between the isolated phage and the three antibiotics commonly used for K. pneumonia infection (meropenem, amikacin, and levofloxacin) was determined using the chequerboard microdilution method. The method is as follows: vB_KpnP_23 and the antibiotic were serially diluted (1:10 and 1:2, respectively) in a 96-well plate, and the bacterial suspension (10⁵ CFU/mL) was added to each well. The plate was incubated at 37 °C for 16–18 h, after which the MIC was determined by measuring the OD600.The FICI was calculated using the following equations: FICI = C_antibiotic/MIC_antibiotic + C_phage/MIC_phage. Where MIC_antibiotics and MIC_phages are the MICs of the antibiotic and phage alone, respectively. The C_antibiotic and C_phage are the respective concentrations of the antibiotic and phage in combination. A FICI ≤ 0.5 indicates a synergistic effect; 0.5 ˂ FICI ≤ 1 indicates an additive effect; 1 ˂ FICI ≤ 2 indicates no effect; FICI > 2 indicates an antagonistic effect.

3. Results

3.1. Isolation and characterization of the phage

Phage vB_KpnP_23 was isolated from hospital wastewater using K. pneumonia JNKPN23 as the host. This phage produced large, clear plaques (5.0–6.0 mm in diameter) surrounded by halos (Fig. 1A). TEM was used to observe phage morphology and showed that it possessed an icosahedral head of 50–60 nm in diameter and a short tail (Fig. 1B).

Fig. 1.

Morphology of phage vB_KpnP_23.

(A) Phage vB_KpnP_23 plaques. (B) Transmission electron micrograph of phage vB_KpnP_23.

3.2. Activity spectrum of phage vB_KpnP_23 and depolymerase Dep_46

57 CRKP isolates (Hao et al., 2021) were used to determine the depolymerase ability of the expressed depolymerase Dep_46, and the lytic spectrum of phage vB_KpnP_23 was testified simultaneously. Phage vB_KpnP_23 formed clear plaques on 40 strains, specifically those with capsular types K2, K17, K47, K52, K54, K64, K107, K116, and K149, demonstrating a relatively broad lytic range. Notably, phage vB_KpnP_23 lysed all ST11-K64 CRKP strains among the 57 K. pneumoniae strains. Additionally, 38 strains were sensitive to Dep_46. The depolymerase activity spectrum of Dep_46 differed from that of phage vB_KpnP_23 but appeared to be broader, covering 13 capsular types, including additional capsular types K10, K15, K21, and K28 compared to the phage. For the ST11-K64 strains, the results were consistent with those observed for the phage (Table 1).

Table 1.

Activity spectrum of phage vB_KpnP_23 and depolymerase Dep_46.

Strain	ST	K-type	Phage	Dep_46
JNKPN01	ST11	K64	+	+
JNKPN02	ST11	K64	+	+
JNKPN03	ST11	K64	+	+
JNKPN04	ST11	K47	–	–
JNKPN05	ST11	K64	+	+
JNKPN06	ST528	K27	–	–
JNKPN07	ST133	K116	+	+
JNKPN08	ST11	K64	+	+
JNKPN09	ST258	K107	+	+
JNKPN10	ST3924	K25	–	–
JNKPN11	ST11	K64	+	+
JNKPN12	ST2246–2LV	K52	+	+
JNKPN13	ST11	K64	+	+
JNKPN14	ST392	K64	–	–
JNKPN15	ST11	K64	+	+
JNKPN16	ST323	K21	–	+
JNKPN17	ST15	K19	–	–
JNKPN18	ST11	K64	+	+
JNKPN19	ST11	K47	+	+
JNKPN21	ST25	K2	+	+
JNKPN22	ST11	K47	+	+
JNKPN23	ST11	K64	+	+
JNKPN24	ST11	K64	+	+
JNKPN26	ST11	K64	+	+
JNKPN27	ST24	K25	–	–
JNKPN28	ST11	K64	+	+
JNKPN29	ST11	K64	+	+
JNKPN30	ST11	K64	+	+
JNKPN31	ST11	K64	+	+
JNKPN32	ST15	K112	±	–
JNKPN33	ST11	K47	+	+
JNKPN34	ST11	K64	+	+
JNKPN35	ST101	K17	+	+
JNKPN36	ST11	K64	+	+
JNKPN37	ST11	K64	+	+
JNKPN38	ST11	K64	+	+
JNKPN40	ST29	K54	+	+
JNKPN41	ST11	K47	+	+
JNKPN42	ST1537	K24	±	+
JNKPN43	ST11	K47	–	–
JNKPN44	ST11	K64	+	+
JNKPN45	ST485	K28	–	+
JNKPN46	ST1031–1LV	K10	–	+
JNKPN47	ST101	K17	+	+
JNKPN48	ST11	K19	–	–
JNKPN49	ST11	K64	+	+
JNKPN50	ST37	K15	–	+
JNKPN51	ST24	K25	–	–
JNKPN52	ST11	K47	–	–
JNKPN54	ST11	K47	+	+
JNKPN55	ST11	K47	+	+
JNKPN56	ST37	K81	–	–
JNKPN57	ST11	K47	+	+
JNKPN58	ST11	K64	+	+
JNKPN59	ST152	K149	+	+
JNKPN60	ST11	K47	+	+
JNKPN61	ST11	K64	+	+

