Regional diversity of the ALS gene and hormesis due to tribenuron-methyl in Centaurea cyanus L.

Abstract

Centaurea cyanus L. is a common field weed in Eastern Europe but only in Poland biotypes of this species with resistance to acetolactate synthase (ALS) inhibitors have been confirmed. This phenomenon is constantly developing and spreading to consecutive regions of Poland. This study aimed to assess the response of selected Polish C. cyanus populations to tribenuron-methyl and to analyse the genetic variability of the ALS gene of C. cyanus populations resistant to ALS inhibitors. Between 2017 and 2021, 13 seed samples were collected from eastern Poland and a dose-response study with tribenuron-methyl was performed. Eleven populations resistant to tribenuron-methyl were identified. All populations from this study as well as 6 additional resistant populations characterised in the previous dose-response studies were subjected to molecular analysis of the ALS gene. Target-site resistance due to mutations P197S, P197Q, P197T and P197A were identified in 8 populations from Warmia-Masuria and Podlaskie provinces. This is the first case of target-site resistance (TSR) in C. cyanus confirmed by sequencing of the ALS gene. Moreover in some resistant plants, ten changes in the amino acid ALS sequence were identified in comparison to those in the susceptible ones. In none of the populations were all mutations detected in the same individual. The highest frequency of mutations was detected in Warmia-Masuria province. Some C. cyanus populations resistant to ALS inhibitors showed hormesis effect concerning shoot fresh weight after tribenuron-methyl treatment. Stimulation due to half the recommended dose of tribenuron-methyl was the highest and the difference between untreated and treated plants was statistically significant in two populations from Warmia-Masuria and in one from Podlaskie province.

Supplementary Information

The online version contains supplementary material available at 10.1038/s41598-024-76345-6.

Introduction

Cornflower (Centaurea cyanus L.) is an annual broadleaf weed from the Asteraceae family. This species comes from the central-eastern Mediterranean and up to the half of the XX century it was widespread in temperate zones around the world^1–3. Currently, in many countries, mainly of Western Europe, populations of C. cyanus are decreasing due to intensive use of herbicides^1,2 however there are European countries where this weed species is common in winter cereals and winter rapeseed^4–9. When C. cyanus occurs in high density it is highly competitive against crops and generates high yield losses. The economic threshold for cornflower in cereals is equal to 1–5 plants m^{− 2 10–12}.

Tribenuron-methyl is a selective, post-emergence sulfonylurea herbicide. It affects sensitive weeds through inhibition of the enzyme acetolactate synthase (ALS) and leads to the rapid cessation of cell division and subsequent growth processes in plants. It is rapidly absorbed by plants’ leaves. Symptoms of chlorosis appear in affected weeds in days, with necrosis and death occurring after 10–25 days under optimal conditions. The half-life of tribenuron-methyl is short (1–7 days) and it degrades in the soil by hydrolysis or microbial degradation^13,14.

Currently, 22 active ingredients belonging to Herbicide Resistance Action Committee (HRAC) groups 0, 2, 4, 5, 6, 12, 13, 15 are recommended for control of C. cyanus, which can be used alone or in multi-component herbicides. In this group of active ingredients, acetolactate synthase inhibitors belonging to HRAC 2 account for 23%. In addition, active substances from the HRAC 2 group occur in herbicides that are effective in cornflower control only as two-component products, for example: iodosulfuron-methyl (HRAC 2) + thiencarbazone-methyl (HRAC 2) or amidosulfuron (HRAC 2), bentazone (HRAC 6) + imazamox (HRAC 2), tembotrione (HRAC 27) + thiencarbazone-methyl (HRAC 2)¹⁵. However, there are active substances from this group e.g. florasulam, imazamox and metsulfuron, that show low effectiveness in some populations of C. cyanus control, due to innate tolerance governed by non-target-site-tolerance mechanisms¹⁶. Resistance of other weed species to this mechanism of action is one of the main problems worldwide¹⁷. In Poland the first case of C. cyanus resistant to chlorsulfuron was recorded in 2006 by Marczewska and Rola¹⁸. Another information about the population of this species resistant to ALS inhibitors concerned resistance to tribenuron-methyl and chlorsulfuron¹⁹. The International Database on Herbicide-Resistant Weeds contains information on the population of dicamba-resistant C. cyanus originating from Poland²⁰. In the years 2017–2020, the occurrence of another 83 populations resistant to ALS inhibitors was confirmed in Poland, including three with multiple resistance to ALS inhibitors and synthetic auxins¹¹.

