Skip to main content
Cellular and Molecular Neurobiology logoLink to Cellular and Molecular Neurobiology
. 2017 Jul 8;38(3):657–668. doi: 10.1007/s10571-017-0516-y

Neuroprotective Effects of n-3 Polyunsaturated Fatty Acid-Enriched Phosphatidylserine Against Oxidative Damage in PC12 Cells

Hongxia Che 1,#, Xueyuan Fu 2,#, Lingyu Zhang 1, Xiang Gao 1, Min Wen 1, Lei Du 3,4, Changhu Xue 1, Jie Xu 1,, Yuming Wang 1,
PMCID: PMC11481886  PMID: 28689275

Abstract

Neurodegenerative diseases are defined by progressive loss of specific neuronal cell populations and are associated with protein aggregates. Oxidative stress has been implicated in their pathological processes. Previous studies revealed that docosahexaenoic acid (DHA) is beneficial in neurodegenerative diseases. Phospholipids (PLs) derived from marine products are rich in DHA and eicosapentaenoic acid (EPA). In the present study, we investigated the neuroprotective effects of DHA-enriched and unenriched phosphatidylcholine (PC) and phosphatidylserine (PS) on oxidative stress induced by hydrogen peroxide (H2O2) and tert-butylhydroperoxide in PC12 cells. Cell viability and leakage of lactate dehydrogenase results showed that the neuroprotective effect of PS was superior to that of PC. DHA- and EPA-enriched PC and PS were superior to that without DHA or EPA; in addition, the improvement with n-3 polyunsaturated fatty acid-enriched PS (n-3 PS) was dose dependent. Acridine orange/ethidium bromide staining showed that DHA- and EPA-enriched PS (DHA/EPA-PS) could significantly inhibit apoptosis. Mechanistic studies revealed that EPA-PS and DHA-PS were effective to increase superoxide dismutase (SOD) levels by 48.4 and 58.2 % and total antioxidant capacity (T-AOC) level by 51 and 94 %, respectively, in the H2O2 model. Similar results for SOD and T-AOC levels were shown in the t-BHP model. EPA/DHA-PS could downregulate the messenger RNA level of Caspase-3, Caspase-9, and Bax, upregulate Bcl-2, inhibit Bax, and increase Bcl-2 at protein level. In conclusion, EPA/DHA-PS could protect PC12 cells from oxidative stress and prevent mitochondrial-mediated apoptosis. Our findings indicate that the neuroprotective effects of DHA/EPA-PLs depend on the molecular form. Further studies are necessary to reveal detailed mechanisms and structure–effect relationships.

Keywords: n-3 polyunsaturated fatty acid-enriched phosphatidylserine, Oxidative stress, Antioxidant, Mitochondrial-mediated apoptosis

Introduction

Alzheimer’s disease (AD) is a neurodegenerative disease characterized by memory loss and impaired cognitive functions, becoming a serious socioeconomic problem in recent years (Muthaiyah et al. 2011). Many mechanisms participate in the pathology of AD, with increased oxidative stress being widely considered to be a mediator of neuronal damage in AD (Bonda et al. 2010). It is accepted that overproduction of Aβ leads to free-radical production, causing oxidative damage and cell death (Sponne et al. 2003). Oxidative stress occurs when the cellular antioxidant system cannot clear excessive produced free radicals (Ferreiro et al. 2012). Therefore, therapeutic strategies aiming to prevent oxidative stress are considered to be effective for treatment of AD.

Phospholipids (PLs) are an important class of lipids for construction of cell membrane. Glycerol PLs are the commonest subgroup and can be classified based on the PL head-group, which can be choline, ethanolamine, glycerol, inositol or serine; For example, phosphatidylcholine (PC) contains a choline head-group, whereas phosphatidylethanolamine contains an ethanolamine (Burri et al. 2012). Marine PLs have an n-3 long-chain polyunsaturated fatty acid (LC-PUFA) at sn-2 position of the glycerol backbone (Lu et al. 2015), making them different from PLs derived from other sources. Many studies have investigated n-3 FAs bound to triglycerides (TGs) or ethyl esters, while n-3 PUFA-enriched PLs derived from marine products have attracted much attention recently due to their beneficial health effects; For example, krill oil, which is known for its high amount of n-3 PUFA-enriched PLs, was reported to have beneficial effects on fatty liver and plasma cholesterol level (Tandy et al. 2009). It has been indicated that intake of n-3-rich PLs from herring roe leads to a decrease in plasma TG, PL, total cholesterol, and glucose levels in mice (Moriya et al. 2007). A substantial number of studies have assessed the health benefits of n-3 polyunsaturated fatty acids (Riediger et al. 2009). It has been suggested that dietary n-3 polyunsaturated fatty supplements including docosahexaenoic acid (DHA) can improve neuronal development and enhance cognitive functions (Van et al. 2016). Eicosapentaenoic acid-enriched PLs (EPA-PLs) have been confirmed to be effective in protecting rat pheochromocytoma (PC12) cells from oxidative stress and preventing development of learning and memory impairment in aged mice (Wu et al. 2014). Our previous study also revealed that DHA-enriched PLs (DHA-PLs) extracted from squid roe could improve learning and memory abilities of mice with dementia (Wen et al. 2016). As a natural PL, phosphatidylserine (PS) is widely present in all cell membranes, and is an essential component of brain (Breckenridge et al. 1972). Previous study revealed that PS is superior to PC in reducing neuronal death in retina 7 days after reperfusion (Dvoriantchikova et al. 2009). Soybean-derived PS (Soy-PS) and bovine cortex-derived PS (BC-PS) were found to improve memory deficits in animals with cognitive impairment (Claro et al. 1999; Suzuki et al. 2001). However, the effect of EPA/DHA-PS on oxidative-induced neurodegeneration remains unclear; moreover, comparison of the effect of different fatty acids (PC and PS) on neurodegenerative diseases has not received much attention.