+, clear lytic spots; -, no lytic spots; ±, ambiguous lytic spots; NA, not available.

3.3. Optimal MOI and one–step growth curve

The highest titre of phage vB_KpnP_23 was obtained under the MOI of 0.1 (Fig. 2A), indicating that 0.1 was the optimal MOI for the growth of vB_KpnP_23.

Fig. 2.

Biological characteristics of phage vB_KpnP_23. (A) Optimal MOI of phage vB_KpnP_23; (B) One-step growth curve of phage vB_KpnP_23; (C) Titres at different temperatures and (D) pH values. The data represent the mean ± SD (n = 3).

One-step growth curve experiments were used to characterise the lytic capability of phage vB_KpnP_23 at an MOI of 0.1. Phage vB_KpnP_23 had a latent period of approximately 10 min and a rising phase of approximately 90 min. This suggested that is vB_KpnP_23 an efficient lytic phage (Fig. 2B).

3.4. Stability of phage vB_KpnP_23

To investigate the stability of phage vB_KpnP_23 under different environmental conditions, we assessed its survival rate at various temperatures and pH values. The results showed that the titre of phage vB_KpnP_23 was considerably stable at temperatures ranging between −80 °C and 50 °C. However, the activity of phage vB_KpnP_23 slowly declined from 50 °C to 60 °C, while nearly no phages survived when incubated at 70 °C (Fig. 2C). In the pH stability test, the titre of phage vB_KpnP_23 remained relatively unchanged from pH 4.0 to pH 11.0, and the phage was completely inactivated at pH = 3.0 and pH = 12.0 (Fig. 2D). These results indicate that vB_KpnP_23 has strong adaptability to the environment.

3.5. Genomic features of the vB_KpnP_23 genome

The vB_KpnP_23 genome was characterised as a 40,987-base pair (bp) double-stranded DNA (dsDNA) structure with a G + C content of 51 %. The genome has been annotated and submitted to the GenBank database and is accessible under the specified accession number (Accession no PP542034.1). Subsequent online BLASTn analysis of the vB_KpnP_23 sequence in GenBank revealed pronounced similarity to the genome of the Klebsiella phage vB_KpnP_cmc356ctg1 (Accession No OR105945.1) sourced from sewage in Sichuan, China. The comparison yielded an 87 % query coverage and 95 % nucleotide identity.

Genomic examination revealed 51 open reading frames (ORFs), but no tRNA sequences were identified. Whole-genome sequencing (WGS) analysis facilitated the functional annotation of 37 ORFs, designating the remainder as proteins of unknown function. Further functional analysis revealed a modular genomic architecture, including modules for structural proteins (13 ORFs); DNA packaging (3 ORFs); DNA metabolism, repair, and replication (20 ORFs); and lysis system comprising endolysin (ORF_18), holin (ORF_47) and Rz lysis protein (ORF_49), which are essential for phage release from host cells (Fig. 3, Table 2).

