Key resources table.
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain (Drosophila melanogaster) | Canton S | Bloomington Stock Center | ||
| Strain (D. melanogaster) | mnb[1] | Tejedor et al., 1995 | FBal0012364 | gift from Francisco J. Tejedor |
| Genetic reagent (D. melanogaster) | UAS-mnb | Shaikh et al., 2016 | FBtp0114512 | gift from Francisco J. Tejedor |
| Genetic reagent (D. melanogaster) | UAS-RHEB | Bloomington Stock Center | FBst0009688 | |
| Genetic reagent (D. melanogaster) | D42-Gal4 | Bloomington Stock Center; Gustafson and Boulianne, 1996 | FBti0002759 | |
| Genetic reagent (D. melanogaster) | P[(45)w[+mC]=UAS Tor.TED]II | Bloomington Stock Center; Shaikh et al., 2016 | FBti0026636 | |
| Genetic reagent (D. melanogaster) | UAS-mCherry | Bloomington Stock Center | FBti0147460 | |
| Chemical compound | 4% paraformaldehyde | Himedia | Cat# TCL119 | |
| Antibody | Mouse anti-DLG | DSHB; Shaikh et al., 2016 | CatID# 4F3 | IF (1:500) |
| Antibody | Rabbit anti-HRP conjugated with alexa488 | Jackson | CatID# 123-545-021 | IF (1:500) |
| Antibody | Goat anti-mouse conjugated with Alexa 555 | Invitrogen | CatID# A28180 | IF (1:500) |
| Other | Microsocope: Leica Stellaris 5 | Leica | PL APO 40 X/1.30 oil objective | |
| Other | Microsocope: Olympus FV3000 | Olympus | UPLFLN 40 X/1.30 oil objective | |
| Cell line (Homo sapiens) | HEK293 | ATCC | CRL-1573 | |
| Cell line (H. sapiens) | 293T | ATCC | CRL-3216 | |
| Cell line (Mus musculus) | NIH3T3 | ATCC | CRL-1658 | |
| Cell line (H. sapiens) | SH-SY5Y | ATCC | CRL-2266 | |
| Transfected construct (H. sapiens) | DYRK1A shRNA | ThermoFisher; Li et al., 2018 | Lentiviral construct to transduce and express the shRNA. | |
| Transfected construct (M. musculus) | Dyrk1a sgRNA | This paper | Lentiviral construct to transduce and mediate Dyrk1a knockout |
|
| Antibody | anti-Actin (rabbit monoclonal) | Abclonal | Cat# AC026 | WB (1:5000) |
| Antibody | anti-HA (mouse monoclonal) | Abclonal | Cat# AE008 | WB (1:5000) |
| Antibody | anti-TSC1 (rabbit polyclonal) | Cell Signaling Technology | Cat# 4906 | WB (1:1000) |
| Antibody | anti-TSC2 (rabbit monoclonal) | Cell Signaling Technology | Cat# 4308 | WB (1:1000) |
| Antibody | anti- p70 S6 Kinase (rabbit monoclonal) | Cell Signaling Technology | Cat# 2708 | WB (1:1000) |
| Antibody | anti- Phospho-p70 S6 Kinase (Thr389) (rabbit polyclonal) | Cell Signaling Technology | Cat# 9205 | WB (1:1000) |
| Antibody | anti- S6 Ribosomal Protein (mouse monoclonal) | Cell Signaling Technology | Cat# 2317 | WB (1:1000) |
| Antibody | anti- Phospho-S6 Ribosomal Protein (Ser235/236) (rabbit monoclonal) | Cell Signaling Technology | Cat# 4856 | WB (1:1000) |
| Antibody | anti-Flag(mouse monoclonal) | MBL | Cat# M185 | WB (1:5000) |
| Antibody | anti-Phospho-TSC2-T1462(rabbit polyclonal) | Abclonal | Cat# AP0866 | WB (1:1000) |
| Antibody | anti-Phospho-TSC2-S1387 (rabbit polyclonal) | Abclonal | Cat# AP1117 | WB (1:1000) |
| Antibody | anti-Phospho- TSC2-S939 (rabbit polyclonal) | Cell Signaling Technology | Cat# 3615 | WB (1:1000) |
| Antibody | anti-DYRK1A | PMID:30137413 | WB (1:2000) | |
| Recombinant DNA reagent | pcDNA3-HA3-TSC1 (plasmid) | Addgene | RRID:Addgene_19911 | |
| Recombinant DNA reagent | pcDNA3 Flag TSC2 (plasmid) | Addgene | RRID:Addgene_14129 | |
| Recombinant DNA reagent | LentiCRISPR v2(plasmid) | Addgene | RRID:Addgene_52961 | |
| Sequence-based reagent | DYRK1A-RT-F | This paper | RT-qPCR primers | AAGCTCAGGTGGCTCATCGG |
| Sequence-based reagent | DYRK1A-RT-R | This paper | RT-qPCR primers | TCTCGCAGTCCATGGCCTG |
| Sequence-based reagent | GAPDH-RT-F | This paper | RT-qPCR primers | ACAACTTTGGTATCGTGGAAGG |
| Sequence-based reagent | GAPDH-RT-R | This paper | RT-qPCR primers | GCCATCACGCCACAGTTTC |
| Sequence-based reagent | Control-sgRNA | This paper | SgRNA target sequences for mouse cells | CGAGGTATTCGGCTCCGCG |
| Sequence-based reagent | Dyrk1a-sgRNA | This paper | SgRNA target sequences for mouse cells | CGCTTTTATCGGTCTCCAG |
| Commercial assay or kit | BCA Protein Quantification Kit | Meilunbio | Cat# MA0082 | |
| Commercial assay or kit | HiScript II 1st Strand cDNA Synthesis Kit | Vazyme | Cat# R212 | |
| Chemical compound, drug | Puromycin | Solarbio | Cat# P8230 | |
| Chemical compound, drug | Doxycycline | MCE | Cat# HY-N0565 | |
| Software, algorithm | GraphPad | Prism v.7.00 | RRID:SCR_002798 | |
| Software, algorithm | ImageJ | ImageJ v.1.53 | RRID:SCR_003070 | |
| Other | Anti-Flag Beads | Smart-Lifesciences | Cat# SA042005 | |
| Other | r Protein A/G MagPoly Beads | Smart-Lifesciences | Cat# SM015001 |