Every year, the number of herbicide-resistant weed biotypes increases. Currently, resistance has been reported in 272 weed species found in 72 countries. A total of 530 cases of weeds (species x HRAC group) resistant to herbicides were confirmed. Resistance to ALS inhibitors has been noted in as many as 178 species in 53 countries²⁰. Target-site resistance (TSR) is a very common mechanism of resistance to ALS inhibitors, and it refers to resistance caused by the changes in the herbicide target protein, including mutation, duplication, and overexpression. Non-target-site resistance (NTSR) has also been identified in weed species, and it includes all resistance mechanisms besides the TSR, primarily anything that reduces the amount of herbicide reaching the target protein, such as alterations in absorption, translocation, or metabolism²¹. Mutations in at least 42 ALS codons have a confirmed or possible role in sensitivity to ALS inhibitors. Nine of them has been observed in weed populations originated from the field (codons 122, 197, 205, 206, 376, 377, 548, 574, 653 and 654), 13 have been identified in laboratory mutants (121, 124, 196, 199, 203, 256, 351, 352, 375, 570, 571 and 578) and the rest have been pointed out during molecular docking or crystallography studies of the ALS (119, 120, 123, 194, 195, 198, 200, 201, 202, 207, 208, 378, 568, 569, 575 and 655 to 660)^20,22–28. In C. cyanus none of the above-mentioned mutations have been reported yet.

The origins of the emergence and development of resistance to herbicides are widely described in the literature^29–32. The overuse of herbicides has contributed to the worldwide evolution of herbicide resistance in weeds and imposes strong selection for any trait enabling plant populations to survive and reproduce under recurrent herbicide pressure³⁰. The development of weed resistance to herbicides depends on the interaction of three factors: the herbicide and target site properties (chemical structure, herbicide-target site interactions and residual activity), herbicide dose, the biological and genetic characteristics of the weeds (e.g. life cycle, seed production capability, mating system), and agronomic management practices^29,32. Recently, more attention has been paid to the stimulating effect of small doses of herbicides, i.e. herbicide hormesis, as one of the factors that may contribute to the development of resistance. Herbicide hormesis has a stimulating effect on the growth and/or reproductive development of plants^33,34. Plants can have enhanced growth, produce more shoots and biomass, have bigger photosynthetic effectivity or higher amino acid and protein production than plants not subjected to stressors^35–40. Hormesis can occur in both herbicide-resistant and herbicide-sensitive plants^34,37,41,42, but if the population is resistant to a particular herbicide, a higher dose of that herbicide can be required to induce hormesis³³. The phenomenon of herbicide hormesis is of particular importance in relation to resistant populations in which the field dose of the herbicide is a low dose and may stimulate plant growth or increase their fertility^43,44. Regular use of herbicides that cause hormesis in populations resistant to these active substances may influence the selection of those populations that, due to more favourable morphological parameters, will be more competitive with respect to the crop and sensitive populations. Additionally, increased fertility of these populations will increase their numbers in subsequent years^34,41,42,45. Hormesis is also a measure of a plant’s ability for adaptation to stress conditions, making weeds more resistant to herbicides used to their control^44,46,47.

The objectives of the present research were to (i) assess the reaction of selected Polish C. cyanus populations to tribenuron-methyl; (ii) to check the presence of TSR mechanism of resistance to ALS inhibitors and analyze the genetic variability of the ALS of C. cyanus populations resistant to ALS inhibitors with a special interest of resistance causing mutations; (iii) check the incidence of growth stimulation of C. cyanus due to tribenuron-methyl.

Methods

Plant material

Plant material of potentially resistant populations of C. cyanus was sampled in the eastern part of Poland from fields where insufficient efficacy of ALS inhibitors were signalized by farmers (Table 1). Three populations originated from wastelands. Seeds were collected in the years 2017–2021 according to the protocol described earlier¹¹. GPS locations and crop types (if applicable) were recorded at each sample site. The locations of studied populations were plotted on the map using Quantum GIS (QGIS) ver. 3.36 software (https://www.qgis.org). Mature achenes were pooled from individuals within the crop to form a representative sample of the population. Samples were air dried and stored at ambient temperature until screening. Before sowing seeds were placed in 4 °C for 7 days.

Table 1.

The information on the origin of C. cyanus populations used in the study.