Fig. 3.

Circular genome annotation of phage vB_KpnP_23. Arrows in various colors represent predicted CDSs encoding products of different functions.

Table 2.

Annotation and features of predicted ORFs in the vB_KpnP_23 genome.

ORF	Description	Scientific Name	Coverage	E-value	Identity	Accession
ORF_1	hypothetical protein HOS61_gp01	Klebsiella phage SH-Kp 152,410	100	8.00E-37	98.41	YP_009796975.1
ORF_2	hypothetical protein HOS61_gp02	Klebsiella phage SH-Kp 152,410	79	7.00E-19	100	YP_009796976.1
ORF_3	hypothetical protein	Klebsiella pneumoniae	100	8.00E-68	92.11	WP_221,690,650.1
ORF_4	hypothetical protein	Staphylococcus epidermidis	100	4.00E-36	93.33	WP_227,954,138.1
ORF_5	hypothetical protein HOV32_gp04	Klebsiella phage Pharr	100	2.00E-38	100	YP_009821341.1
ORF_6	serine-threonine kinase	Klebsiella phage kpssk3	100	0	93.26	YP_009816994.1
ORF_7	DNA-directed RNA polymerase	Klebsiella pneumoniae	100	0	98.79	WP_221,690,647.1
ORF_8	hypothetical protein HOU69_gp07	Klebsiella phage kpssk3	100	8.00E-34	100	YP_009816997.1
ORF_9	dGTPase inhibitor	Klebsiella phage K5–2	100	2.00E-50	94.12	YP_009788565.1
ORF_10	DNA ligase	Klebsiella phage SH-Kp 152,410	100	0	92.88	YP_009796982.1
ORF_11	hypothetical protein HOS61_gp09	Klebsiella phage SH-Kp 152,410	100	4.00E-21	100	YP_009796983.1
ORF_12	hypothetical protein HOT25_gp09	Klebsiella phage KP32_isolate 196	97	2.00E-55	98.85	YP_009801446.1
ORF_13	nucleotide kinase	Klebsiella phage KP32_isolate 196	98	5.00E-69	80.65	YP_009801447.1
ORF_14	RNA polymerase inhibitor	Klebsiella phage KP32_isolate 192	100	1.00E-26	100	YP_009801318.1
ORF_15	Gp2.5-like ssDNA binding protein and ssDNA annealing protein	Klebsiella phage KP32_isolate 195	100	1.00E-166	99.57	YP_009801403.1
ORF_16	endonuclease	Klebsiella phage KP32_isolate 195	89	7.00E-92	99.24	YP_009801404.1
ORF_17	endonuclease I	Enterobacteriaceae	100	5.00E-105	100	WP_016024414.1
ORF_18	amidase(endolysin)	Klebsiella phage KP32_isolate 192	100	2.00E-109	99.34	YP_009801321.1
ORF_19	hypothetical protein HOR22_gp19	Klebsiella phage vB_KpnP_KpV763	100	4.00E-13	92.11	YP_009786762.1
ORF_20	hypothetical protein HOU69_gp16	Klebsiella phage kpssk3	100	3.00E-16	89.74	YP_009817006.1
ORF_21	HNH endonuclease	Klebsiella phage SH-Kp 152,234	100	6.00E-83	99.17	YP_009966349.1
ORF_22	DNA primase/helicase	Klebsiella phage K11	100	0	99.8	YP_002003807.1
ORF_23	hypothetical protein HOT34_gp22	Klebsiella phage SH-Kp 152,234	100	1.00E-35	97.1	YP_009966351.1
