Abstract
Theiler's virus is a picornavirus responsible for a persistent infection of the central nervous system of the mouse, leading to a chronic demyelinating disease considered to be a model for multiple sclerosis. The leader (L) protein encoded by Theiler's virus is a 76-amino-acid-long peptide containing a zinc-binding motif. This motif is conserved in the L proteins of all cardioviruses, including encephalomyocarditis virus. The L protein of Theiler's virus was suggested to interfere with the alpha/beta interferon (IFN-α/β) response (W.-P. Kong, G. D. Ghadge, and R. P. Roos, Proc. Natl. Acad. Sci. USA 91:1796–1800, 1994). We show that expression of the L protein indeed inhibits the production of alpha/beta interferon by infected L929 cells. The L protein specifically inhibits the transcription of the IFN-α4 and IFN-β genes, which are known to be activated early in response to viral infection. Mutation of the zinc finger was sufficient to block the anti-interferon activity, outlining the importance of this motif in the L protein function. In agreement with the anti-interferon role of the L protein, a virus bearing a mutation in the zinc-binding motif was dramatically impaired in its ability to persist in the central nervous system of SJL/J mice.
Theiler's murine encephalomyelitis virus (TMEV) (or Theiler's virus), a member of the Picornavirus family, is a naturally occurring enteric pathogen of the mouse, responsible for central nervous system (CNS) infections (32). The neurovirulent strains (GD7 and FA) cause an acute lethal encephalomyelitis. The persistent strains (DA and BeAn) induce a biphasic disease after intracerebral inoculation of susceptible mice (18). After a mild encephalomyelitis lasting about 2 weeks, mice develop a chronic demyelinating disease, which serves as an experimental model of multiple sclerosis (for review, see references 8 and 25).
TMEV can be recovered from the spinal cord white matter virtually lifelong, indicating that active viral replication occurs during persistence despite the host immune response. Viral persistence appears to be required to induce the chronic demyelinating disease, but the exact mechanisms involved in persistence are still poorly understood. Among the viral determinants of persistence identified, the capsid plays a crucial role, probably affecting the tropism of the virus in the CNS (2, 11, 22). However, viral factors allowing the virus to escape the host immune response could also play a pivotal role in establishing persistence.
Antagonism of the innate immune response mediated by alpha/beta interferons (IFNs-α/β) is a common determinant of virulence (33). Indeed, IFNs-α/β are cytokines produced by most cell types in response to viral infection. The antiviral action of IFNs is mediated by the activation of proteins, such as protein kinase R (PKR), the 2′-5′-oligodenylate synthetase, or the Mx proteins, known to interfere with the viral cycle (29).
The genome of picornaviruses is translated as a long precursor polyprotein that undergoes autoproteolytic cleavage to yield the mature viral proteins. The leader (L) protein of TMEV is a 76-amino-acid-long acidic protein corresponding to the N terminus of the viral polyprotein. L contains a zinc-binding C-H-C-C motif critical for its function in vitro (3, 14). In vivo, the L protein was demonstrated to be essential for neurovirulence of the GDVII strain (1).
In vitro, L is required for viral propagation in L929 cells but not in BHK-21 cells. Since the latter cells are reportedly non-IFN responsive, Kong et al. (14) postulated that the L protein could antagonize the cell interferon response.
The purpose of this study was to test the anti-IFN role of the L peptide and to examine its influence in establishing viral persistence. We show that L inhibits IFN-α/β production and that it selectively blocks the transcription of the immediate-early interferon genes (α4 and β) in L929 cells. The L protein is critical for persistence of the DA1 virus in vivo.
MATERIALS AND METHODS
Construction of mutant viruses.
Site-directed mutagenesis (16) was used to introduce three mutations in the region coding for the zinc finger motif of the L peptide of the DA1 persistent strain (Fig. 1) without affecting the amino acid sequence of the L* protein encoded by an overlapping reading frame (15). Mutagenesis was performed with oligonucleotide TM56 (5′-AAC GGC TGT GCG AAT AGT GCG CAC ATC TGG GT) on pTM410, a plasmid carrying nucleotides (nt) 1 to 1729 of the DA1 virus. A BssHII-BsiWI fragment (nt 665 to 1265 of DA1) containing the mutations was sequenced to ensure that no unexpected mutation occurred. This fragment was then cloned to replace the corresponding region of plasmid pRS5 (24), yielding plasmid pTM595. An XbaI-Van91I fragment (nt 1 to 2983 of DA1) of pTM595 was then used to replace the corresponding fragment of pTM379, a pTMDA1 derivative carrying a large BglII deletion in this region (nt 394 to 2432 of DA1). The plasmid obtained, called pTM598, carries the full-length genome of DA1 with the three point mutations introduced in the zinc finger of the L region (Lcys) (Table 1). The virus derived from this plasmid is called TM598.
FIG. 1.
Mutations in the zinc-binding motif of the L protein. Point mutations were introduced in codons 11, 12, and 14 of the L-coding sequence of the DA1 and KJ6 viruses to produce the mutant viruses called TM598 and TM659, respectively. Translation of the L protein (Lwt) and of its mutant form, called Lcys, is shown above the corresponding nucleotide sequence. Nucleotides and amino acids that were mutated are underlined. The amino acid sequence of the L* alternative ORF, shown under the nucleotide sequence, was unaffected by the mutations.
