TABLE 1.
Oligonucleotides used for linker-insertion mutagenesis, primer-directed mutagenesis, and RT-PCR
| Oligonucleotide | Sequencea (5′→3′) | Nucleotide positions (BVDV CP7) |
|---|---|---|
| BEMLU | acgcgt | |
| BALU | gatcgacgcgtc | |
| NIPLU | cacgcgtgtgca | |
| SALU | tcgagacgcgtc | |
| BESLU | gtgacgacgcgt | |
| BESLU-R | gtcacacgcgtc | |
| HILU | agctacgcgtgg | |
| HILU-R | agctccacgcgt | |
| BVD CS 11 | tttcggcagaagatcttcctaccacttg | 7224–7197 |
| L2336R | cacccactgctcgctcctttagttc | 7413–7389 |
| L2683R+ | gggaagatacgtaaccggtctgggaattatg | 8427–8457 |
| L2683R− | cataattcccagaccggttacgtatcttccc | 8457–8427 |
| 5ABLSDPs | cctataccatgaaggatcctagttggtttcttc | 9916–9948 |
| 5ABLSDPas | gaagaaaccaactaggatccttcatggtatagg | 9948–9916 |
| B38 | cagtccagacaattggc | 8266–8282 |
| B42 | gttgggatcactttagtt | 9270–9287 |
| B49R | agaacaaagggcctttcat | 9469–9451 |
| B53R | cctgcttccgtcattatg | 10372–10355 |
a
Restriction sites introduced by the mutation are underlined (MluI in BEMLU, BALU, NIPLU, SALU, BESLU, BESLU-R, HILU, and HILU-R; BglII in BVD CS 11; SnaBI in L2683R+ and L2683R−; BamHI in 5ABLSDPs and 5ABLSDPas). Mutated nucleotides are indicated by italics.