Population	Province	Coordinates	Crop	Year of collection
8401	WM	54°19’19.5"N 21°09’31.2"E	winter wheat	2017
8748	WM	54°13’53.9"N 21°11’40.0"E	spring barley	2017
8801	WM	54°25’29.7"N 19°52’43.5"E	winter wheat	2017
8806	WM	54°22’03.3"N 19°57’58.7"E	winter wheat	2017
9376	WM	54°03’45.0"N 20°53’26.0"E	winter wheat	2018
9382	WM	54°09’14.0"N 20°50’22.0"E	winter wheat	2018
9386	WM	54°12’10.0"N 21°25’32.0"E	spring barley	2018
9294	Pd	52°56’01.0"N 22°52’21.5"E	winter triticale	2018
9303	Pd	52°43’21.9"N 23°25’18.1"E	winter triticale	2018
9307	Pd	52°43’12.4"N 23°26’02.4"E	winter wheat	2018
9398	Pd	52°46’50.0"N 23°31’17.0"E	winter wheat	2018
9402	Pd	52°42’14.0"N 23°25’54.0"E	winter wheat	2018
8524	Lb	51°36’02.2"N 22°05’12.2"E	narrow-leaved lupin	2017
10373	Lb	51°24’22.0"N 22°09’38.2"E	winter wheat	2019
10650	Lb	51°23’14.3"N 22°17’59.6"E	narrow-leaved lupin	2021
10652	Lb	50°17’38.7"N 23°07’23.7"E	winter wheat	2021
8815	Św	50°47’20.0"N 20°19’09.8"E	wasteland	2017
S1	GP	52°34’55.3"N 17°52’38.3"E	wasteland	2018
S2	Pd	52°30’04.0"N 22°36’02.0"E	wasteland	2017

GP–Greater Poland; Lb–Lublin; Pd–Podlaskie; Św–Świętokrzyskie; WM–Warmia-Masuria.

Table 1 presents characteristics of the collecting site of 19 C. cyanus populations which were subjected to the analysis of the ALS gene, analysis of hormetic effect, and estimation of reproduction rate in the present study.

Investigation of resistance level to tribenuron-methyl in C. cyanus populations

Tests were carried out in 2018–2022 in the glasshouse. Plant cultivation and herbicide treatment methodology and equipment were as described by Stankiewicz-Kosyl et al.¹¹. The experiments had a completely randomized design and three replications per herbicide dose. One replicate consisted of three plants in one pot treated with a given herbicide dose. For calculations, the mean biomass of three plants from one pot was taken as one replicate. For all tests Lumer 50 WG (Adama, Poland) was used as a source of tribenuron-methyl.

The preliminary test was conducted on all 13 collected populations in the aim to establish resistance/susceptibility status to tribenuron-methyl. When the seedling reached the 2-leaf stage, the field dose of tribenuron-methyl (15 g a.i. ha^-1) was applied. Control plants were treated with water only. Three weeks after tribenuron-methyl treatment plants were assessed and according to the visual estimated biomass (VEB) reduction scale⁴⁸ populations were qualified as susceptible (VEB = 51–100%) or resistant (VEB ≤ 50%).

Dose–response experiments were conducted to quantify the resistance levels of the studied populations. Seedlings from populations that were classified as resistant in preliminary tests were treated at the 2-leaf stage with tribenuron-methyl at doses: 1/2 N, 1 N, 2 N, 4 N, 8 N, 16 N and 32 N, where N is the recommended dose in Poland (15 g a.i. ha^-1). Seedlings from populations that were classified as susceptible in preliminary tests were subjected to doses: 1/8 N, 1/4 N, 1/2 N, 1 N, 2 N, 4 N. Control plants were treated with water only (0 N). Each time when resistant populations were tested, one of susceptible populations was included. After three weeks, fresh aboveground biomass was weighted.

Investigation of hormesis due to tribenuron-methyl in C. cyanus populations

The aim of the experiment was to check whether tribenuron-methyl doses from 1/2 N to 2 N can stimulate the accumulation of biomass of C. cyanus plants resistant to ALS inhibitors. The analysis included plant biomass of all resistant populations (17 populations) from the dose-response tests. Plant biomass obtained after treatment with 1/2 N, 1 N, and 2 N doses of tribenuron-methyl and the biomass of untreated control was used for the analysis. The analysis included only doses that may occur in field conditions. The dose 2 N is required in herbicide selectivity tests during the registration procedure. In addition, 2 N dose may occur in the field in spots on the field headlands. Shoot fresh weight of treated and untreated tribenuron-methyl plants of C. cyanus populations resistant to ALS inhibitors was expressed as a percentage of the untreated plants (control – 0 N). The biomass results were statistically analyzed.