TABLE 1.
Viruses used in the experiments
| Type of encoded L protein | Virus with wild-type capsid | Virus with L929-adapted capsid |
|---|---|---|
| Wild-type L (Lwt) | DA1 | KJ6 |
| Zinc finger mutations in L (Lcys) | TM598 | TM659 |
| 61-amino-acid deletion in L and L* (LΔ7–67) | TM564 |
The capsid coding region of pTM598, contained in a BsiWI-BamHI fragment (nt 1265 to 3925 of DA1), was then replaced by the corresponding region of pKJ6 (12), a variant of pTMDA1 with mutations in the capsid coding region that enhance infection of L929 cells. The recombinant carrying the Lcys mutations and the capsid adapted to L929 cells was called pTM659 (Table 1). The virus derived from this plasmid is called TM659.
pTM564 carries a 61-codon deletion (LΔ7-67) affecting both the L and L* reading frames. The construction of this plasmid was described earlier (24).
Cell culture and virus production.
BHK-21 cells were cultured in Glasgow minimum essential medium (Gibco-BRL) supplemented with 10% newborn bovine serum (Gibco-BRL), 100 IU of penicillin/ml, 100 μg of streptomycin/ml, and 130 g of tryptose phosphate broth (Gibco-BRL)/liter. 2fTGH, U3A (23), BALB/3T3, and L929 cells were cultured in Dulbecco's modified Eagle medium (Gibco-BRL) supplemented with 10% fetal bovine serum (Gibco-BRL), 100 IU of penicillin/ml, 100 μg of streptomycin/ml, and 1 mM sodium pyruvate. TMEV derivatives were produced by electroporation of BHK-21 cells (24) with the genomic RNA transcribed in vitro from plasmids carrying the corresponding cDNAs: pTMDA1 (21, 24), pKJ6 (12), pTM564 (24), pTM598, and pTM659 (this work).
Culture supernatants were collected after completion of the cytopathic effect (generally between 48 and 72 h after transfection). The culture supernatants were frozen, thawed, and centrifuged at 4,000 × g for 15 min. The supernatants were then collected and stored in aliquots at −70°C. Viruses were titrated on BHK-21 cells by standard plaque assay. The Mengo virus strain of encephalomyocarditis virus (EMCV) was produced in a similar way from the pMC24 cDNA clone (9).
RNA extraction for dot blotting.
RNA was prepared from cells or from mouse tissues (brain and spinal cord) by using the technique described by Chomczynski and Sacchi (5). Dot blot hybridization to measure viral RNA levels was performed as described previously (24).
Inactivation of supernatants and estimation of IFN-α/β production.
The protocol established was inspired by that used by Chinsangaram et al. (4). Culture supernatants from L929 cells infected for 48 h at a multiplicity of infection (MOI) of 0.2 PFU per cell were collected and centrifuged in a microtube at 15,000 × g for 3 min to remove cellular debris. Supernatants were then brought to pH 2 with a 2 M hydrochloric acid solution. After 24 h at 4°C, the pH was restored to 7 with a 2 M sodium hydroxide solution. Inactivation of the virus in the pH 2-treated supernatant samples was checked by plaque assay on BHK-21 cells. Priming of L929 cells was usually done as follows: 5 × 104 to 1 × 105 cells were incubated in a 24-well plate with 250 μl of pH 2-treated supernatant diluted two times in Dulbecco modified Eagle medium supplemented with 10% fetal calf serum. A series of supernatant samples were treated in parallel, with 80 U of a blocking anti-murine IFN-α/β polyclonal antibody (PBL Biomedical Laboratories) per ml for half an hour at room temperature before priming. At 24 h after priming, cells were infected with KJ6 at an MOI of 1 PFU per cell. Various techniques were used to compare the extent of infection of cells primed with the different pH 2-treated supernatants, including plaque assay, dot blot hybridization, flow cytometry, or immunocytochemistry. The latter techniques involved intracellular labeling of viral antigen with a monoclonal anti-VP1 antibody (F12B3).
IFN activity.
IFN activity was quantified by a plaque number reduction assay. BALB/3T3 cells were seeded in six-well plates at a density of 5 × 105 cells per well. After 24 h, cells were treated for 24 h with fourfold serial dilutions of three independent pH 2-treated supernatants (that had been kept frozen at −70°C) or with serial dilutions of reference mouse IFN-β (PBL laboratories), which was itself calibrated against reference IFN from the National Institutes of Health. Cells were then infected for 1 h with a test virus (vesicular stomatitis virus [VSV] or Mengo virus) and overlaid with 0.8% agarose in modified Eagle medium (Gibco-BRL) for plaque assay. Results were confirmed by a standard cytopathic effect reduction assay performed in 96-well plates with the same cells and viruses.
RT-PCR.
