TABLE 1.
Primers used in this study
| Primer | Use | Sequence (5′ to 3′) | Positiona | Reference |
|---|---|---|---|---|
| 4017-1 | Recombinant PCR and Southern blot analysis | ACGAAGGGGTCGAGGGAGAC | −514 to −497 of omcF | This study |
| 4017-2 | Recombinant PCR | GACGATTGCCCCCCCTCG | −18 to −1 of omcF | This study |
| 4017-3 | Recombinant PCR | CGAGGGGGGGCAATCGTCAGTGCCACCTGGGATGAATGb | −18 to −1 of omcF, −274 to −255 of Kanr in pBBR1MCS-2 | This study |
| 4017-4 | Recombinant PCR | CTCATGGGAAGCTCGCCACGATGGCAGGTTGGGCGTCGCc | −1 to 18 from omcF stop codon, −51 to −33 from Kanr stop codon in pBBR1MCS-2 | This study |
| 4017-5 | Recombinant PCR | CGTGGCGAGCTTCCCATGAG | −1 to 18 from omcF stop codon | This study |
| 4017-6 | Recombinant PCR and Southern blot analysis | CCTTTTCAGCGGGGAGCGAC | −567 to −548 from omcF stop codon | This study |
| ComF2 | Expression of the omcF gene in trans | CGAGAAAGACGAGAAGAAGG | −63 to −44 of omcF | This study |
| ComR3 | Expression of the omcF gene in trans | AAGCTTCGGAACGAGGGCTCTCATGGGAd | −14 to 8 from omcF stop codon | This study |
| 8916 | RT-PCR and Northern blot analysis of omcB | GGACTGCGCACCATCAAGG | 580 to 598 of omcB | 26 |
| 8908-2 | RT-PCR and Northern blot analysis of omcB | GGTCAGCAGGCCACCGG | 998 to 1004 of omcB | 27 |
| 8914 | RT-PCR and Northern blot analysis of omcC | CCTGCCATGAGACCGTTGCC | 285 to 302 of omcC | 26 |
| 8915 | RT-PCR and Northern blot analysis of omcC | GGGTGTTGTGGTAGAAGGG | 879 to 897 of omC | 9 |
| RT4017F | RT-PCR and Northern blot analysis of omcF | ATGAGAGGGCTTGCCCCGGTG | 1 to 21 of omcF | This study |
| RT4017R | RT-PCR and Northern blot analysis of omcF | TGGGAAGCTCGCCACGACG | 294 to 312 of omcF | This study |
| RT4018F | RT-PCR analysis of orfA | GCATGGCCACCACCAACTTC | 1037 to 1056 of orfA | This study |
| RT4018R | RT-PCR analysis of orfA | CTCCTCGATCCGGTTACTCC | 1631 to 1650 of orfA | This study |
| RT4016F | RT-PCR analysis of orfC | CCATCGGCGAGAAGCAGGAC | 421 to 420 of orfC | This study |
| RT4016R | RT-PCR analysis of orfC | TCGGCAATGAAAAGGATGAG | 901 to 920 of orfC | This study |
a
Unless indicated otherwise, the A of the ATG start codon is considered position 1.
b
The omcF bases are underlined, and pBBR1MCS-2 bases are indicated by boldface type.
c
The underlining indicates positions −1 to 18 from the omcF stop codon, and the boldface type indicates positions −51 to −33 from the Kanr stop codon in pBBR1MCS-2.
d
HindIII site is underlined.