Analysis of genetic variability of the ALS

The 57 individuals from 19 cornflower populations were analysed in the aim to check the presence of TSR mechanism of resistance to ALS inhibitors and to assess the variability of the ALS gene. Seventeen resistant and two susceptible populations to this group of herbicides were taken for the study. Leaf tissue was sampled from plants not treated with tribenuron-methyl (susceptible populations) and from plants which survived dose 4 N of tribenuron-methyl (resistant populations). DNA was extracted from three plants from each population using the CTAB (cetyltrimethylammonium bromide) method⁴⁹. DNA extracts were diluted to a final concentration of 100 ng µL^− 1 and stored at − 20 °C until use.

For the amplification of the ALS gene fragments primers were designed on the basis of Asteraceae species sequences from GenBank. The software accessed online, Primer3web ver. 4.1.0 (Whitehead Institute for Biomedical Research, Cambridge, MA, USA) (https://primer3.ut.ee) was used. Three regions of the ALS gene were amplified. These regions encompassed codons where mutations conferring resistance were observed in weeds and laboratory mutants or pointed out on the basis of molecular docking or crystallography data^20,22–28.

Primers CentaureaAF 5’ accgacgtcttcgcctac 3’ and CentaureaAR 5’ gacgaggtaattgtgtttcgtt 3’ ensured coverage of codons 113–225, as standardised after Arabidopsis thaliana (L.) Heynh. ALS sequence. The PCR program consisted of 5 min at 94 °C, followed by 35 cycles of 30 s at 94 °C, 30 s at 50 °C and 40 s at 70 °C and 10 min of final elongation at 70 °C. Amplifications were done in 25 µL with 100 ng of genomic DNA template, 0.5 µM of each primer, 0.2 mM of each dNTP, 2 mM of MgCl₂, 1× Taq Buffer and 0.05 u µL^− 1 of recombinant Taq DNA Polymerase (Thermo Fisher Scientific, Waltham, MA, USA).

Primers Centaurea376F 5’ cgccgaaggctacgcacg 3’ and Centaurea376R 5’ gacacgtgaggctgcttgttctt 3’ were designed to amplify the region between codons 150 and 414 of the ALS gene. The PCR program consisted of 5 min at 95 °C, followed by 35 cycles of 10 s at 95 °C, 30 s at 56.2 °C, 30 s at 72 °C, and 5 min of final elongation at 72 °C. Amplifications were done in 25 µL with 100 ng of genomic DNA template, 0.2 µM of each primer, 1 M of betaine, 1 × VWR HiFi DNA Polymerase Master Mix, (VWR Life Science, Haasrode, Belgium).

Primers CentaureaBF 5’ gacgcggtcgtggtcgata 3’ and CentaureaBR 5’ tcaatatttcattctgccatcg 3’ ensured coverage of codons 529–671. The PCR program and quantities of reaction mix components were the same as for the amplification of codons 113–225.

PCR reactions were performed using SimplyAmp™ Thermal Cycler (Thermo Fisher Scientific, Waltham, USA). Afterwards, the PCR products were separated on 1.5% agarose gels with the aim of checking the quantity and quality of the amplification. Genomed S.A. (Warsaw, Poland) performed purification and sequencing of PCR products. Sequence data were analysed using FinchTV (Geospiza, Washigton, DC, USA) and ClustalW (GenomeNet, Kyoto, Japan). The sequence of the wild type of C. cyanus ALS consensus was generated through alignment of amplicons originated from six individuals (two susceptible populations) from this study as well as 13 sequences of ALS from C. cyanus susceptible to ALS inhibitors from GenBank (MZ561651-MZ561662, OL332826). All sequences amplified from resistant individuals of the present study were compared with the wild type C. cyanus ALS consensus.

Statistical analysis

The ED₁₀ and ED₅₀ doses for each population were calculated with the ‘drc’ package⁵⁰ in R ver. 4.0.1⁵¹ using a three-parameter log-logistic model with the lower limit equal to 0:

in which x is herbicide dosage, b denotes the slope of the curve around the ED₅₀, d is the upper asymptote, and e - effective dose to reduce plant biomass by 50% (ED₅₀). The reproductive potential of C. cyanus populations resistant to ALS inhibitors was expressed by the surrogate reproductive endpoint, EDrepro10 value (i.e., the dose resulting in a 10% reduction in the reproductive potential of the herbicide-treated plant) which was calculated on the basis of ED₁₀ value. The extrapolation factor (EF) determined by the EFSA’s Panel on Plant Protection Products and their Residues (PPR) was taken for calculation of EDrepro10⁵².

Shoot fresh weight data of tribenuron-methyl treated plants (doses 1/2 N, 1 N and 2 N) and untreated control (0 N) were checked for normality (Shapiro-Wilk test) and then analysed with one-way ANOVA. A post hoc Tukey test was used for mean comparison at P ≤ 0.05 (SPSS.1 IBM SPSS Statistics 26, Armonk, NY, USA). The percentage data were transformed by arcsine transformation.