For the detection of cytokine mRNA, total RNA was extracted from cells by using the Microprep kit (Stratagene). As the IFN genes are intronless, RNA samples (5 to 10 μg) were additionally treated with 20 U of fast-protein liquid chromatography-purified DNase I (Amersham Pharmacia Biotech) prior to reverse transcriptase PCR (RT-PCR), as previously described (28). RT-PCRs were performed with and without RT in order to exclude genomic DNA contamination. Conditions used for PCR are presented in Table 2. The sequences of the primers were from reports by Shaw-Jackson and Michiels (28) for β-actin and virus, by Chinsangaram et al. (4) for IFN-α, ΙFN-β, and PKR, and by Deonarain et al. (6) for IFN-α4 and IFN-non-α4. Note that 1 nucleotide was added to the TM264 primer to increase melting temperature and specificity. Primers sequences were as follows: TM4, TTCCCTCCATCGCGACGTGGT; TM132, GTGCCATAGTAGCAAAAGCA; TM92, TGGCGCTTTTGACTCAGGAT; TM93, AGCCCTGGCTGCCTCAAC; TM235, ATGGCTAGRCTCTGTGCTTTCCT; TM236, AGGGCTCTCCAGAYTTCTGCTCTG; TM237, CATCAACTATAAGCAGCTCCA; TM238, TTCAAGTGGAGAGCAGTTGAG; TM257, CGTTGTCACATCTACATTCAGTGGC; TM258, GGATTTTCCATCATTTT CCAGGGC; TM263, CTGGTCAGCCTGTTCTCTAGGATGT; TM264, TCAGAGGAGGTTCCTGCATCAC; TM265, ARSYTGTSTGATGCARCAGGT; TM266, GGWACACAGTGATCCTGTGG.
TABLE 2.
Primers and PCR conditions
| Primers (sense, antisense) | Gene fragment | Fragment length (bp) | No. of cycles | Annealing temp (°C) |
|---|---|---|---|---|
| TM4, TM132 | Virus | 1,125 | 20–30 | 58 |
| TM92, TM93 | β-Actin | 460 | 20–30 | 58 |
| TM235, TM236 | Total IFN-α | 524 | 30–35 | 58 |
| TM237, TM238 | IFN-β | 354 | 40 | 58 |
| TM257, TM258 | PKR | 680 | 30–35 | 58 |
| TM263, TM264 | IFN-α4 | 314 | 35–40 | 55–58 |
| TM265, TM266 | IFN-non-α4 | 104 | 35–40 | 55 |
Infection of mice.
Three-week-old female SJL/J mice (from IFFA-CREDO) were inoculated intracranially in the right hemisphere with 40 μl of viral suspension containing 105 PFU of the indicated virus. At 5 or 45 days postinfection, groups of four mice were sacrificed and their viral loads in brain and spinal cord were quantified by dot blot analysis. Note that some of the data for DA1- and TM564-infected mice were reported previously (34).
RESULTS
Construction of L mutant viruses.
We constructed a DA1 mutant (called TM598) by disrupting the zinc finger C-H-C-C motif of the TMEV L protein (Lcys mutant) without altering the amino acid sequence of the L* protein encoded by an alternative overlapping open reading frame (Fig. 1). The same mutations were also introduced in the KJ6 virus, which is a DA1 derivative carrying a capsid adapted to L929 cells (12). The KJ6 derivative with the Lcys mutation was called TM659 (Table 1). In agreement with previous data (14), both the Lcys and LΔ7-67 mutant viruses formed plaques on BHK-21 cells comparable in size to plaques formed by the parental viruses. On L929 cells, however, the mutants formed only minute to undetectable plaques while parental viruses formed medium-sized plaques.
After a single cycle of L929 cell infection (14 h) at an MOI of 0.2 PFU per cell, the yield of infectious virus was slightly (2.4 times) higher for the KJ6 virus than for the Lcys derivative TM659 (7.5 ± 1.08 × 104 and 3.2 ± 0.85 × 104 PFU per ml, respectively).
A soluble factor secreted by L929 cells is capable of restricting viral propagation.
L929 cell monolayers were infected at an MOI of 0.1 PFU per cell with either the wild-type (DA1) or the Lcys mutant (TM598) virus or with a 1:1 mixture of the two viruses. Viral replication was assessed by dot blot hybridization 24 and 48 h postinfection (Fig. 2).
FIG. 2.
Inhibition of viral propagation by a soluble factor. Dot blot hybridization was performed to detect viral RNA in L929 cells infected for 24 and 48 h with the wild-type virus (DA1), the Lcys mutant (TM598) virus, or a 1:1 mixture of the two viruses. A representative blot of three independent experiments is shown.
As reported by Kong et al. (14), viral replication of the L-mutant virus was restricted in L929 cells compared to that of the wild-type virus. In the case of the mixed infection, the level of viral RNA was not higher than that in the case of the L mutant. As coinfection of cells by both viruses was unlikely due to the low MOI used, the results suggest that a soluble factor, such as IFN-α/β, secreted by TM598-infected cells rendered neighboring cells resistant to both wild-type and mutant virus infection.
L protein inhibits IFN-α/β production in L929 cells.