ORF_24	hypothetical protein HOR22_gp23	Klebsiella phage vB_KpnP_KpV763	100	2.00E-66	98.06	YP_009786766.1
ORF_25	DNA polymerase I	Klebsiella phage K5–2	100	0	97.88	YP_009788578.1
ORF_26	HNH endonuclease	Escherichia phage LL2	100	2.00E-59	86	YP_009812337.1
ORF_27	Gp5.5-like host HNS inhibition	Klebsiella phage K5–4	100	1.00E-58	93.68	YP_009788619.1
ORF_28	HNS binding protein	Klebsiella phage vB_Kp1	100	7.00E-43	100	YP_009190979.1
ORF_29	hypothetical protein HOT68_gp27	Klebsiella phage vB_KpnP_IME321	100	1.00E-34	98.28	YP_009806235.1
ORF_30	exonuclease	Staphylococcus epidermidis	100	0	99.34	WP_016024424.1
ORF_31	gp6.3	Klebsiella phage K11	100	4.00E-14	97.22	YP_002003817.1
ORF_32	DUF2717 domain-containing protein	Bacteria	100	3.00E-52	98.77	WP_015991469.1
ORF_33	DUF5476 domain-containing protein	Klebsiella phage kpssk3	100	8.00E-42	97.26	YP_009817016.1
ORF_34	host range and adsorption protein	Klebsiella phage kpssk3	100	2.00E-49	97.67	YP_009817017.1
ORF_35	portal protein	Klebsiella pneumoniae	100	0	99.44	WP_221,690,629.1
ORF_36	head assembly	Klebsiella phage kpssk3	100	0	99.68	YP_009817019.1
ORF_37	major head protein	Klebsiella phage K5–2	100	0	99.13	YP_009788587.1
ORF_38	hypothetical protein	Staphylococcus epidermidis	100	2.00E-120	100	WP_227,954,113.1
ORF_39	endonuclease VII	Klebsiella phage KP32_isolate 195	100	1.00E-91	97.74	YP_009801425.1
ORF_40	tail protein	Klebsiella phage KP32_isolate 196	100	0	99.49	YP_009801467.1
ORF_41	internal virion protein	Klebsiella phage SH-Kp 152,410	100	5.00E-97	98.54	YP_009797011.1
ORF_42	endonuclease VII	Salmonella phage vB_STy-RN5i1	100	3.00E-83	96.09	YP_010678535.1
ORF_43	internal virion protein	Klebsiella phage kpssk3	100	9.00E-139	99.49	YP_009817025.1
ORF_44	internal virion protein	Klebsiella phage K11	100	0	98.27	YP_002003828.1
ORF_45	internal virion protein with endolysin domain	Klebsiella phage vB_Kp1	100	0	98.18	YP_009190994.1
ORF_46	tail fiber protein	Klebsiella phage SH-Kp 152,410	100	0	98.33	YP_009797016.1
ORF_47	type II holin	Escherichia coli	100	1.00E-40	100	WP_236,266,382.1
ORF_48	terminase small subunit	Klebsiella phage vB_KpnP_KpV767	100	6.00E-53	97.65	YP_009786841.1
ORF_49	lysis system i-spanin subunit Rz	Klebsiella pneumoniae	100	1.00E-102	98.65	WP_221,690,619.1
ORF_50	terminase large subunit	Klebsiella phage SH-Kp 152,410	100	0	99.49	YP_009797020.1
ORF_51	HNH endonuclease	Klebsiella phage SH-Kp 152,410	100	4.00E-101	96.53	YP_009797021.1