The neuron-like rat pheochromocytoma cell line (PC12) is catecholaminergic and excitable, expressing multiple properties of neurons. It is widely used for cell signaling studies and various types of neurochemical study (Muthaiyah et al. 2011; Yu et al. 2008a). In the present study, the protective effects of EPA-PC/PS and DHA-PC/PS against damage induced by oxidative stress in PC12 cells were investigated and compared with those of Soy-PC and Soy-PS. It was found that DHA- or EPA-enriched PLs showed better protective effects in PC12 cells compared with Soy-PC/PS. Moreover, for PLs derived from the same source, PS showed superior protective effect compared with PC. Given that n-3 PUFA-enriched PS (n-3 PS) exhibited obvious advantages in protecting PC12 cells from damage induced by oxidative stress, the underlying mechanisms were further explored in PC12 cells treated with EPA-PS and DHA-PS, including the antioxidant ability, mitochondrial pathway of apoptosis, and glycogen synthase kinase (GSK)-3β. This study may support development of n-3 PUFA-enriched PS as a functional component for neuroprotection.

Materials and Methods

Materials

Dry sea cucumber, Cucumaria frondosa, were purchased from Nanshan Aquatic Market of Qingdao (China). Illex argentinus Castellanos squid roe was provided by Weihai Boow Foods Co., Ltd. (Weihai, China). PC12 cell line was purchased from Shanghai Institute of Biochemistry and Cell Biology (Shanghai, China). Roswell Park Memorial Institute (RPMI) 1640 medium and fetal bovine serum (FBS) were purchased from Gibco (Grand Island, NY, USA). 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyl (MTT) was purchased from Sigma (St. Louis, MO, USA). Leakage of lactate dehydrogenase (LDH), superoxide dismutase (SOD), and total antioxidant capacity (T-AOC) assay kits were provided by Nanjing Jiancheng Bioengineering Institute (Nanjing, China). Maxima SYBR Green qPCR master mix was purchased from Fermentas (Glen Burnie, Maryland, USA). Anti-Bcl-2, anti-Bax, and anti-β-actin antibodies were from Abcam (Cambridge, UK).

Preparation of Phospholipids from Different Sources

Soy-PC was purchased from Avanti Polar Lipids (Alabama, USA). EPA- and DHA-PLs were extracted from C. frondosa and squid roe, respectively, according to the method of Wu et al. (2014). EPA-PC and DHA-PC were purified from EPA-PL and DHA-PL, respectively, by silica gel column chromatography. All of the PS used in this study was enzymatically synthesized by phospholipase D-catalyzed transphosphatidylation of PC as described by Hosokawa et al. (2000). The structures of the different phosphoglycerides are shown in Fig. 1.

Fig. 1.

Fig. 1

Structures of phosphatidylcholine and phosphatidylserine. a Phosphatidylcholine (PC) contains a choline head-group; sn-2 can be replaced by EPA and DHA to form EPA-PC and DHA-PC, respectively. b Phosphatidylserine (PS) contains a serine head-group; sn-2 can be replaced by EPA and DHA to form EPA-PS and DHA-PS, respectively

The fatty acid composition of Soy-PC/PS, DHA-PC/PS, and EPA-PC/PS was determined by gas chromatography using an Agilent 6890 with HP-Innowax capillary column (30 m × 0.32 mm × 0.25 μm) and flame ionization detector, as presented in Table 1. The temperature of the detector and injector were kept constant at 250 and 240 °C, respectively, and the oven temperature was increased from 170 to 240 °C at 3 °C/min and held at 240 °C for 15 min. Nitrogen was used as carrier gas at flow rate of 1.2 mL/min. For the experiment, the PLs were prepared in liposome using the method of Hossain et al. (2006).

Table 1.

Main fatty acid composition of the phospholipids (%)

Fatty acid Soy-PC Soy-PS DHA-PC DHA-PS EPA-PC EPA-PS
16:0 14.2 13.5 29.15 29.12 2.75 2.74
18:0 3.0 3.1 3.64 3.62 3.72 3.39
18:1 10.5 10.2 12.13 12.17 n.d. n.d.
18:2 66.0 66.7 0.68 0.55 n.d. n.d.
18:3 6.3 6.5 2.32 2.15 n.d. n.d.
20:1 n.d. n.d. 5.87 5.79 1.31 1.16
20:2 n.d. n.d. 1.49 1.51 3.18 3.65
20:3 n.d. n.d. 1.05 1.03 10.91 10.28
20:5 n.d. n.d. 11.54 11.79 57.4 58.4
22:6 n.d. n.d. 30.19 30.31 1.2 1.38

n.d. not detected

Cell Culture

PC12 cells were grown in RPMI1640, supplemented with 10 % FBS and 100 U/mL penicillin and 100 μg/mL streptomycin in humidified atmosphere of 95 % air and 5 % CO2 at 37 °C. PC12 cells after five to seven passages were used for further experiments. Before treatment, cells were seeded at appropriate density on cell culture plates. Following seeding, cells were allowed to adhere to the plate for 24 h. Once adhered, appropriate concentration of PLs was added to the plate and incubated for 24 h prior to incubation with oxidative damage agent. Freshly prepared hydrogen peroxide (H2O2) or tert-butylhydroperoxide (t-BHP) was then added to the plate to cause damage.

Measurement of Cell Viability

Cell viability was determined by MTT assay. PC12 cells were plated at density of 200,000 cells/mL in 96-well plates. The medium was removed, and cells were washed with phosphate-buffered saline (PBS) at the end of incubation. MTT dissolved in RPMI1640 was then added to each well for an additional 4 h at 37 °C in CO2 incubator, then the medium was removed and the formazan was dissolved in 200 μL acidated dimethylcarbinol. The absorbance at 570 nm was measured using a microplate reader (model 680, Bio-Rad, Tokyo, Japan). Cell viability is expressed as a percentage of control value.