Results

Investigation of resistance level to tribenuron-methyl in C. cyanus populations

Dose–response experiments

Populations qualified as potentially resistant or susceptible were subjected to the dose-response experiments. The dose-response curves were presented in Supplementary Information (Fig. S1 (resistant populations), Fig. S2 (susceptible populations) online). The ED₅₀ values calculated on the basis of dose-response study are presented in Table 2. ED₅₀ values of the remaining six resistant populations were calculated in the previous study described by Stankiewicz-Kosyl et al.¹¹ and are presented in Table 2 with appropriate annotation (an asterisk). The ED₅₀ value of susceptible populations S1 and S2 was 6.6 and 7.1 g a.i. ha^-1, respectively, which corresponds to less than a half of the registered dose of tribenuron-methyl in Poland (15 g a.i. ha^-1). Eleven populations resistant to tribenuron-methyl were identified. All populations from Warmia-Masuria province were highly resistant with ED₅₀ value equal to or higher than 199.37 g a.i. ha^-1 (over 13-fold registered tribenuron-methyl dose). In Podlaskie province two resistant populations were detected, 9398 with high and 9294 with medium resistance level. All three populations from Lublin and the only one population from Świętokrzyskie provinces were characterised by low level of resistance to tribenuron-methyl, their ED₅₀ ranging from 16.34 to 28.21 g a.i. ha^-1 (1.1–1.88-fold registered tribenuron-methyl dose). For populations from these two provinces this parameter was increased 2.39–4.12-fold in comparison to mean ED₅₀ value for S1 and S2 populations.

Table 2.

ED₅₀ values of C. cyanus populations tested in the present study.

Population	Province	Tribenuron-methyl ED50 (g a.i. ha− 1)
8401	WM	259.7*
8748	WM	> 480*
8801	WM	> 480
8806	WM	296.25
9376	WM	237.57
9382	WM	220.73
9386	WM	199.37
9294	Pd	48.6
9303	Pd	229.5*
9307	Pd	151.0*
9398	Pd	73.82
9402	Pd	281.6*
8524	Lb	119.7*
10373	Lb	19.44
10650	Lb	16.34
10652	Lb	17.42
8815	Św	28.21
S1	GP	6.6
S2	Pd	7.1

The tribenuron-methyl dose needed to reduce the fresh weight (ED₅₀) by 50% was determined during the whole-plant dose-response bioassays. GP–Greater Poland; Lb–Lublin; Pd–Podlaskie; Św–Świętokrzyskie; WM–Warmia-Masuria. * ED₅₀ values of six resistant populations were calculated in the previous study described by Stankiewicz-Kosyl et al.¹¹.

Assessment of the reproductive potential of C. cyanus populations resistant to ALS inhibitors

The reproductive potential of C. cyanus populations resistant to ALS inhibitors expressed by EDrepro10 value was calculated on the basis of ED₁₀ value (Table 3). An extrapolation factor of 3 was used for calculations as recommended by the EFSA’s Panel on Plant Protection Products and their Residues (EFSA PPR Panel)⁵².

Table 3.

ED₁₀ values and the reproductive potential of C. cyanus populations resistant to ALS inhibitors treated with tribenuron-methyl.

Population	Tribenuron-methyl ED10 (g a.i. ha− 1)	EDrepro10
8401	19.25	6.42
8748	291.98	97.33
8801	105.81	35.27
8806	77.25	25.75
9376	6.15	2.05
9382	7.30	2.43
9386	5.06	1.69
9294	21.02	7.01
9303	77.00	25.67
9307	52.35	17.45
9398	7.15	2.38
9402	5.38	1.79
8524	1.64	0.55
10373	0.46	0.15
10650	3.43	1.14
10652	7.42	2.47
8815	2.50	0.83

The tribenuron-methyl dose needed to reduce the fresh weight (ED₁₀) by 10% was determined during the whole-plant dose-response bioassays. EDrepro10 (i.e., the dose resulting in a 10% reduction in the reproductive potential of the herbicide-treated plant), was calculated on the basis of the ED₁₀ value.

The EDrepro10 value of the majority of studied populations resistant to tribenuron-methyl is lower than 15 g a.i. ha^-1 which suggests the field dose of this active ingredient will decrease their reproductive potential by at least 10%. However 8748, 8801, 8806, 9303 and 9307 populations will not be affected.