In order to confirm that the hypothetical soluble factor responsible for restriction of virus propagation was indeed IFN-α/β, we compared the amounts of IFN-α/β secreted by L929 cells infected with viruses expressing the wild-type or the mutated L protein. The protocol (Fig. 3) that we followed to detect IFN-α/β took advantage of the following properties: (i) IFNs-α/β are known to be stable at pH 2 (30), (ii) conversely, TMEV is inactivated at pH 2 (32), (iii) L929 cells are IFN responsive, and priming by IFN-α/β induces an antiviral state in these cells, and (iv) TMEV is inhibited by IFN-α/β (10). Viruses adapted to L929 cells were used in these experiments to ensure efficient infection.
FIG. 3.
Strategy used to compare IFN production by wild-type and Lcys virus-infected L929 cells. L929 cells monolayers were infected with KJ6 or TM659 or were left uninfected. At 48 h after infection, the culture supernatant was collected, brought to pH 2 for 24 h at 4°C, and then neutralized. A sample of the pH 2-treated supernatant was subsequently treated with a neutralizing anti-mouse IFN-α/β antibody. Conditioned supernatants were then used to prime fresh L929 cell monolayers for 24 h, and the relative resistance of primed cells to KJ6 virus infection was measured.
Supernatants from KJ6 (Lwt), TM659 (Lcys), or mock-infected cells were collected 48 h after infection. These supernatants were then treated at pH 2 to inactivate the virus and then used to prime L929 cells. Cells primed with the various supernatants were then infected by KJ6 to compare their resistance to viral infection.
As shown in Fig. 4A, priming of L929 cells with a supernatant from KJ6-infected cells did not protect cells from subsequent infection better than priming with a supernatant from mock-infected cells. This suggests that little or no IFN-α/β was produced in the supernatant of KJ6-infected cells in the conditions used. In contrast, priming of L929 cells with supernatants from L-mutant-infected cells strongly inhibited subsequent infection (about an 80% reduction in the number of infected cells).
FIG. 4.
Inhibition of IFN-α/β production by L protein. The graphics present the relative susceptibility to KJ6 of L929 cells primed with pH 2-treated supernatants from KJ6-, TM659-, or mock-infected L929 cells. The percentage of infected cells was determined by immunocytochemistry. The graphs show the means and standard deviations of experiments performed in triplicate, with three independent supernatants used to prime cells. (A) Susceptibility of cells primed with pH 2-treated supernatants. (B) As in panel A, except that pH 2-treated supernatants were treated in parallel with a neutralizing anti-IFN-α/β antibody prior to priming. (C) Immunolabeling of viral antigen in KJ6-infected L929 cells primed with supernatant from the Lcys TM659 mutant virus without (a) or with (b) anti-IFN antibody treatment of the supernatant.
To confirm that the inhibition of viral infection was really due to the presence of IFN-α/β in the pH 2-treated supernatants, samples of pH 2-treated supernatants were treated in parallel with an anti-IFN-α/β antibody prior to cell priming. As shown in Fig. 4B and C, such a treatment completely abolished the antiviral effect of cell priming.
The amount of IFN present in the supernatant of infected cells was quantified using both VSV and the Mengo virus strain of EMCV as reporter viruses. In the conditions used (pH 2-treated supernatants collected 48 h after infection and stored frozen), TM659-infected cells consistently produced between 5 × 103 and 20 × 103 U of IFN per ml, protective toward both VSV and Mengo virus infections. No IFN activity (<100 U per ml) could be demonstrated in the supernatant of KJ6-infected cells.
In conclusion, this experiment shows that the L peptide is capable of inhibiting IFN-α/β production by L929 cells. Disruption of the zinc-binding motif of the protein is sufficient to block this anti-IFN activity.
Infection of STAT-1-deficient cells.
As IFN-α/β signaling occurs through STAT-1 phosphorylation and translocation, we analyzed whether L mutant viruses could replicate in STAT-1 deficient cells. Therefore, we compared the infection of 2fTGH human fibroblasts and of their STAT-1-deficient derivatives (U3A cells) by the DA1 and TM598 viruses. Infections were performed at 0.5 or 5 PFU per cell. Replication was followed at different time points between 14 and 48 h by dot blot hybridization (Fig. 5). U3A cells appeared to be highly susceptible to infection by both the wild-type and Lcys viruses. In these cells, the difference of replication between wild-type and mutant viruses was low (1.1 to 1.6 times higher for the wild type) while, in 2fTGH cells, the difference was more pronounced (3.7 to 8 times higher for the wild type). This observation nicely fits an anti-IFN role for L. One does not know at this time whether the small but reproducible reduction of replication observed in U3A cells for the mutant virus reflects a STAT-1-independent effect of the IFN pathway or an additional role for the L protein.
FIG. 5.
Infection of STAT-1-deficient cells. 2fTGH cells and their STAT-1−/− derivatives (U3A cells) were infected by the wild-type virus (DA1) or the Lcys mutant virus (TM598) at an MOI of 5 PFU per cell. At 24 h after infection, total RNA was extracted from infected and mock-infected cells (−) and viral replication was measured by dot blot hybridization.
L protein selectively inhibits transcription of immediate-early IFN genes.