LDH Activity Assay

PC12 cells were seeded at density of 200,000 cells/mL in 96-well plates. At the end of incubation, the medium was collected from each well and the leakage of dehydrogenase (LDH) activity was determined using assay kit at 440 nm according to the manufacturer’s protocol.

Acridine Orange/Ethidium Bromide (AO/EB) Double Staining

Apoptosis was determined morphologically after staining the cells with AO/EB (Sigma, St. Louis, MO) followed by fluorescence microscopy inspection. PC12 cells were seeded in a 96-well plate, and after adherence, appropriate concentration of PLs was added to the plate and incubated for 24 h prior to incubation with H2O2. At the end of incubation, the cells were harvested, washed three times with PBS, and adjusted to density of 106 cells/mL of PBS. AO/EB solution (1:1 v/v) was added to the cell suspension in final concentration of 100 μg/mL. Cellular morphology was evaluated by fluorescence microscope (Olympus, Japan).

Measurement of Intracellular SOD and T-AOC Activity

PC12 cells were seeded in a six-well plate at density of 500,000 cells/mL. Following phospholipids treatment, cells were washed twice with PBS then scraped from the plate into cold PBS. The cells in PBS were homogenized by using an ultrasonic cell disruptor (Ningbo Scientz Biotechnology Co. Ltd.). The homogenate was then centrifuged at 4000×g for 20 min at 4 °C, and the supernatant was collected for further assay. The protein concentration in each supernatant sample was determined by BCA assay kit (Beyotime, China).

SOD activity was determined using a SOD activity assay kit at 450 nm, based on production of superoxide radicals during conversion of xanthine to nitrite by xanthine oxidase. T-AOC activity was measured by commercial assay kit at 520 nm, based on oxidation of intracellular antioxidants by Fe3+ in acidic medium. The liberated Fe2+ was reacted with 1,10-phenanthroline, and a colored complex formed. The activities of SOD and T-AOC are expressed as U/mg protein in cells.

Real-Time PCR

Messenger RNA (mRNA) levels of relevant genes were measured by real-time polymerase chain reaction (PCR). Total RNA was extracted using TRIzol reagent (Invitrogen, USA). The concentration of total RNA was assessed by NanoDrop 2000 (Thermo Scientific, USA). Total RNA (2 μg) from each sample was reverse-transcribed into complementary DNA (cDNA) using random primer and Moloney murine leukemia virus reverse transcriptase (Madison, WI). Selected genes were amplified using SYBR Green I master mix (Roche, Germany) using an iQ5 real-time detection system (Bio-Rad, USA) with both forward and reverse primers after cDNA synthesis. Relative gene expression was determined using the standard curve method. Results are expressed as relative values after normalization to β-actin RNA. The primer sequences for the analyzed genes are presented in Table 2.

Table 2.

Sequences of primers used in quantitative RT-PCR

Gene Forward primer Reverse primer
Caspase-9 GCCTCATCATCAACAACGTG CCTGGTATGGGACAGCATCT
Caspase-3 GACGACAGGGTGCTACGAT ACAGACCAGTGCTCACAAGG
Bcl-2 TGGGATACTGGAGATGAAGACT CCACCGAACTCAAAGAAGG
Akt-2 ACACGATGTTGGCAAAGAA GTGCTGGAGGACAACGACT
GSK-3β AACACCAACAAGGGAGCA GAGCGTGAGGAGGGATAA
β-Actin GCAGATGTGGATCAGCAAGC GTCAAAGAAAGGGTGTAAAACG

Western Blot Analysis

For Western blot analysis, cells were homogenized in radioimmunoprecipitation assay lysis buffer containing protease inhibitor phenylmethylsulfonyl fluoride. Cellular proteins were isolated using 10 % sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Proteins were blotted onto polyvinylidene fluoride membranes, which were incubated with antibodies against Bcl-2 (1:2000 dilution) and Bax (1:2000 dilution) at 4 °C overnight. After this, membranes were incubated with goat anti-rabbit immunoglobulin G (1:3000 dilution) for 2 h at room temperature, and the blots were developed with chemiluminescent horseradish peroxidase substrate.

Statistical Analysis

Data are expressed as mean ± standard error on the mean (SEM). Statistical significance between groups was analyzed by one-way analysis of variance (ANOVA) test using SPSS software (version 18.0; SPSS, Inc., Chicago, IL, USA), with P < 0.05 considered statistically significant.

Results

Effect of Different Phospholipids on Viability of PC12 Cells

As shown in Fig. 2, none of the studied PLs had a detectable toxic effect on growth of PC12 cells within 24 h. Given that no toxic effect on growth of PC12 cells was found for any of the PLs at concentrations less than 80 μg/mL within 24 h, concentrations of 10 and 40 μg/mL were selected for further experiments.

Fig. 2.

Fig. 2

Effect of phospholipids from different sources on viability of PC12 cells. Cell viability was measured by MTT assay after pretreatment with PC (a) and PS (b) from different sources for 24 h. Results are mean ± SEM of three independent experiments

Dose-Dependent Toxicity of H2O2 and t-BHP in PC12 Cells

H2O2 and t-BHP were investigated as oxidative stressors to study the protective effects of PLs in pathological conditions. Cell viability under oxidative stress was measured by MTT assay as shown in Fig. 3. A dose-dependent decrease in cell viability was demonstrated in PC12 cells exposed to oxidative stresses. The 50 % inhibitory concentration (IC50) value for H2O2 and t-BHP was 200 and 150 μmol/L, respectively, when PC12 cells were treated for 4 h. Therefore, 200 μmol/L H2O2 and 150 μmol/L t-BHP were used to induce damage to PC12 cells in subsequent experiments.

