REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
anti-OCT4, rabbit IgG	GeneTex	Cat# GTX101497; RRID: AB_10618784
anti-SSEA4, mouse IgG	GeneTex	Cat# GTX48037; RRID: AB_10727924
anti-SOX2, mouse IgG	Cell signaling	Cat# 4900; RRID: AB_10560516
anti-Nanog, rabbit IgG	Cell signaling	Cat# 4903; RRID: AB_10559205
anti-TRA-1-60, mouse IgG	Cell signaling	Cat# 4746; RRID: AB_2119059
anti-Nestin, mouse IgG	GeneTex	Cat# GTX630201; RRID: AB_2888203
anti-NODAL, mouse IgG	Abcam	Cat# ab55676; RRID: AB_2151660
anti-FOXH1, sheep IgG	Novus Biologicals	Cat# AF4248; RRID: AB_2105752
anti-phospho-SMAD2/3, rabbit IgG	Cell signaling	Cat# 8828; RRID: AB_2631089
Fluoroshield Mounting Medium With DAPI	Abcam	Cat# ab104139
Alexa 488–conjugated goat anti-rabbit IgG	Invitrogen	Cat# A-11034; RRID: AB_2576217
Alexa 488–conjugated goat anti-mouse IgG	Invitrogen	Cat# A-11029; RRID: AB_2534088
Alexa 594–conjugated goat anti-rabbit IgG	Invitrogen	Cat# A-11037; RRID: AB_2534095
Alexa 594-conjugated goat anti-mouse IgG	Invitrogen	Cat# A-11032; RRID: AB_2534091
Alexa 488–conjugated goat anti-sheep IgG	Invitrogen	Cat# A-11015; RRID: AB_2534082
Chemicals, peptides, and recombinant proteins
Goat serum-blocking solution	Cell signaling	Cat# 5425
SignalStain® Antibody Diluent	Cell signaling	Cat# 8112
Power SYBR Green PCR Master Mix	Thermo Fisher	Cat# 4367659
mTeSR Plus	Stemcell. Tech.	Cat# 100-0276
Accutase	Stemcell. Tech.	Cat# 07920
Y-27632	Selleck	Cat# S1049
olanzapine	Sigma	Cat# PHR1825
SB431542	APExBIO	Cat# A8249
Critical commercial assays
TRIZol reagent kit	Invitrogen	Cat# 15596026
NEBNext® UltraTM RNA Library Prep Kit for Illumina®	NEB	Cat# E7770
TruSeq PE Cluster Kit v3-cBot-HS	Illumina	Cat# #PE-401-3001
RNeasy Mini Kit	Qiagen	Cat# 74004
iScript Select cDNA Synthesis Kit	Bio-rad	Cat# 1708896
STEMdiff™ Cerebral Organoid Kit	Stemcell. Tech.	Cat# 08570
STEMdiff™ Cerebral Organoid Maturation Kit	Stemcell. Tech.	Cat# 08571
Deposited data
Bulk RNA-seq	This paper	CNGBdb: CNP0003542
Targeted metabolomics	This paper	CNGBdb: METM0000155
Anorexia nervosa GWAS Summary data	Watson et al.50	N/A
Anxiety disorders GWAS Summary data	Otowa et al.51	N/A
Bipolar disorder GWAS Summary data	Mullins et al.52	N/A
Intelligence GWAS Summary data	Savage et al.53	N/A
Major depressive disorder GWAS Summary data	Howard et al.54	N/A
Obsessive-compulsive disorder GWAS Summary data	Posthuma, D.55	N/A
Panic disorder GWAS Summary data	Forstner et al.56	N/A
Post-traumatic stress disorder GWAS Summary data	Duncan et al.57	N/A
Schizophrenia GWAS Summary data	Trubetskoy et al.58	N/A
Brain cis-eQTL data	Qi et al.59	N/A
Experimental models: Cell lines
hiPSC-F1 reprogrammed from female skin tissue	Beijing Cellapy Biotechnology Co., LTD	CA4028106
hiPSC-B1 reprogrammed from female blood	Beijing Cellapy Biotechnology Co., LTD	CA4025106
hiPSC-U2 reprogrammed from female urine	Beijing Cellapy Biotechnology Co., LTD	CA4027106
Oligonucleotides
NODAL F1 (from 5' to 3': CAGTACAACGCCTATCGCTGT)	This paper	N/A
NODAL R1 (from 5' to 3': TGCATGGTTGGTCGGATGAAA)	This paper	N/A
β-actin F1 (from 5' to 3': TCCCTGGAGAAGAGCTACGA)	This paper	N/A
β-actin R1 (from 5' to 3': TGAAGGTAGTTTCGTGGATGC)	This paper	N/A
Software and algorithms
Hisat2 v2.0.5	https://daehwankimlab.github.io/hisat2/	N/A
FeatrureCounts v1.5.0-p3	https://subread.sourceforge.net/featureCounts.html	N/A
edgeR version 3.37.0	Bioconductor	N/A
STRING database version 11.5	https://string-db.org/	N/A
Metascape	https://metascape.org/	N/A
MAGMA v1.10	https://ctg.cncr.nl/software/magma	N/A
MetaboAnalyst	https://www.metaboanalyst.ca/	N/A
SMR v1.3.1	https://yanglab.westlake.edu.cn/software/smr	N/A
Axis Navigator version 1.5	Axion BioSystems, Inc.	N/A
SPSS version 26.0	IBM	N/A
GraphPad Prism version 9.0	https://www.graphpad.com/	N/A
R version 4.3.2	https://www.r-project.org/	N/A
Other
CytoView MEA 24	Axion BioSystems, Inc.	M384-tMEA-24W
96-well round-bottom ultra-low-attachment microplate	Corning	Cat# 7007
24-well flat-bottom ultra-low-attachment plate	Corning	Cat# 3473
6-well flat-bottom ultra-low attachment plates	Corning	Cat# 3471