3.6. Functional analysis of phage lysis system proteins

The physicochemical properties of the lysis-associated proteins of phage vB_KpnP_23 have been characterized. Endolysin, encompassing 151 amino acids, exhibits a molecular weight of 16.9 kDa and a theoretical isoelectric point (pI) of 8.47. Despite its hydrophilic attributes, it is identified as an unstable protein. In contrast, the holin protein, composed of 69 amino acids with a molecular weight of 7.5 kDa and a pI of 6.05, is recognized as a stable protein with hydrophobic qualities. The Rz lysis protein, comprising 148 amino acids with a molecular weight of 16.4 kDa and a pI of 9.35, is also classified as a stable hydrophilic protein. Analysis reveals that endolysin lacks transmembrane domains and resides outside the membrane. Holin features two transmembrane domains, with amino acids 1–13 and 56–69 located within the membrane, and amino acids 27–36 positioned outside in the transmembrane area. The Rz lysis protein includes a transmembrane domain, where amino acids 1–7 are membrane-internal, and amino acids 23–148 are external to the membrane in the transmembrane region. Notably, endolysin, holin, and the Rz-like lysis protein all lack signal peptides, indicating they are not secretory proteins.

3.7. Evolutionary analysis of phage vB_KpnP_23

We identified 39 TFP sequences with 99 % coverage and 96 % identity from a variety of phages, all homologous to the TFP (Dep_46) of phage vB_KpnP_23 and classified them within the order Caudovirales and family Autographiviridae. This identification underscores the evolutionary conservation across these phages (Fig. 4A). Phylogenetic analysis identified the TFP of phage vB_KpnP_23 and the depolymerase P510dep from phage P510 on the same cluster, revealing their close evolutionary relationships. Comparative protein sequence alignment between P510dep and Dep_46 revealed 18 amino acid differences. Phyre2 analysis specified that the Bacteriophage T7 tail fiber protein-like N-terminal domain (residues 2–152, identity: 45 %) shows 2 amino acid differences; α−1,3-galactosidase B (residues 178–761, identity: 17 %), which exhibits hydrolase activity on glycosyl bonds, has 7 amino acid substitutions; and β−1–3-glucanase (residues 273–646, identity: 22 %), which demonstrates polygalacturonase activity and belongs to the Pectate lyase superfamily, contains 6 amino acid variations. This phylogenetic proximity suggests that the Dep_46 of vB_KpnP_23 may share a functionally analogous role with the depolymerase P510dep (Li et al., 2021). This finding not only highlights the evolutionary conservation of these proteins, but also suggests a potential similarity in their functional roles, pointing towards a conserved evolutionary strategy among these phages.

Fig. 4.

Phylogenetic Relationships and Taxonomic Classification. (A) Phylogenetic trees generated through the neighbor-joining method, incorporating 1000 bootstrap replicates, based on the sequence of the tail fiber protein (ORF_46). (B) A Sankey diagram illustrates the classification and abundance of Klebsiella phage vB_KpnP_23 and 258 related viral genomes across multiple taxonomic levels: domain, order, family, genus, and species. (C) A detailed phylogenetic tree showcasing the evolutionary relationships among Klebsiella phage vB_KpnP_23 and its related viral genomes. The enlarged zoom shows the cluster where the bacteriophage vB_KpnP_23 is located, with the red branches representing vB_KpnP_23.

From the NCBI Standard Nucleotide database (until Mar.2024), 258 whole genome sequences of phages related to phage vB_KpnP_23 were retrieved, each displaying over 70 % identity and 45 % coverage. Detailed taxonomic analyses of these phages were conducted, and their relationships were visualized using a Sankey diagram (Fig. 4B). Phage vB_KpnP_23 belongs to the order Caudovirales, family Autographiviridae, genus Przondovirus, and is a member of the species Klebsiella phage Kp1. Genome phylogenetic analysis and Average Nucleotide Identity (ANI) analysis reveal that phage vB_KpnP_23 constitutes a new species within the genus Klebsiella phage Kp1, evidenced by its ANI of less than 95 % relative to any other phage in the genus. The phylogenetic analysis further supports the assertion that phage vB_KpnP_23 forms a distinct clade, indicative of it representing a novel variant within the Klebsiella phages (Fig. 4C).

3.8. vB_KpnP_23 exhibits a synergistic effect with commonly used antibiotics

The checkerboard analysis results indicated that when meropenem, amikacin, and levofloxacin were used in combination with bacteriophage vB_KpnP_23, the FICI values were respectively recorded as 0.125, >0.5, and 0.5. FICI values below 0.5 signify a synergistic interaction. The MIC of these antibiotics were significantly reduced from 128, >2048, and 256 µg/mL to 16, 1024, and 128 µg/mL, respectively (Fig. 5). This combination of phages and antibiotics resulted in a multiple-fold decrease in MIC values, significantly more than the reduction achieved with the use of phages or antibiotics alone. The synergistic effect is optimized by adjusting the MOI one order of magnitude above or below the ideal MOI. These findings suggest that the combined application of phage vB_KpnP_23 with antibiotics could effectively manage CRKP infections.

Fig. 5.