Fig. 3.

Fig. 3

Dose-dependent toxicity of H2O2 and t-BHP in PC12 cells. PC12 cells were treated with various doses of a H2O2 (100, 200, 250, 300, 400, and 500 μmol/L) or b t-BHP (50, 100, 150, 200, 300, and 400 μmol/L) for 4 h, and cell viability was measured by MTT assay. Concentrations of 200 μmol/L H2O2 and 150 μmol/L t-BHP were chosen for subsequent experiments. Results are mean ± SEM of three independent experiments

Effect of Different Phospholipids on Cell Survival

PLs from different sources, viz. Soy-PC, Soy-PS, EPA-PC, EPA-PS, DHA-PC, and DHA-PS, as well as Soy-PC + serine, were investigated to compare their protective effects against oxidative stress-induced cell damage. As shown in Fig. 4, the viability of PC12 cells increased when pretreated with different kinds of PL before exposure to H2O2. For PC or PS, it was observed that n-3 PUFA-enriched PLs showed better protective effects on PC12 cells compared with Soy-PC or PS, whose predominant fatty acid is linoleic acid (LA, 18:2). Moreover, for PLs derived from the same source, PS showed better protective effect than PC (P < 0.05). Compared with treatment with Soy-PC alone, treatment with Soy-PC together with serine did not markedly enhance the protective effect of Soy-PC. Similar results were shown for LDH release. These data indicate that n-3 PUFA-enriched PS (n-3 PS) exhibited obvious advantages in protecting PC12 cells from oxidative stress-induced damage compared with the other PLs.

Fig. 4.

Fig. 4

Effect of different phospholipids on cell survival when treated with H2O2. PC12 cells were pretreated with different phospholipids (40 μg/mL) and serine (Ser, 40 μg/mL) for 24 h, then exposed to 200 μmol/L H2O2 for 4 h. Cell viability was measured by MTT assay (a), and LDH leakage into medium was determined by assay kit (b). Results are mean ± SEM of three independent experiments. ## P < 0.01, versus normal group, *P < 0.05, **P < 0.01, versus H2O2 group. a–f Means with different superscripts among these groups are significantly different (P < 0.05, one-way ANOVA)

n-3 PS Improves Cell Survival and Cellular Morphology

As shown in Fig. 5a, b, the viability of PC12 cells pretreated with EPA-PS and DHA-PS was obviously increased compared with model group, in a dose-dependent manner (P < 0.05). Better protective effect was observed for DHA-PS compared with EPA-PS. Similar results were obtained for LDH release. In cultures pretreated with EPA-PS or DHA-PS, LDH was reduced in a dose-dependent manner. In the H2O2-induced damage model, 40 μg/mL EPA-PS deceased LDH release by 34 %, and 40 μg/mL DHA-PS by 47 %. In the t-BHP-induced damage model, 40 μg/mL EPA-PS deceased LDH release by 47 %, and 40 μg/mL DHA-PS by 53 %. These results indicate that both EPA-PS and DHA-PS could dose-dependently reduce cell death and inhibit release of LDH by protecting against membrane permeability.

Fig. 5.

Fig. 5

Effect of n-3 PS on survival of PC12 cells pretreated with different concentrations (10 and 40 μg/mL) of EPA-PS and DHA-PS for 24 h then exposed to 200 μmol/L H2O2 or 150 μmol/L t-BHP for 4 h. Cell viability was measured by MTT assay (a, c), and leakage of LDH to medium was determined by assay kit (b, d). Results are mean ± SEM of three independent experiments. ## P < 0.01, versus normal group, *P < 0.05, **P < 0.01, versus model group

The cellular morphology of PC12 cells was observed by inverted microscope. Compared with normal group, the shape of cells treated with H2O2 was heterogeneous, cells became round, and the cell number reduced. However, treatment with EPA-PS and DHA-PS showed a resistance effect to H2O2-induced damage, as proved by the restored uniform neuronal shape and cell number (Fig. 6). Morphological evaluation of apoptosis was carried out by AO/EB double staining. As shown in Fig. 7, viable cells in normal group showed uniform bright-green nuclei with organized structure, while apoptotic cells of model group showed orange to red nuclei with condensed or fragmented chromatin. Pretreatment of cells with EPA-PS and DHA-PS could significantly reduce the extent of cell apoptosis compared with the model group.

Fig. 6.

Fig. 6

Effect of n-3 PS on cellular morphology of PC12 cells treated with EPA-PS or DHA-PS (10, 40 μg/mL) for 24 h then exposed to 200 μmol/L H2O2 for 4 h. Cellular morphology was observed by inverted microscope

Fig. 7.

Fig. 7

Effects of n-3 PS on apoptosis determined morphologically after staining cells with AO/EB followed by fluorescence microscopy inspection. PC12 cells were pretreated with phospholipids prior to incubation with H2O2. At the end of incubation, the cells were harvested, washed with PBS, and adjusted to density of 106 cells/mL of PBS. AO/EB solution was added to the cell suspension in final concentration of 100 μg/mL

n-3 PS Increases SOD and T-AOC Activity

To investigate whether the effects of EPA-PS and DHA-PS on H2O2- and t-BHP-induced toxicity are mediated by antioxidation, intracellular SOD and T-AOC activity were measured. As shown in Fig. 8, SOD generation in cells exposed to H2O2 and t-BHP markedly decreased to 34.21 and 39.60 U/mg protein, respectively, while pretreatment with EPA-PS or DHA-PS effectively attenuated the reduction of SOD level. In the two damage models, the SOD level increased by 48.4 % (P < 0.05) and 51 % (P < 0.01) when treated with EPA-PS compared with model. For treatment with DHA-PS, the SOD level increased by 58.2 % (P < 0.05) and 46.1 % (P < 0.01), respectively, in these two models. The data shown in Fig. 8c, d demonstrate that the T-AOC of PC12 cells was disturbed by oxidative stress, while EPA-PS and DHA-PS significantly preserved the decreased T-AOC activity (P < 0.01). Better protective effect was observed for DHA-PS than EPA-PS on T-AOC level in PC12 cells exposed to H2O2 (P < 0.05, Fig. 8c).