In order to examine whether the inhibitory effect of the L protein on the IFN-α/β production was due to transcriptional repression, RT-PCRs were performed to compare IFN mRNA levels in cells infected with the wild-type and mutant viruses. RNA was extracted from L929 cells infected for 7 h with KJ6 or TM659 at an MOI of 5 PFU per cell. At this MOI, the proportion of cells infected by the two viruses was comparable (more than 95% of antigen-positive cells), as measured by fluorescence-activated cell sorter analysis (not shown).
RT-PCR results (Fig. 6) showed a strong inhibition of the transcription of IFN-α4 and IFN-β in KJ6-infected cells 7 h after infection. In contrast, in these cells, the mRNA levels of total IFN-α and of IFN-non-α4 were similar if not higher than those in cells infected with the mutant virus. This specific inhibition of IFN-α4 and IFN-β by the Lwt-expressing virus was confirmed in a time course experiment (1 to 7 h) (Fig. 7) and in several independent experiments with samples analyzed 12 and 24 h after infection at MOIs of 5 and 0.1 PFU/cell (data not shown). No clear effect of the viral infection was seen on the level of PKR mRNA.
FIG. 6.
Specific inhibition by the L protein of immediate-early IFNs (α4 and β). Total RNA was extracted from L929 cells infected for 7 h with viruses expressing the wild-type L protein (KJ6) or the Lcys mutant (TM659) or from mock-infected cells (−). RT-PCR was used to measure mRNA levels of total IFN-α, IFN-non-α4, IFN-α4, IFN-β, and PKR. Viral RNA and β-actin mRNA were amplified as controls. PCR conditions used are shown in Table 1. Note the strong inhibition of IFN-α4 and IFN-β, but not of total IFN-α, in cells infected with the wild-type virus, producing the Lwt protein.
FIG. 7.
Kinetics of IFN-α4 and IFN-β inhibition. As described in the legend to Fig. 6, except that samples were analyzed from 1 to 7 h after infection to check whether inhibition was already effective at early times of IFN induction.
L protein is essential for persistence of TMEV in CNS.
The L peptide was previously shown to be essential for the neurovirulence of the GDVII virus strain (1). We wanted to determine whether L was also required for the pathogenesis of the persistent strain DA1. We therefore assessed, by dot blot hybridization, the level of viral persistence of wild-type DA1 and mutant TM598 (Lcys) and TM564 (LΔ7-67) viruses in brains and spinal cords of SJL/J mice 5 and 45 days postinfection (Fig. 8).
FIG. 8.
Mutation of the L protein zinc finger strongly affects viral infection of the mouse CNS. (A) Viral RNA detected by dot blot hybridization in the brain and spinal cord of mice infected in parallel with viruses DA1, TM598, and TM564, for 5 and 45 days. Reprinted in part from reference 34 with permission. (B) The levels of viral RNA were quantified using a phosphorimager and are shown as relative amounts of viral RNA per organ. The levels of β-actin mRNA, measured as a control, were highly homogenous among the samples. TM598 is the Lcys mutant of DA1. TM564 contains a 61-codon-long deletion in the L ORF as well as in the overlapping L* ORF.
The 61-codon deletion of TM564 had a dramatic effect on viral persistence, as this virus was not detected by RT-PCR of the CNS of the mouse 45 days after infection. However, it is noteworthy that the deletion present in the L region of the virus also affected the L* reading frame so that the lack of persistence cannot be attributed solely to the mutations in L.
The mutation of L in TM598 also had a strong impact on virus persistence. At 45 days postinoculation, the amount of Lcys-mutant virus RNA in the spinal cord was 36 times lower than that of the wild-type virus. Viral persistence was severely but not completely blocked at this time since viral RNA of the Lcys mutant could still be detected by RT-PCR in the spinal cord of four out of four mice. Sequencing of the RT-PCR products confirmed the virus identity and showed that no revertants were selected during infection. The effect of the L protein zinc-binding motif disruption was already apparent 5 days postinfection (fourfold effect). This could indicate that a functional L peptide is required for efficient viral infection during the acute phase of the disease and is in agreement with the observed anti IFN-α/β role of the protein.
DISCUSSION
Inhibition of IFN-α/β by L peptide.
Kong et al. (14) have observed that the L peptide of TMEV is required for viral spread in L929 cells, but not in non-IFN-responsive BHK-21 cells. On the basis of these observations, they proposed that the L protein could interfere with the host IFN response. Our results establish that the L peptide indeed inhibits IFN-α/β production by infected L929 cells, as supernatants of cells infected with a virus expressing the wild-type L protein failed to prime naive cells for viral resistance.
To analyze the level at which repression of IFN production occurred, we performed RT-PCRs to monitor IFN mRNA levels in infected cells. As soon as 7 h after infection, we observed a strong inhibition of the transcription of the IFN-α4 and IFN-β genes in L929 cells infected with the KJ6 virus. This effect is strikingly selective as the transcription of IFN-non-α4 genes and that of the PKR gene were not decreased.