Checkerboard analysis of antibiotics and phage vB_KpnP_23. Antibiotic concentrations at the abscissa ranging from 0.5 to 512 μg/mL and phage concentrations at the ordinate (10³ - 10⁹ PFU/mL). The growth inhibition is represented as a heatmap: (A) Levofloxacin; (B) Amikacin; (C) Meropenem.

4. Discussion

CRKP is a serious nosocomial pathogen and the most frequently isolated species causing a variety of illnesses, especially in those hospitalised in intensive care units and immunocompromised patients, owing to the increased prevalence of resistant strains (Karampatakis et al., 2023; Yang et al., 2022). The misuse of these drugs and lack of access to newer drugs have led to a crisis in the spread of antimicrobial resistance; therefore, new approaches need to be considered for developing potential therapeutic or preventive drugs (Aslam et al., 2018). Phage therapy, an effective and safe treatment, has received significant interest as an alternative to antibiotics in the post-antibiotic era, and has received attention from patients with few or no alternative therapies (Pires et al., 2015; Aranaga et al., 2022). However, the clinical application of phage therapy requires thorough characterization and genomic analysis of phages to ensure their safety for therapeutic use.

Here, we isolated a novel lytic phage, vB_KpnP_23, from hospital sewage. Phage vB_KpnP_23 exhibited a strong lytic potential against the CRKP isolates tested. For phage therapy to be effective, there should be a relatively wide host range (Hyman, 2019). Phage vB_KpnP_23 lysed 38 out of 57 K. pneumoniae strains and nine capsule types (K-types). This indicates that vB_KpnP_23 has a relatively wide host range, suggesting its high potential for use in clinical settings to treat infections caused by CRKP.

The efficacy of phages as biological control agents and their use in therapeutic, storage, and production applications is significantly influenced by their tolerance to environmental conditions such as pH and temperature (Jończyk-Matysiak et al., 2019). Notably, phage vB_KpnP_23 achieves complete adsorption within 10 min. When the MOI was 0.1, the titre of vB_KpnP_23 reached its maximum value. Phage vB_KpnP_23 stands out with its extraordinary adaptability to a broader pH range (4–11) and exceptional thermal resilience, underscoring its robustness under various environmental conditions. Given these characteristics, phage vB_KpnP_23 emerges as a viable antimicrobial agent, showing great promise for use in biocontrol and phage therapy endeavors.

To ensure that phages can be safely used for in vivo therapeutic applications, it is critical to confirm that their genomes are free of lysogeny-, antibiotic resistance-, and virus-associated genes (Ling et al., 2022). This precaution is vital for the therapeutic application of phages. Analysis of the vB_KpnP_23 genome revealed that the phage is devoid of genes coding for virulence, resistance and lysogenicity, thus establishing its safety for such applications. The potential of phage therapy largely depends on the functionality of the phage-derived enzymes, including depolymerases and endolysins, which are known to effectively prevent and control biofilm formation (Chan and Abedon, 2015). The endolysin produced by vB_KpnP_23 is an unstable, hydrophilic protein without a transmembrane domain or signal peptide, indicating that the vB_KpnP_23 lyase does not function as a secreted protein and lacks the capability to autonomously traverse the inner cell membrane to access the cell wall. Lytic bacteriophages release endolysins, enzymes adept at degrading the peptidoglycan layers within the cell walls of their bacterial hosts, resulting in bacterial suppression or lethality (Schmelcher et al., 2012). This process is particularly effective against gram-positive bacteria due to the absence of an outer membrane, which, in gram-negative bacteria, serves as a barrier to endolysin efficacy, thereby limiting their action (Abdelrahman et al., 2021). To overcome this issue, endolysins have been engineered. Artilysin stands out as a notable engineered endolysin that exemplifies this breakthrough (Briers et al., 2014).

In contrast to the use of endolysin for targeting infections by gram-positive bacteria, phage-encoded depolymerases, which disintegrate bacterial capsular polysaccharides, are deployed against gram-negative bacteria like Klebsiella pneumoniae. For these bacteria, the capsule, integral to the outer membrane, acts as a significant virulence factor. Intriguingly, the severity of infection outcomes is correlated with the K-type of Klebsiella pneumoniae (Fang et al., 2004). Phage infection begins with the adsorption and recognition of specific ligands on the host surface by tail fiber proteins or tail spike proteins (TSPs). TFP with depolymerase activity recognize, bind, and digest the polysaccharide compounds of the bacterial cell wall, exposing phage receptors, which is crucial for effective phage infection of the host (Knecht et al., 2020). The depolymerase activity spectrum results show that Dep_46 is active against 13 K-types, contributing to the broad host range of the phage.

