TABLE 1.
PCR primers used in this worka
| Primer | Sequenceb | Source/positionc | GenBank accession no. |
|---|---|---|---|
| Hindu | AGGAAGCTTATATGTCAGATTTGC | nifHa, (−)11-13 | M10587 |
| Bamhu | GGATCCGACCCGAAAGCC | nifHa, 115-132 | M10587 |
| Apalu | GTGCACATGACGATGTCGACT | nifHa, 344-364 | M10587 |
| NarI | GCGCCCGTTACAGATCAG | nifHa, 564-547 | M10587 |
| MluI | TCCGACGCGTACTGGATCA | nifHa, 701-683 | M10587 |
| BclI | CTTGATCATGCCGAAGTCGAG | nifHa, 831-811 | M10587 |
| XbaI | TCCTCTAGACAGCGGCAGTTAT | nifHa, 912-891 | M10587 |
| 1 | CTGAAACCCAACAAAAG | nifHa, (−)135-(−)119 | M10587 |
| 2 | GCAAGGCGATTAAGTTG | pIC20R, 385-369 | L08913 |
| 3 | AGTCGGCAAATAATGTC | ΩTc, 2543-2559 | U35135 |
| 4 | AAAACGCTGTCATTCTC | nifHa, 1033-1017 | U80928 |
a
All the oligonucleotides are shown in the 5′ to 3′ direction.
b
Nucleotides that were modified to generate the corresponding restriction site (underlined) are shown in boldface.
c
Positions correspond to the start codon of the indicated sequence (nifHa) or to the initial nucleotide in the reported sequence (pIC20R and ΩTc).