IFN-α4 and IFN-β are termed the immediate-early IFN genes, being the first two subtypes synthesized following viral infection (6, 19, 20, 26). Several transcriptional activators have been shown to cooperate in forming an active enhanceosome at the IFN-β promoter (35). These include IRF-3, NF-κB, and ATF/c-Jun, which are all activated by phosphorylation in the cytoplasm and translocate to the nucleus following viral infection. The immediate-early IFNs are subsequently secreted and act in a paracrine manner to induce an antiviral state in neighboring cells. They might also act in an autocrine fashion to induce the transcription of the other IFN-α subtypes.
The selective inhibition of IFN-α4 and IFN-β observed in L929 cells suggests that the L peptide targets a specific factor involved in their transcription, although at this stage we cannot exclude the possibility of a posttranscriptional effect. IRF-3 is an obvious candidate for interaction with the L peptide, as this factor is known to specifically activate the transcription of IFN-β and IFN-α4 (13). IRF-3 is constitutively present in the cytoplasm of uninfected cells. Viral infection triggers a signaling cascade which leads to the C-terminal phosphorylation of IRF-3 (27), enabling it to homodimerize and to translocate to the nucleus, where it cooperates with CBP/p300 to activate the transcription of the IFN genes (17, 31, 36). Experiments are in progress to determine whether the L peptide interacts with IRF-3.
It is intriguing to note that total IFN mRNA synthesis was activated in KJ6-infected cells in spite of the represssion of IFN-β and IFN-α4. Indeed, in current murine models (20, 26), synthesis of the late IFN-α subtypes depends on the transcriptional induction of IRF-7 by immediate-early IFNs. Since immediate-early IFNs were repressed here, one might postulate that, in this case, transcription of some late IFNs subtypes could occur independently of IRF-7 activation.
L peptide is critical for viral persistence in vivo.
A virus with mutations in the zinc-binding motif of the L peptide is severely impaired in its ability to persist. The L peptide influences infection in the early stages of the infection, as our data show a fourfold reduction of viral RNA for the Lcys mutant virus already 5 days postinfection. These data are in good agreement with previous results from Calenoff et al. (1), who showed that the L peptide is also important for the neurovirulence of the GDVII strain. The fact that L is required early by TMEV in the CNS could be a clue that it is important for the virus to counteract the innate host immunity and, in particular, the IFN-α/β response.
It is clear, however, that IFN inhibition by L is not complete, as the disruption of STAT-1 in U3A cells and of IFN-α/β receptor in knockout mice (10) dramatically enhanced infection by the wild-type virus (expressing L). This might reflect an inability of the virus to completely counteract a potent IFN response of the host. On the other hand, modulation rather than blockade of the IFN response might represent a better strategy to allow viral persistence and favor host-to-host transmission of the virus.
Conservation of anti-IFN role of picornavirus L.
Although the picornavirus genome organization is rather well conserved, only cardioviruses and aphthoviruses express L. The L protein of aphthoviruses is a protease responsible for host cell protein synthesis shutoff through cleavage of eIF4G, a factor required for translation initiation (7). This protein, which is unrelated to the L protein of cardioviruses, was also found to have anti-IFN activity, possibly through the inhibition of protein synthesis (4).
The Cardiovirus genus includes TMEV and EMCV. As in the case of aphthoviruses, the L protein of Mengo virus (an EMCV strain) was proposed to participate in host cell protein synthesis shutoff and to affect IFN-α/β production by infected cells (37). The L protein of EMCV and TMEV share about 35% of identical amino acids. In spite of this rather low identity, the zinc-binding motif is perfectly conserved in all the strains sequenced so far, suggesting some conserved roles for these proteins. We found that IFN inhibition by the L protein of TMEV was specific for immediate-early IFN and thus unlikely to result merely from host cell translational shutoff. L proteins of cardioviruses might thus interfere with different signal transduction pathways to induce translational shutoff and immediate-early IFN inhibition.
ACKNOWLEDGMENTS
We are indebted to Daniel Gonzalez-Dunia and Sylvie Syan (Pasteur Institute, Paris, France) for help with the interferon biological assay. We thank Eliane Meurs (Pasteur Institute, Paris, France) for the gift of VSV and Ann Palmenberg (University of Wisconsin, Madison) for the gift of pMC24. We thank Michel Brahic (Pasteur Institute, Paris, France) for the F12B3 monoclonal antibody and for long-term collaboration. We are grateful to Ian Kerr (Imperial Cancer Research Fund, London, United Kingdom) and his team for rapid sending of 2fTGH and U3A cells and to Francis Brasseur (Ludwig Institute for Cancer Research, Brussels) for the gift of BALB/3T3 cells.
V.V.P. is a research assistant and T.M. is a senior research associate with the FNRS (Belgian Fund for Scientific Research). O.V.E. is a fellow of the Belgian FRIA (Fonds pour la Recherche dans l'Industrie et l'Agriculture). This work was supported by convention 3.4573.94F of the FRSM, by a crédit aux chercheurs 1.5.095.00 of the FNRS, by the Charcot Foundation, and by the Fonds de Développement Scientifique (FSR) of the University of Louvain.