Comparative analysis revealed a high degree of similarity between the Dep_46 of phage vB_KpnP_23 and P510dep of phage P510, although there were amino acid differences. Despite this similarity, Dep_46 exhibited a broader activity spectrum, indicating its potential for wider application in targeting diverse bacterial strains. This suggests an enhanced therapeutic scope of phages against a variety of pathogens. The specific amino acid(s) responsible for this difference remain unknown and will be investigated in future experiments.

The combination of phages and conventional antibiotics can produce synergistic antibacterial effects, and the application of phage-antibiotic combination therapy has been increasingly explored in the preclinical phage therapy literature (Tagliaferri et al., 2019, Torres‐Barceló et al., 2016). Meropenem, Amikacin, and Levofloxacin, as antibiotics from different classes, inhibit bacterial growth and reproduction through distinct mechanisms. Our study shows that vB_KpnP_23 has a synergistic effect on CRKP infection in combination with antibiotics. The significant reduction in MIC values for meropenem, when used in conjunction with phage vB_KpnP_23, suggests that the phage's role extends beyond a mere adjunct to antibiotics; it may actively reshape the bacterial susceptibility landscape. Studies have shown that the synergism between phages and antibiotics varies broadly and could differ between the antibiotics and phages used (Comeau et al., 2007). For instance, a study by Elshamy, Ann, et al., showed that meropenem antibiotics indifferently act in combination with CRAB phages (Elshamy et al., 2023). This variability points towards the need for personalized medicine approaches in infectious disease treatment, where phage-antibiotic combinations are tailored based on the specific pathogen and its resistance profile. Furthermore, the finding that adjusting the MOI can optimize the synergistic effect highlights the importance of dosage strategy in phage therapy, suggesting that careful consideration of phage to bacterial cell ratios could further enhance the efficacy of combined treatments. The promising results of combining bacteriophages with antibiotics against CRKP infections open the door to a new frontier in antimicrobial therapy. This approach could lead to the development of more effective treatments for a range of resistant infections, ultimately reducing the global burden of antibiotic resistance.

5. Conclusion

We isolated and characterized vB_KpnP_23, a novel lytic phage against CRKP. Bacteriophage vB_KpnP_23 shows great environmental stability with effective antibacterial activity. Genomic analysis revealed that vB_KpnP_23 does not contain resistance-, toxin-, or virulence-related genes. These characteristics make vB_KpnP_23 an interesting candidate biocontrol agent against CRKP infections. Future studies could explore the potential of integrating vB_KpnP_23 into a multifaceted approach to combat CRKP infections, especially in clinical settings where antibiotic resistance is a significant challenge. Investigating the interaction mechanisms between vB_KpnP_23 and CRKP could provide deeper insights into phage-host dynamics and optimize phage therapy strategies. Additionally, long-term safety and efficacy trials of vB_KpnP_23 in vivo could pave the way for its application as a sustainable alternative to traditional antibiotics.

Funding

This study was supported by grants from the National Natural Science Foundation of China (81902119) and Shandong Province Natural Science Foundation (ZR2021MH214).

Ethical approval

Not require.

CRediT authorship contribution statement

Qian Wang: Writing – review & editing, Visualization, Software, Methodology. Ran Chen: Writing – original draft, Project administration, Methodology, Data curation. Hui Liu: Methodology, Investigation. Yue Liu: Validation. Jinmei Li: Methodology. Yueling Wang: Resources. Yan Jin: Funding acquisition. Yuanyuan Bai: Investigation. Zhen Song: Formal analysis. Xinglun Lu: Formal analysis. Changyin Wang: Supervision, Resources, Project administration, Conceptualization. Yingying Hao: Funding acquisition, Conceptualization.

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Data availability

• The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found in the article.