Abstract
Subarachnoid hemorrhage (SAH), a stroke subtype associated with high mortality, is closely linked to neuroinflammation. Phloretin, a naturally occurring flavonoid abundant in fruits, possesses anti-inflammatory properties. However, its specific role in SAH remains unclear. Therefore, we aimed to investigate the potential role of phloretin in SAH. We established in vitro and in vivo SAH models to assess the effects of phloretin. Subsequently, utilizing SAH-related public datasets from the GEO database, we identified key genes associated with SAH and investigated the potential mechanism of action of phloretin. Our findings reveal that phloretin significantly improves prognostic outcomes and mitigates inflammation in SAH mice. Moreover, our results suggest that phloretin mitigates neuroinflammation by inhibiting the TLR2/MYD88/NF-κB pathway.
Supplementary Information
The online version contains supplementary material available at 10.1038/s41598-024-77671-5.
Keywords: Subarachnoid hemorrhage (SAH), Phloretin, Neuroinflammation, TLR2/MYD88/NF-Κb
Subject terms: Computational biology and bioinformatics, Drug discovery, Neurology
Introduction
Subarachnoid hemorrhage (SAH), though accounting for only 5% of all strokes, remains a significant cerebrovascular event1. Despite being less common than ischemic stroke and intracerebral hemorrhage, SAH disproportionately affects younger individuals and is associated with higher morbidity and mortality rates2,3. The impact of SAH on life expectancy is comparable to that of more prevalent stroke types. Clinically, SAH presents with acute symptoms such as headache, vomiting, confusion, numbness, and seizures, contributing to its substantial neurological burden. Approximately 30% of SAH patients confront either poor prognosis or mortality, with survivors often grappling with long-term disability or cognitive impairment. SAH may result from traumatic brain injury or spontaneous aneurysm rupture. Research suggests that the inflammatory response, characterized by microglial activation, inflammatory cell infiltration, and cytokine release, contributes significantly to SAH-induced brain injury4,5. Neuroinflammation commences early in SAH and correlates closely with neuronal apoptosis6,7. Nevertheless, current investigations into anti-inflammatory drugs for SAH patients remain constrained. Given the persistent unfavorable neurological outcomes among SAH patients, further exploration of underlying mechanisms is essential.
Phloretin, predominantly derived from apples, serves as a natural dihydrochalcone recognized as generally safe by the Flavor and Extract Manufacturers of America (FEMA)8–10. Renowned for its diverse biological activities, including anticancer, anti-inflammatory, and antioxidant properties, phloretin also displays inhibitory effects on inflammatory mediators like leukocyte-induced cytokines, chemokines, and differentiation factors pivotal to the innate immune response11,12. A study by Li et al. highlighted phloretin’s potential to diminish microglia-mediated synaptic phagocytosis and inhibit NF-κB (Nuclear factor kappa-light-chain-enhancer of activated B cells), thereby showcasing neuroprotective qualities13. Nonetheless, the precise role of phloretin in SAH remains ambiguous. This investigation endeavors to clarify phloretin’s potential in both in vivo and in vitro SAH models, aiming to uncover its impacts and underlying mechanisms concerning SAH-related inflammation. The research idea of this study is shown in Fig. 1.
Fig. 1.
Flowchart of this study.
In this study, we systematically investigated the potential role and mechanism of phloretin in subarachnoid hemorrhage using public datasets, in vitro and in vivo models.
Method
In-vitro SAH model (cellular SAH model)
An in vitro model simulating SAH was established utilizing the HT22 mouse hippocampal neuronal cell line acquired from Zhongqiao Xinzhou Biotechnology Co., Ltd., Shanghai, China. SAH induction involves the lysis of erythrocytes, leading to the release of hemoglobin, which subsequently degrades into hemin. The cytotoxic effects of hemin ensue upon its uptake by cells, triggering various adverse reactions. Previous studies have shown that neurons can be activated within 12 h with 75 µM (micromolar) hemin (Cat#H9039, Sigma) to simulate the effects of SAH14.