REFERENCES
- 1.Calenoff M A, Badshah C S, Dal Canto M C, Lipton H L, Rundell M K. The leader polypeptide of Theiler's virus is essential for neurovirulence but not for virus growth in BHK cells. J Virol. 1995;69:5544–5549. doi: 10.1128/jvi.69.9.5544-5549.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Calenoff M A, Faaberg K S, Lipton H L. Genomic regions of neurovirulence and attenuation in Theiler murine encephalomyelitis virus. Proc Natl Acad Sci USA. 1990;87:978–982. doi: 10.1073/pnas.87.3.978. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Chen H-H, Kong W-P, Roos R P. The leader peptide of Theiler's murine encephalomyelitis virus is a zinc-binding protein. J Virol. 1995;69:8076–8078. doi: 10.1128/jvi.69.12.8076-8078.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Chinsangaram J, Piccone M E, Grubman M J. Ability of foot-and-mouth disease virus to form plaques in cell culture is associated with suppression of alpha/beta interferon. J Virol. 1999;73:9891–9898. doi: 10.1128/jvi.73.12.9891-9898.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem. 1987;162:156–159. doi: 10.1006/abio.1987.9999. [DOI] [PubMed] [Google Scholar]
- 6.Deonarain R, Alcami A, Alexiou M, Dallman M J, Gewert D K, Porter A C G. Impaired antiviral response and alpha/beta interferon induction in mice lacking beta interferon. J Virol. 2000;74:3404–3409. doi: 10.1128/jvi.74.7.3404-3409.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Devaney M A, Vakharia V N, Lloyd R E, Ehrenfeld E, Grubman M J. Leader protein of foot-and-mouth disease virus is required for cleavage of the p220 component of the cap-binding protein complex. J Virol. 1988;62:4407–4409. doi: 10.1128/jvi.62.11.4407-4409.1988. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Drescher K M, Pease L R, Rodriguez M. Antiviral immune responses modulate the nature of central nervous system (CNS) disease in a murine model of multiple sclerosis. Immunol Rev. 1997;159:177–193. doi: 10.1111/j.1600-065x.1997.tb01015.x. [DOI] [PubMed] [Google Scholar]
- 9.Duke G M, Palmenberg A G. Cloning and synthesis of infectious cardiovirus RNAs containing short, discrete poly(C) tracts. J Virol. 1989;63:1822–1826. doi: 10.1128/jvi.63.4.1822-1826.1989. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Fiette L, Aubert C, Muller U, Huang S, Aguet M, Brahic M, Bureau J-F. Theiler's virus infection of 129Sv mice that lack the interferon alpha/beta or interferon gamma receptors. J Exp Med. 1995;181:2069–2076. doi: 10.1084/jem.181.6.2069. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Fu J, Stein S, Rosenstein L, Bodwell T, Routbort M, Semler B L, Roos R P. Neurovirulence determinants of genetically engineered Theiler viruses. Proc Natl Acad Sci USA. 1990;87:4125–4129. doi: 10.1073/pnas.87.11.4125. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Jnaoui K, Michiels T. Adaptation of Theiler's virus to L929 cells: mutations in the putative receptor binding site on the capsid map to neutralization sites and modulate viral persistence. Virology. 1998;244:397–404. doi: 10.1006/viro.1998.9134. [DOI] [PubMed] [Google Scholar]
- 13.Juang Y T, Lowther W, Kellum M, Au W C, Lin R, Hiscott J, Pitha P M. Primary activation of interferon A and interferon B gene transcription by interferon regulatory factor 3. Proc Natl Acad Sci USA. 1998;95:9837–9842. doi: 10.1073/pnas.95.17.9837. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Kong W-P, Ghadge G D, Roos R P. Involvement of cardiovirus leader in host cell-restricted virus expression. Proc Natl Acad Sci USA. 1994;91:1796–1800. doi: 10.1073/pnas.91.5.1796. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Kong W-P, Roos R P. Alternative translation initiation site in the DA strain of Theiler's murine encephalomyelitis virus. J Virol. 1991;65:3395–3399. doi: 10.1128/jvi.65.6.3395-3399.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Kunkel T A. Rapid and efficient site-specific mutagenesis without phenotypic selection. Proc Natl Acad Sci USA. 1985;82:488–492. doi: 10.1073/pnas.82.2.488. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Lin R, Heylbroeck C, Pitha P M, Hiscott J. Virus-dependent phosphorylation of the IRF-3 transcription factor regulates nuclear translocation, transactivation potential, and proteasome-mediated degradation. Mol Cell Biol. 1998;18:2986–2996. doi: 10.1128/mcb.18.5.2986. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Lipton H L. Theiler's virus infection in mice: an unusual biphasic disease process leading to demyelination. Infect Immun. 1975;11:1147–1155. doi: 10.1128/iai.11.5.1147-1155.1975. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Mamane Y, Heylbroeck C, Génin P, Algarté M, Servant M J, LePage C, DeLuca C, Kwon H, Rongtuan L, Hiscott J. Interferon regulatory factors: the next generation. Gene. 1999;237:1–14. doi: 10.1016/s0378-1119(99)00262-0. [DOI] [PubMed] [Google Scholar]