Hormesis

Some C. cyanus populations resistant to ALS inhibitors showed hormetic effect concerning shoot fresh weight after tribenuron-methyl treatment (Fig. 1). Stimulation due to 1/2 N dose of tribenuron-methyl was the highest and difference between untreated and treated plants was statistically significant in two populations from Warmia-Masuria (8801, 8806) and in one from Podlaskie province (9307). The above-ground biomass of plants from populations 8801, 8806 and 9307 treated with 1/2 N dose of tribenuron-methyl was by 57%, 28% and 25% higher than those of the untreated control, respectively. Higher shoot fresh weight was also observed after treatment with 1/2 N dose of tribenuron-methyl in populations 8401 and 9303 however difference between treated and untreated plant was not significant. The biomass of 8801, 8806, 9294 and 9303 after 1 N of tribenuron-methyl application was higher by 6–15% than the untreated control and the biomass of 8801, 8806 and 9303 after 2 N of tribenuron-methyl was higher by 4–33% than the untreated control however these differences were not statistically significant. Hormetic effect was not detected in resistant populations from Lublin and Świętokrzyskie provinces.

Fig. 1.

Shoot fresh weight of treated and untreated tribenuron-methyl plants of C. cyanus populations resistant to ALS inhibitors, expressed as a percentage of the untreated plants (control – 0 N). Data are means ± SE. Means marked by the same letter do not differ significantly at P ≤ 0.05 by Tukey’s test. Abbreviations: Lb–Lublin; Pd–Podlaskie; Św–Świętokrzyskie; WM–Warmia-Masuria.

Analysis of genetic variability of the ALS

With the use of starters CentaureaA, Centaurea376 and CentaureaB products of 339 bp, 835 bp and 429 bp size, respectively, were amplified. Products showed 90.69–99.93% similarity to C. cyanus ALS sequences from GenBank. Alignment of sequences amplified from resistant populations with the wild consensus allowed to identify non-synonymous mutations in 10 codons which are or can be responsible for ALS inhibitors resistance (Table 4).

Table 4.

Genetic variability in the acetolactate synthase of C. cyanus populations.

Only positions where nonsynonymous mutations were found are represented. All sequences were compared with the wild type C. cyanus ALS consensus. IUPAC code was used for the amino acids nomenclature. Dots indicate amino acids identical to those of the wild type ALS. Amino acid substitutions in the 197 codon are marked in red (Q), yellow (S), blue (T) and purple (A), substitutions in other codons are marked in rose.

In 15 individuals from eight resistant populations substitutions were found in the codon P197 (P197S, P197Q, P197T, P197A) (Fig. 2) and it was the most commonly mutated codon in this study (Table 4). Substitutions in the codon 197 were found in populations from Warmia-Masuria and Podlaskie provinces (Fig. 3). They were present in 42.86% of individuals from Warmia-Masuria and 40% from Podlaskie. This is the first case of TSR in C. cyanus confirmed by sequencing of the ALS gene. Other substitutions were detected in codons 230, 236, 254, 260, 317, 353, 364, 584 and 629.

Fig. 2.

Substitutions in the codon 197 of the ALS gene in C. cyanus populations resistant to ALS inhibitors. Proline (CCA) is replaced by (a) serine (TCA), (b) glutamine (CAA), (c) threonine (ACA) or (d) alanine (GCA). The red rectangle indicates the codon 197 and the arrow indicates the substituted nucleotide.

Fig. 3.

Geographical distribution of C. cyanus populations investigated. Colours of dots indicate susceptibility/resistance to tribenuron-methyl and the molecular status of the 197 codon: green—susceptible population, yellow—P197S, red—P197Q, blue—P197T, purple—P197A, grey—resistant population without mutation in P197. GP–Greater Poland; Lb–Lublin; Pd–Podlaskie; Św–Świętokrzyskie; WM–Warmia-Masuria.

L317V, P197S and S364R were the most frequent replacements in populations resistant to ALS inhibitors and their frequency varied between 23.53% and 9.8% (Table 5). L317V was detected in seven populations from three out of four provinces. Nine individuals out of 12 had the mutation in the 317 codon but not in the 197 one (Table 4). The substitution R584A was unique for Lublin province and was present in all three individuals from the population 10,652.

Table 5.

Distribution of C. cyanus individuals with specific resistant mutation in eastern part of Poland.