Fig. 8.

Fig. 8

Effect of n-3 PS on SOD activity and T-AOC in PC12 cells pretreated with EPA-PS or DHA-PS (40 μg/mL) for 24 h then exposed to 200 μmol/L H2O2 or 150 μmol/L t-BHP for 4 h. SOD activity (a, b) and T-AOC (c, d) were measured by assay kit. Results are mean ± SEM of three independent experiments. ## P < 0.01, versus normal group. a–cMeans with different superscripts among these groups are significantly different (P < 0.05, one-way ANOVA)

Effects of n-3 PS on Bcl-2, Caspase-9, Caspase-3, Akt-2, and GSK-3β mRNA Levels

As shown in Fig. 9, the activity of apoptosis genes Caspase-3 and Caspase-9 was increased in t-BHP-treated cells, while pretreatment with EPA-PS or DHA-PS markedly reduced their activity. Compared with control cells, the level of antiapoptotic gene Bcl-2 was decreased by 57.78 % (P < 0.05), while cells pretreated with EPA-PS and DHA-PS showed reversed Bcl-2 level. It was observed that Akt-2 and GSK-3β mRNA levels were impaired after t-BHP treatment, while treatment with EPA-PS or DHA-PS could upregulate the decreased Akt-2 and GSK-3β level but without significant difference.

Fig. 9.

Fig. 9

Effect of n-3 PS on Bcl-2, Caspase-9, Caspase-3, Akt-2, and GSK-3β mRNA level in PC12 cells pretreated with EPA-PS or DHA-PS (40 μg/mL) for 24 h then exposed to 150 μmol/L t-BHP for 4 h. The mRNA levels of Caspase-3 (a), Caspase-9 (b), Bcl-2 (c), Akt-2 (d), and GSK-3β (e) were determined by quantitative RT-PCR and normalized against β-actin. Results are mean ± SEM of three independent experiments. # P < 0.05, ## P < 0.01, versus normal group. ab Means with different superscripts among these groups are significantly different (P < 0.05, one-way ANOVA)

Western Blot Analysis of Bcl-2 and Bax

The level of antiapoptotic protein Bcl-2 was diminished while that of proapoptotic protein Bax was increased in t-BHP-treated cells (Fig. 10). Pretreatment with EPA-PS or DHA-PS markedly reversed the Bcl-2 level, with DHA-PS showing better protective effect compared with EPA-PS (P < 0.05). Meanwhile, the level of Bax was markedly decreased by DHA-PS and EPA-PS, compared with model (P < 0.05).

Fig. 10.

Fig. 10

Effect of n-3 PS on Bcl-2 and Bax protein level in PC12 cells pretreated with EPA-PS or DHA-PS (40 μg/mL) for 24 h then exposed to 150 μmol/L t-BHP for 4 h. Expression of Bcl-2 and Bax level were detected by Western blot analysis and normalized against β-actin. Results are mean ± SEM of three independent experiments. ## P < 0.01, versus normal group. a–cMeans with different superscripts among these groups are significantly different (P < 0.05, one-way ANOVA)

Discussion

Oxidative stress-induced cell damage has been implicated in many neurodegenerative diseases, and reactive oxygen species (ROS) are considered to be the mediator of oxidative damage (Yu et al. 2008b). Excessive ROS may induce cell damage directly by destroying cellular proteins, lipids, and nucleic acid, or indirectly by affecting normal cellular pathways (Wang et al. 2012). Increasing evidence suggests that oxidative stress may be the leading cause of neuronal cell death in neurodegenerative diseases (Kim et al. 2015). H2O2 and t-BHP, which are thought to be major precursors of free radicals, have been used in vitro as model compounds to investigate cell damage induced by oxidative stress (Chandra et al. 2000). The rat pheochromocytoma cell line PC12 is frequently used in vitro for neurochemical studies (Gozal et al. 2005).

Exogenous lipids that contain highly enriched DHA species are important to effectively provide adequate DHA donors in brain for daily usage. Exogenous PUFAs esterified in PLs can be incorporated into high-density lipoprotein then transported to the liver for further metabolism. Generally, DHA is delivered to brain mainly in the forms of both nonesterified plasma DHA and lipoprotein PL-derived 2-DHA lysophospholipids. It has been verified that lysophosphatidylcholine can pass across the blood–brain barrier (BBB). We speculate that PS may pass across the BBB. PS is the main PL in the inner leaflet of mammalian plasma membrane and has been shown to play a key role in the functioning of neuron membranes (Kim et al. 2014). Studies have revealed that PS can counteract pathological dysfunctions associated with age-related disorders in humans and deterioration of memory and learning performance in animals (Crook et al. 1991; Lee et al. 2010). PS can be obtained from several sources: BC-PS and an alternative Soy-PS. BC-PS contains approximately 10 % DHA, while Soy-PC/PS is sufficient in n-6 PUFA (mainly LA). Previous studies have revealed that Soy-PS provides little benefit with regard to cognitive functions, compared with BC-PS (Blokland et al. 1999). These results indicate the importance of fatty acid composition. However, use of BC-PS is problematic because of possible transfer of infectious disease (bovine spongiform encephalopathy). Another constraint on use of BC-PS is that the yield of PS from BC is rather low.

