| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Biological samples | ||
| Aeolian wall lizard (Podarcis raffonei) | Field collection | see Table S1 for more details |
| Italian wall lizard (Podarcis siculus) | Field collection | see Table S1 for more details |
| Chemicals, peptides, and recombinant proteins | ||
| SbfI restriction enzyme | New England Biolabs Inc. | NEB #R3642 |
| MspI restriction enzyme | New England Biolabs Inc. | NEB #R0106 |
| Illumina adapters | Illumina | N/A |
| T4 DNA ligase | New England Biolabs Inc. | NEB #M0202 |
| Taq-Phusion High-Fidelity | New England Biolabs Inc. | NEB #M0530 |
| Critical commercial assays | ||
| QIAgen DNeasy Blood & Tissue Kit | Qiagen | Cat #69506 |
| AMPure XP beads | Beckman Coulter | Cat #A63882 |
| QIAquick Gel Extraction Kit | Qiagen | Cat #28706X4 |
| QIAgen MinElute PCR Purification Kit | Qiagen | Cat # 28006 |
| Illumina HiSeq 2500 | Illumina | N/A |
| Deposited data | ||
| ddRADseq data from 133 lizards: Podarcis raffonei (NCBI Taxonomy ID: 65483), Podarcis siculus (NCBI Taxonomy ID: 65484) and the four identified hybrids (NCBI Taxonomy ID: 3239811) | This study | ENA BioProject Number: PRJEB77477 |
| Oligonucleotides | ||
| 12S mtDNA gene, primer forward: 12Sa | Kocher et al.91 | CTGGGATTAGATACCCCACTAT |
| 12S mtDNA gene, primer reverse: 12Sb | Kocher et al.91 | GAGGGTGACGGGGCGGTGTGT |
| Software and algorithms | ||
| fastp v0.23.2 | Chen et al.92 | https://github.com/OpenGene/fastp |
| Stacks v2.60 | Rochette et al.93 | https://catchenlab.life.illinois.edu/stacks/ |
| bwa mem v0.7.17 | Li94 | https://github.com/lh3/bwa |
| vcftools v0.1.17 | Danecek et al.95 | https://vcftools.github.io/index.html |
| R v4.0.2 | R Core Team21 | https://www.r-project.org/ |
| ggplot2 v3.4.3 | Wickham et al.96 | https://ggplot2.tidyverse.org/ |
| tidyverse v2 | Wickham et al.97 | https://www.tidyverse.org/ |
| Plink v1.9 | Purcell et al.98 | https://www.cog-genomics.org/plink/ |
| Hierfstat v0.5.11 | Goudet99 | https://github.com/jgx65/hierfstat |
| fineRADstructure v0.3.2 | Malinsky et al.100 | https://github.com/millanek/fineRADstructure |
| introgress v1.2.3 | Gompert and Alex Buerkle101 | https://github.com/zgompert/introgress |
| Admixture v1.3 | Alexander et al.102 | https://dalexander.github.io/admixture/ |
| NewHybrids v2.0 | Anderson and Thompson103 | https://github.com/eriqande/newhybrids |
| parallelenewhybrid v1.0.1 | Wringe et al.104 | https://github.com/bwringe/parallelnewhybrid |
| hybriddetective | Wringe et al.105 | https://github.com/bwringe/hybriddetective |
| Genotype Plot v0.2.1 | Whiting106 | https://github.com/JimWhiting91/genotype_plot |
| NeEstimator v2.1 | Do et al.107 | https://www.molecularfisherieslaboratory.com.au/neestimator-software/ |
| rayshader v0.38.1 | Morgan-Wall22 | https://www.rayshader.com/ |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.