Specific resistant mutation	Proportion of individuals with specific resistant mutation (%)*	Proportion of C. cyanus individuals with specific resistant mutation in different provinces (%)**
		WM	Pd	Lb	Św
P197Q	5.88	14.29	0	0	0
P197S	13.73	9.52	33.33	0	0
P197T	7.84	19.05	0	0	0
P197A	1.96	0	6.67	0	0
H/D230N	3.92	9.52	0	0	0
R/H236 L	1.96	4.76	0	0	0
R/H236 S	1.96	0	6.67	0	0
V/I254 L	1.96	4.76	0	0	0
Q260H	5.88	14.29	0	0	0
L317V	23.53	29.81	6.67	50.00	0
G353R	1.96	0	6.67	0	0
S364R	9.80	14.29	6.67	0	0
R584A	5.88	0	0	25.00	0
L629S	1.96	4.76	0	0	0

Lb–Lublin, Pd–Podlaskie, Św–Świętokrzyskie, WM–Warmia-Masuria, P–proline, Q–glutamine, S–serine, T– threonine, A–alanine, H–histidine, D–aspartic acid, N–asparagine, L–leucine, V–valine, I–isoleucine, G–glycine, R–arginine.

*Proportion (%) = numbers of C. cyanus individuals with specific resistant mutation / total numbers of C. cyanus tested resistant individuals in this study.

**Proportion (%) = numbers of C. cyanus individuals with specific resistant mutation in a province / total tested C. cyanus individuals from a province.

P197S was the second most common mutation in the study and the most common in the 197 codon (Table 5). It was more frequent in Podlaskie than in Warmia-Masuria province but it was absent in Lublin and Świętokrzyskie provinces. P197T and P197Q were about twice less frequent than P197S and were present only in populations from Warmia-Masuria. The substitution P197A with its frequency of 1.96% was the rarest. It was noted only in one individual from Podlaskie province. There were three populations: 8401 from Warmia-Masuria province, 9294 from Podlaskie and 8815 from Świętokrzyskie provinces where the ALS gene fragments analysed in the study were identical to the wild consensus (Table 4).

The highest frequency of mutations was detected in Warmia-Masuria province (Table 5). There were seven substitutions which were unique for this province: P197Q, P197T, H/D230N, R/H236L, V/I254L, Q260H, L629S (Table 5). In the Lublin province frequency of mutations in the ALS gene was low, substitutions were identified in two codons only. L317V was present in 50% of individuals and R584A in 25% of individuals from this province, respectively (Table 5).

Discussion

Resistance of C. cyanus to ALS inhibitors is an increasing problem in Poland^11,18,19. Moreover control of this species is becoming problematic in surrounding countries^2,53–55. In the present study eleven C. cyanus populations resistant to tribenuron-methyl were identified. The majority of populations with high resistance originated from Warmia-Masuria province. All populations from this region were highly resistant to this active ingredient. Similar results were described by Stankiewicz-Kosyl et al.¹¹. Most of the populations resistant to ALS inhibitors were found in this province and over 82% of them showed high level of resistance to tribenuron-methyl. The problem with ALS inhibitors resistance in this province is so intense probably because the frequency of herbicide application was higher than in other regions of Poland¹¹. Most resistant populations assessed in the present study originated from winter cereals. It confirms the results of the previous study¹¹ that winter crops favour the selection of resistant populations of C. cyanus. Warmia-Masuria is a province where the first case of C. cyanus resistance to ALS inhibitors was noted in 2010¹⁹, and there was sufficient time to escalate the problem. Moreover the average area of a farm in Warmia-Masuria province was over 2 times greater than the national average in Poland⁵⁶.

Our study was the first to confirm target-site resistance in C. cyanus by sequencing of the ALS gene. Target-site resistance to tribenuron-methyl due to substitutions in the codon P197 of the ALS gene were found in eight C. cyanus resistant populations. In these populations proline was replaced by serine, threonine, glutamine or alanine. In other weed species substitutions P197S, P197T, P197Q, P197A have been identified already²⁰. Replacement of proline by serine, threonine or alanine in the 197 codon of the ALS gene is quite common in weed biotypes resistant to ALS inhibitors in Poland and in other countries²⁰. Mutation P197Q has not been identified in Polish biotypes of Apera spica venti, Alopecurus myosuroides or Papaver rhoeas yet^57–59, however it has been noted already in ALS resistant populations outside Poland²⁰. In the codon 197 of populations of C. cyanus resistant to ALS inhibitors only one type of substitution has been diagnosed per population or per individual therefore this codon in C. cyanus is more homogenic than in other species like P. rhoeas or Lolium sp^59–61.