Recently, marine-derived PLs, sufficient in n-3 LC-PUFA, have attracted much attention (Burri et al. 2012). Our previous study demonstrated that EPA-enriched PL derived from sea cucumber was effective in protecting PC12 cells from oxidative stress (Wu et al. 2014). In addition, DHA-enriched PL derived from squid roe was proved to be beneficial for improving the intelligence of mice with dementia (Wen et al. 2016). A previous report demonstrated that squid-derived PC and PS can easily pass across the Caco-2 cell barrier, where Soy-PS may be blocked (Hossain et al. 2006). The current results reveal that marine-derived PC and PS exert pronounced protective effects on PC12 cells compared with Soy-PC/PS. Therefore, it may be postulated that PLs sourced from marine products improve learning and memory ability to a greater extent than those sourced from soy, which is probably due to the LC-PUFA action at the sn-2 position. It may also be due to the synergistic effect of LC-PUFA and the residual PS moiety. Among PLs containing the same fatty acid, PS showed better protective effect than PC, suggesting that serine head-group of PL had obvious advantage over choline head-group of PL in protecting against oxidative-induced neuron damage. No obvious enhancement of the protective effect was observed when Soy-PC functioned together with serine, confirming that PS exerts its influence via the serine head-group rather than serine alone.

To further study the neuroprotective effects of PS, LDH release from PC12 cells was measured and their morphology observed when treated with n-3 PS. When cell damage occurs, LDH leaks from the cytoplasm to the extracellular medium due to increased cell membrane permeability, making LDH one of the indexes to evaluate cell damage (Thomas et al. 2015). It was found that LDH leakage was significantly reduced by n-3 PS. Moreover, better morphology was observed when treated with n-3 PS compared with model. Studies have shown that cells are equipped with antioxidant mechanisms that protect them from oxidative stress-induced injury (Jan et al. 2015; Pisoschi and Pop 2015). SOD, which exists in cytoplasm, is an antioxidant enzyme that plays a key role in cellular defense against oxidative stress by catalyzing disproportionation reactions and clearing free radicals (Rattanawong et al. 2015). T-AOC represents the total antioxidant capacity, including enzymatic and nonenzymatic reaction systems (Dadkhah et al. 2006). In the present study, n-3 PS was effective to reverse the reduction of SOD and T-AOC level in PC12 cells induced by H2O2 and t-BHP, and the improvement with DHA-PS was superior to that observed with EPA-PS. These results show that pretreatment of PC12 cells with n-3 PS can inhibit the decrease of antioxidant activity, which may be one of the mechanisms through which n-3 PS protected PC12 cells against oxidative stress-induced cell damage.

Apoptosis is a main type of programmed cell death which involves a series of biochemical events eventually leading to cell death. Numerous studies on mitochondrial dysfunction have revealed that mitochondria are central to oxidative stress-induced apoptosis (Feng et al. 2012; Wallace 2005). Caspases are responsible for cutting proteins selectively, playing a key role in most death signals. Caspase-3 can be activated by Caspase-9, which can be activated by cytochrome c released from mitochondria. Activated caspases enter mitochondria to cleave key substrates in the electron transport chain, leading to increased ROS production and eventually apoptosis. In the present study, the mRNA levels of Caspase-3 and Caspase-9 and the protein expression of Bax were increased by t-BHP, while n-3 PS significantly reduced their activity. Bcl-2 is identified as a negative regulator of apoptosis, disturbing the related mitochondrial apoptosis pathway induced by various stimuli in a variety of cells. In this study, treatment of PC12 cells with n-3 PS could restore the decreased Bcl-2 mRNA and protein level induced by oxidative stress. The PI3k/Akt-2 pathway is another important antiapoptotic pathway that is independent of mitochondria, regulating apoptosis via regulating the expression of apoptotic protease (Guo et al. 2015). GSK-3β can be activated by the PI3k/Akt-2 pathway, thereby reducing neuron death (Eom et al. 2007). Here, it was observed that treatment with n-3 PS could upregulate the decreased Akt-2 and GSK-3β level but without significant difference. Overall, these experimental results demonstrate that n-3 PS was effective in protecting PC12 cells from oxidative stress-induced cell death, mainly via protection of mitochondrial pathway. Previous studies have verified the anticholesterolemic, antithrombotic, and anticancer effects of PL and PUFA (Bayon et al. 1997; Shiratsuchi and Nakanishi 1999). The results showed that n-3 PS could ameliorate damage induced by oxidative stress. The results proved that n-3 PS represents a potential novel therapeutic candidate for protection against oxidation stress-induced neuronal damage, possibly being a functional component for treatment of neurodegenerative diseases such as AD and Parkinson’s. In summary, n-3 PS was more effective in protecting against oxidative stress-induced cell damage compared with n-3 PC, as proved by reversal of decreased cell viability and downregulation of LDH release. Moreover, cells pretreated with n-3 PS showed resistance to the damaging effects of H2O2 and t-BHP, with restored, uniform neuronal shape and number similar to the normal group, with inhibited apoptosis. Underlying mechanisms including antioxidant activity as well as mitochondrial apoptosis were investigated. The results suggest that n-3 PS exerts its effect against oxidative stress in PC12 cells via protective antioxidant mechanisms in cells; in addition, the mitochondrial apoptosis pathway was partly inhibited when treated with n-3 PS.

Acknowledgements

This work was supported by grants from the National Natural Science Foundation of China (No. 31371757) and the project supported by the State Key Program of National Natural Science of China (No. 31330060).

Compliance with Ethical Standards

Conflict of interest

The authors declare that there are no conflicts of interest.

Footnotes

Hongxia Che and Xueyuan Fu contributed equally to this work.

Contributor Information

Jie Xu, Phone: +86 532 82032597, Email: xujie9@ouc.edu.cn.