- 20.Marié I, Durbin J E, Levy D E. Differential viral induction of distinct interferon-α genes by positive feedback through interferon regulatory factor 7. EMBO J. 1998;17:6660–6669. doi: 10.1093/emboj/17.22.6660. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.McAllister A, Tangy F, Aubert C, Brahic M. Molecular cloning of the complete genome of Theiler's virus, strain DA, and production of infectious transcripts. Microb Pathog. 1989;7:381–388. doi: 10.1016/0882-4010(89)90041-7. [DOI] [PubMed] [Google Scholar]
- 22.McAllister A, Tangy F, Aubert C, Brahic M. Genetic mapping of the ability of Theiler's virus to persist and demyelinate. J Virol. 1990;64:4252–4257. doi: 10.1128/jvi.64.9.4252-4257.1990. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.McKendry R, John J, Flavell D, Müller M, Kerr I M, Stark G R. High-frequency mutagenesis of human cells and characterization of a mutant unresponsive to both α and γ interferons. Proc Natl Acad Sci USA. 1991;88:11455–11459. doi: 10.1073/pnas.88.24.11455. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Michiels T, Dejong V, Rodrigus R, Shaw-Jackson C. Protein 2A is not required for Theiler's virus replication. J Virol. 1997;71:9549–9556. doi: 10.1128/jvi.71.12.9549-9556.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Monteyne P, Bureau J-F, Brahic M. The infection of mouse by Theiler's virus: from genetics to immunology. Immunol Rev. 1997;159:163–176. doi: 10.1111/j.1600-065x.1997.tb01014.x. [DOI] [PubMed] [Google Scholar]
- 26.Sato M, Suemori H, Hata N, Asagiri M, Ogasawara K, Naka O K, Nakaya T, Katsuki M, Noguchi S, Tanaka N, Taniguchi T. Distinct and essential roles of transcription factors IRF-3 and IRF-7 in response to viruses for IFN-α/β gene induction. Immunity. 2000;13:539–548. doi: 10.1016/s1074-7613(00)00053-4. [DOI] [PubMed] [Google Scholar]
- 27.Servant M J, ten Oever B, Le Page C, Conti L, Gessani S, Julkunen I, Lin R, Hiscott J. Identification of distinct signaling pathways leading to the phosphorylation of interferon regulatory factor 3. J Biol Chem. 2001;276:355–363. doi: 10.1074/jbc.M007790200. [DOI] [PubMed] [Google Scholar]
- 28.Shaw-Jackson C, Michiels T. Absence of internal ribosome entry site-mediated tissue specificity in the translation of a bicistronic transgene. J Virol. 1999;73:2729–2738. doi: 10.1128/jvi.73.4.2729-2738.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Stark G R, Kerr I M, Williams B R G, Silverman R H, Schreiber R D. How cells respond to interferons. Annu Rev Biochem. 1998;67:227–264. doi: 10.1146/annurev.biochem.67.1.227. [DOI] [PubMed] [Google Scholar]
- 30.Stewart W E, II, De Clercq E D, De Somer P. Stabilization of interferons by “defensive” reversible denaturation. Nature. 1974;249:460–461. doi: 10.1038/249460a0. [DOI] [PubMed] [Google Scholar]
- 31.Suhara W, Yoneyama M, Iwamura T, Yoshimura S, Tamura K, Namiki H, Aimoto S, Fujita T. Analyses of virus-induced homomeric and heteromeric protein associations between IRF-3 and coactivator CBP/P300. J Biochem (Tokyo) 2000;128:301–307. doi: 10.1093/oxfordjournals.jbchem.a022753. [DOI] [PubMed] [Google Scholar]
- 32.Theiler M, Gard S. Encephalomyelitis of mice. I. Characteristics and pathogenesis of the virus. J Exp Med. 1940;72:49–67. doi: 10.1084/jem.72.1.49. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Tortorella D, Gewurz B E, Furman M H, Schust D J, Ploegh H L. Viral subversion of the immune system. Annu Rev Immunol. 2000;18:861–926. doi: 10.1146/annurev.immunol.18.1.861. [DOI] [PubMed] [Google Scholar]
- 34.van Eyll O, Michiels T. Influence of the Theiler's virus L* protein on macrophage infection, viral persistence and neurovirulence. J Virol. 2000;74:9071–9077. doi: 10.1128/jvi.74.19.9071-9077.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Wathelet M G, Lin C H, Parekh B S, Ronco L V, Howley P M, Maniatis T. Virus infection induces the assembly of coordinately activated transcription factors on the IFN-beta enhancer in vitro. Mol Cell. 1998;3:507–518. doi: 10.1016/s1097-2765(00)80051-9. [DOI] [PubMed] [Google Scholar]
- 36.Yoneyama M, Suhara W, Fukuhara Y, Fukuda M, Nishida E, Fujita T. Direct triggering of the type I interferon system by virus infection: activation of a transcription factor complex containing IRF-3 and CBP/P300. EMBO J. 1998;17:1087–1095. doi: 10.1093/emboj/17.4.1087. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Zoll J, Galama J M D, van Kuppeveld F J M, Melchers W J G. Mengovirus leader is involved in the inhibition of host cell protein synthesis. J Virol. 1996;70:4948–4952. doi: 10.1128/jvi.70.8.4948-4952.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]








