FIG. 9.
Identification of a second, lower-affinity OBP site (OBP-1) by competitive EMSA. (A) Competition with 16- and 80-fold molar excesses of unlabeled DNA duplexes containing HHV-7 OBP-2 (7–2B) and OBP-1 (7–1B, GGAGGGTTCATTGATCCTCCTTGCCTGCAATTCT) with 32P-labeled 7–2 for binding to OBPH7 in buffers A and B (see Materials and Methods). The amount of residual shifted target was quantitated by PhosphorImager analysis. The percentage of inhibition of binding to 32P-labeled 7–2 DNA relative to 7–2B at 80-fold molar excesses by each competitor DNA duplex is shown beneath the gel. −, no competitor present; R, negative control lysate. (B) Conditions are the same as described for panel A, except that binding buffer B was used. Oligonucleotide 6 contains the OBP-1 site and is described in the legend to Fig. 4. TAR is described in the legend for Fig. 5.