Yuming Wang, Phone: +86 532 82032597, Email: wangyuming@ouc.edu.cn.

References

  1. Bayon Y, Croset M, Lagarde M, Lecerf J, Thies F, Tayot JL, Chirouze V (1997) Polyunsaturated fatty acid based drugs. US 5654290 A
  2. Blokland A, Honig W, Brouns F, Jolles J (1999) Cognition-enhancing properties of subchronic phosphatidylserine (PS) treatment in middle-aged rats: comparison of bovine cortex PS with egg PS and soybean PS. Nutrition 15:778–783 [DOI] [PubMed] [Google Scholar]
  3. Bonda DJ, Wang X, Perry G, Nunomura A, Tabaton M, Zhu X, Smith MA (2010) Oxidative stress in Alzheimer disease: a possibility for prevention. Neuropharmacology 59:290–294. doi:10.1016/j.neuropharm.2010.04.005 [DOI] [PubMed] [Google Scholar]
  4. Breckenridge WC, Gombos G, Morgan IG (1972) The lipid composition of adult rat brain synaptosomal plasma membranes. Biochim Biophys Acta 266:695–707 [DOI] [PubMed] [Google Scholar]
  5. Burri L, Hoem N, Banni S, Berge K (2012) Marine omega-3 phospholipids: metabolism and biological activities. Int J Mol Sci 13:15401–15419. doi:10.3390/ijms131115401 [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Chandra J, Samali A, Orrenius S (2000) Triggering and modulation of apoptosis by oxidative stress. Free Radic Biol Med 29:323–333 [DOI] [PubMed] [Google Scholar]
  7. Claro FT, Silva RH, Frussa-Filho R (1999) Bovine brain phosphatidylserine attenuates scopolamine-induced amnesia. Physiol Behav 67:551–554 [DOI] [PubMed] [Google Scholar]
  8. Crook TH, Tinklenberg J, Yesavage J, Petrie W, Nunzi MG, Massari DC (1991) Effects of phosphatidylserine in age-associated memory impairment. Neurology 41:644–649 [DOI] [PubMed] [Google Scholar]
  9. Dadkhah A, Fatemi F, Kazemnejad S, Rasmi Y, Ashrafi-Helan J, Allameh A (2006) Differential effects of acetaminophen on enzymatic and non-enzymatic antioxidant factors and plasma total antioxidant capacity in developing and adult rats. Mol Cell Biochem 281:145–152 [DOI] [PubMed] [Google Scholar]
  10. Dvoriantchikova G, Agudelo C, Hernandez E, Shestopalov VI, Ivanov D (2009) Phosphatidylserine-containing liposomes promote maximal survival of retinal neurons after ischemic injury. J Cereb Blood Flow Metab Off J Int Soc Cereb Blood Flow Metab 29:1755–1759 [DOI] [PubMed] [Google Scholar]
  11. Eom TY, Roth KA, Jope RS (2007) Neural precursor cells are protected from apoptosis induced by trophic factor withdrawal or genotoxic stress by inhibitors of glycogen synthase kinase 3. J Biol Chem 282:22856–22864. doi:10.1074/jbc.M702973200 [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Feng Z et al (2012) Maternal docosahexaenoic acid feeding protects against impairment of learning and memory and oxidative stress in prenatally stressed rats: possible role of neuronal mitochondria metabolism. Antioxid Redox Signal 16:275–289. doi:10.1089/ars.2010.3750 [DOI] [PubMed] [Google Scholar]
  13. Ferreiro E, Baldeiras I, Ferreira IL, Costa RO, Rego AC, Pereira CF, Oliveira CR (2012) Mitochondrial- and endoplasmic reticulum-associated oxidative stress in Alzheimer’s disease: from pathogenesis to biomarkers. Int J Cell Biol 2012:735206. doi:10.1155/2012/735206 [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Gozal E, Sachleben LR Jr, Rane MJ, Vega C, Gozal D (2005) Mild sustained and intermittent hypoxia induce apoptosis in PC-12 cells via different mechanisms. Am J Physiol Cell Physiol 288:C535–C542. doi:10.1152/ajpcell.00270.2004 [DOI] [PubMed] [Google Scholar]
  15. Guo H et al (2015) Modulation of the PI3K/Akt pathway and Bcl-2 family proteins involved in chicken’s tubular apoptosis induced by nickel chloride (NiCl(2)). Int J Mol Sci 16:22989–23011. doi:10.3390/ijms160922989 [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Hosokawa M, Shimatani T, Kanada T, Inoue Y, Takahashi K (2000) Conversion to docosahexaenoic acid-containing phosphatidylserine from squid skin lecithin by phospholipase D-mediated transphosphatidylation. J Agric Food Chem 48:4550 [DOI] [PubMed] [Google Scholar]
  17. Hossain Z, Kurihara H, Hosokawa M, Takahashi K (2006) Docosahexaenoic acid and eicosapentaenoic acid-enriched phosphatidylcholine liposomes enhance the permeability, transportation and uptake of phospholipids in Caco-2 cells. Mol Cell Biochem 285:155–163. doi:10.1007/s11010-005-9074-6 [DOI] [PubMed] [Google Scholar]
  18. Jan AT, Azam M, Siddiqui K, Ali A, Choi I, Haq QM (2015) Heavy metals and human health: mechanistic insight into toxicity and counter defense system of antioxidants. Int J Mol Sci 16:29592–29630. doi:10.3390/ijms161226183 [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Kim HY, Huang BX, Spector AA (2014) Phosphatidylserine in the brain: metabolism and function. Prog Lipid Res 56:1–18 [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Kim GH, Kim JE, Rhie SJ, Yoon S (2015) The role of oxidative stress in neurodegenerative diseases. Exp Neurobiol 24:325–340. doi:10.5607/en.2015.24.4.325 [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Lee B, Sur BJ, Han JJ, Shim I, Her S, Lee HJ, Hahm DH (2010) Krill phosphatidylserine improves learning and memory in Morris water maze in aged rats. Prog Neuropsychopharmacol Biol Psychiatry 34:1085–1093 [DOI] [PubMed] [Google Scholar]