The results of this study suggest multiple evolutionary origins of ALS resistance in C. cyanus. Substitutions P197Q and P197T were identified in Warmia-Masuria while P197A in Podlaskie province only. Similar conclusions were formulated for Senecio vulgaris populations resistant to ALS inhibitors⁶², Bromus tectorum populations resistant to ACCase inhibitors⁶³ as well as in Lolium multiflorum populations resistant to glyphosate⁶⁴. Due to small geographical distance between populations 8801 and 8806 from Warmia-Masuria sharing the same replacement P197Q as well as between 9303 and 9307 from Podlaskie sharing the substitution P197S it is possible that these pairs of populations can have the same origin.

Mechanism of resistance of C. cyanus to ALS inhibitors is diversified. There were nine out of 17 resistant populations where mutations known from the literature as responsible for ALS resistance were not identified in plants which survived tribenuron-methyl treatment. Therefore in these populations resistance to ALS inhibitors can be due to NTSR or another TSR mechanism. Mutations outside the 197 codon of the ALS gene located in the codons 230, 236, 254, 260, 317, 353, 364, 584 and 629 were identified in individuals from resistant populations and were absent in susceptible populations. Mutations L317V, S364R, Q260H and R584A seem to be especially interesting due to the frequency of their appearance in the studied populations (23.53%, 9.8%, 5.88%, 5.88%, respectively). They can confer at least partially to ALS resistance. However, these preliminary studies require further investigation to confirm the significance of these mutations in herbicide resistance development. Similar hypothesis was formulated for C. cyanus by Wrzesińska and Praczyk⁶⁵ who found mutations in the codons L179I, N404R, I468V, and V525I located in the functional regions of ALS present in some resistant but not in susceptible individuals. In corn poppy populations resistant to ALS inhibitors Koreki et al.⁶¹ found mutations in the codon 119, 120, 194, 202 and 351 that are predicted to play a role in herbicide sensitivity. In the present study there were also three populations (8748, 8801, 9307) where only two individuals and three populations (8806, 9376, 9402) where one individual had mutation in the codon 197. In these populations different mechanisms of resistance can coexist. Such situation has been already diagnosed for other weed species like P. rhoeas^30,59,66, Sinapis alba⁶⁷ and Lolium sp⁶⁰.

The highest stimulation of the above ground biomass accumulation was observed after treatment of resistant populations of C. cyanus with half the field dose (1/2 N) of tribenuron-methyl. This hormetic effect was noted in five resistant populations however the hormetic effect was not always significant. In two populations from Warmia-Masuria (8801, 8806) and one population from Podlaskie (9307) the biomass of treated plants was significantly higher than the biomass of untreated plants. In these three populations high level resistance to tribenuron-methyl was noted (ED₅₀ > 10-fold the field dose of tribenuron-methyl) and according to EDrepro10 value, their reproduction potential will not be affected by the field dose of this active ingredient. Therefore, the use of full recommended doses and avoiding drift of the spray solution to adjacent fields is very important in an anti-resistance strategy, as numerous weed species have evolved herbicide resistance following recurrent applications of low herbicide rates^68–70. Moreover, the application of low doses of herbicides may stimulate the growth of resistant individuals⁴².

Conclusions

Populations of C. cyanus with different levels of resistance to tribenuron-methyl were diagnosed in all analysed provinces. Target-site resistance was identified in most populations with high resistance. In some individuals from resistant populations of C. cyanus mutations responsible for resistance were not present therefore presumably in these populations mechanism of resistance is mixed (TSR and NTSR) however this hypothesis needs further confirmation. In some highly resistant populations hormesis was noted after treatment with 1/2–2-fold the field dose of tribenuron-methyl; however it was significant after application of 1/2 the field dose only. Therefore it is important to avoid the drift of spray solution and to use the full field dose because repeated application of herbicides using low doses contributes to the development of herbicide-resistant weeds and can stimulate the growth of C. cyanus individuals with already recognized resistance.

Data collection

The authors confirm that the experimental research and field studies on plants, including the collection of plant material, follows relevant institutional, national, and international guidelines and legislation.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Author contributions

Conceptualization – MSK, MWK, KM; Data curation – MSK, MWK, MW; Funding acquisition – KM; Investigation – MSK, MWK, MW, MH; Methodology – MSK, MWK, KM; Visualization – MSK, MW, MH; Writing of original draft – MSK, MH; Review and editing – MSK, MWK, MW, MH, KM.

Funding

This research was funded by The National Centre for Research and Development, contract number: BIOSTRATEG 3/347445/1/NCBR/2017. The publication was (co)financed by Science development fund of the Warsaw University of Life Sciences – SGGW.

Data availability

The datasets generated during and/or analysed during the current study are available from the corresponding author on request.

Competing interests

The authors declare no competing interests.