  22. Lu FS, Nielsen NS, Baron CP, Jacobsen C (2015) Marine phospholipids: the current understanding of their oxidation mechanisms and potential uses for food fortification. Crit Rev Food Sci Nutr. doi:10.1080/10408398.2014.925422 [DOI] [PubMed] [Google Scholar]
  23. Moriya H, Hosokawa M, Miyashita K (2007) Combination effect of herring roe lipids and proteins on plasma lipids and abdominal fat weight of mouse. J Food Sci 72:C231–C234. doi:10.1111/j.1750-3841.2007.00356.x [DOI] [PubMed] [Google Scholar]
  24. Muthaiyah B, Essa MM, Chauhan V, Chauhan A (2011) Protective effects of walnut extract against amyloid beta peptide-induced cell death and oxidative stress in PC12 cells. Neurochem Res 36:2096–2103. doi:10.1007/s11064-011-0533-z [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Pisoschi AM, Pop A (2015) The role of antioxidants in the chemistry of oxidative stress: a review. Eur J Med Chem 97:55–74. doi:10.1016/j.ejmech.2015.04.040 [DOI] [PubMed] [Google Scholar]
  26. Rattanawong K, Kerdsomboon K, Auesukaree C (2015) Cu/Zn-superoxide dismutase and glutathione are involved in response to oxidative stress induced by protein denaturing effect of alachlor in Saccharomyces cerevisiae. Free Radic Biol Med 89:963–971. doi:10.1016/j.freeradbiomed.2015.10.421 [DOI] [PubMed] [Google Scholar]
  27. Riediger ND, Othman RA, Suh M, Moghadasian MH (2009) A systemic review of the roles of n-3 fatty acids in health and disease. J Am Diet Assoc 109:668–679. doi:10.1016/j.jada.2008.12.022 [DOI] [PubMed] [Google Scholar]
  28. Shiratsuchi A, Nakanishi Y (1999) Phosphatidylserine-mediated phagocytosis of anticancer drug-treated cells by macrophages. J Biochem 126:1101–1106 [DOI] [PubMed] [Google Scholar]
  29. Sponne I et al (2003) Apoptotic neuronal cell death induced by the non-fibrillar amyloid-beta peptide proceeds through an early reactive oxygen species-dependent cytoskeleton perturbation. J Biol Chem 278:3437–3445. doi:10.1074/jbc.M206745200 [DOI] [PubMed] [Google Scholar]
  30. Suzuki S, Yamatoya H, Sakai M, Kataoka A, Furushiro M, Kudo S (2001) Oral administration of soybean lecithin transphosphatidylated phosphatidylserine improves memory impairment in aged rats. J Nutr 131:2951–2956 [DOI] [PubMed] [Google Scholar]
  31. Tandy S, Chung RW, Wat E, Kamili A, Berge K, Griinari M, Cohn JS (2009) Dietary krill oil supplementation reduces hepatic steatosis, glycemia, and hypercholesterolemia in high-fat-fed mice. J Agric Food Chem 57:9339–9345. doi:10.1021/jf9016042 [DOI] [PubMed] [Google Scholar]
  32. Thomas MG, Marwood RM, Parsons AE, Parsons RB (2015) The effect of foetal bovine serum supplementation upon the lactate dehydrogenase cytotoxicity assay: important considerations for in vitro toxicity analysis. Toxicol In Vitro 30:300–308. doi:10.1016/j.tiv.2015.10.007 [DOI] [PubMed] [Google Scholar]
  33. Van AL et al (2016) Mechanisms of DHA transport to the brain and potential therapy to neurodegenerative diseases. Biochimie 130:163–167 [DOI] [PubMed] [Google Scholar]
  34. Wallace DC (2005) A mitochondrial paradigm of metabolic and degenerative diseases, aging, and cancer: a dawn for evolutionary medicine. Annu Rev Genet 39:359–407. doi:10.1146/annurev.genet.39.110304.095751 [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Wang J, Sun P, Bao Y, Dou B, Song D, Li Y (2012) Vitamin E renders protection to PC12 cells against oxidative damage and apoptosis induced by single-walled carbon nanotubes. Toxicol In Vitro Int J Publ Assoc BIBRA 26:32–41. doi:10.1016/j.tiv.2011.10.004 [DOI] [PubMed] [Google Scholar]
  36. Wen M et al (2016) DHA-PC and DHA-PS improved Aβ1–40 induced cognitive deficiency uncoupled with an increase in brain DHA in rats. J Funct Foods 22:417–430 [Google Scholar]
  37. Wu FJ et al (2014) The protective effect of eicosapentaenoic acid-enriched phospholipids from sea cucumber Cucumaria frondosa on oxidative stress in PC12 cells and SAMP8 mice. Neurochem Int 64:9–17 [DOI] [PubMed] [Google Scholar]
  38. Yu S, Liu M, Gu X, Ding F (2008a) Neuroprotective effects of salidroside in the PC12 cell model exposed to hypoglycemia and serum limitation. Cell Mol Neurobiol 28:1067–1078 [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Yu Y, Du JR, Wang CY, Qian ZM (2008b) Protection against hydrogen peroxide-induced injury by Z-ligustilide in PC12 cells. Exp Brain Res 184:307–312. doi:10.1007/s00221-007-1100-3 [DOI] [PubMed] [Google Scholar]

Articles from Cellular and Molecular Neurobiology are provided here courtesy of Springer

RESOURCES