RNA interference assay
Transfection procedures were conducted using Lipofectamine™ 2000 reagent, adhering to the manufacturer’s guidelines. The siRNA sequence is shown in Table 1.
Table 1.
Sequences of siRNA against TLR2.
| Name of siRNA | sequences(5′-3′) |
|---|---|
| siRNA-1 | aactatccactggtgaaacaa |
| siRNA-2 | aaacttgtcagtggccagaaa |
| siRNA-3 | aaagtcttgattgattggcca |
Quantitative real-time PCR
Total RNA was isolated and converted to cDNA according to the manufacturer’s protocol. Detailed information regarding the primers employed can be found in Table 2. Data normalization was executed utilizing the GAPDH value through the 2 − ΔΔCt method for all analyses.
Table 2.
Primers sequence.
| Gene name | Primersequence |
|---|---|
| Cleaved caspase 3 | F: TGGAGGCTGACTTCCTGTATGC |
| R: GAACCACGACCCGTCCTTTGA | |
| Bcl-2 | F: GCTACGAGTGGGATGCTGGAGA |
| R: GGTTGCTCTCAGGCTGGAAGGA | |
| Bax | F: CCAGGATGCGTCCACCAAGAAG |
| R: CCGTGTCCACGTCAGCAATCAT | |
| Cleaved caspase 1 | F: GGACTGACTGGGACCCTCAAGT |
| R: GGCAAGACGTGTACGAGTGGTT | |
| GSDMD-N | F: ACTGAGGTCCACAGCCAAGAGG |
| R: CCACTCGGAATGCCAGGATGCT | |
| IL-1β | Forward: TCGCAGCAGCACATCAACAAGA |
| R: CCACGGGAAAGACACAGGTAGC | |
| GAPDH | F: AAGGTCGGTGTGAACGGATT |
| R: TGAGTGGAGTCATACTGGAACAT | |
| TNFα | F: GGTGCCTATGTCTCAGCCTCT |
| R: CATCGGCTGGCACCACTAGTT | |
| TLR2 | F: TCTGGGCAGTCTTGAACATTT |
| R: AGAGTCAGGTGATGGATGTCG | |
| MyD88 | F: ATCCGAGAGCTGGAAACG |
| R: GCAAGGGTTGGTTAATC | |
| IκBα | F: ACTCGTTCCTGCACTTGGCC |
| R: TGCTCACAGGCAAGGTGTAG | |
| NF-κB-p65 | F: AGCACCATCAACTATGATGAGTTTC |
| R: GAGTTATAGCCTCAGGGTACTCCAT |
Western blot analysis
For specific methods, please refer to previously published articles15. The primary antibodies utilized were anti-TNF-α (1:5000, E10041, Thermo Scientific), anti-IL-1β (1:1000, PAB45925, Bioswamp), anti-IL-6 (1:1000, 21865-1-AP, Proteintech), anti-TLR2 (1:1000, 17236-1-AP, Proteintech), and anti-GAPDH (:50,000, MA5-35235, Thermo Scientific). Secondary antibodies included HRP-labeled goat anti-rabbit (1:10,000; 31460, Thermo Scientific) and HRP-labeled goat anti-mouse (1:20,000; B0048, boerfu) antibodies. The Western Protein Marker is purchased from genestar (ZM227-101, China).
Public dataset
Two SAH-associated microarray datasets (GSE13353 and GSE54083) were obtained from the GEO database (https://www.ncbi.nlm.nih.gov/geo/). Genes demonstrating notable variances between the normal and SAH groups were identified utilizing the “DESeq2” R software package. A significance threshold was established at a p-value < 0.05, along with an absolute log2 (fold change) > 1.
WGCNA analysis
The WGCNA (Weighted Gene Co-expression Network Analysis) method is employed to analyze gene expression across multiple samples, often used in studies investigating correlations between traits and gene associations16,17. In this research, the WGCNA R package was utilized to establish a gene co-expression network and identify key disease-related genes. Modules with high similarity were merged using a cutoff threshold of < 0.25.
In vivo SAH model (animals SAH model)
Anesthesia was initiated with 4% isoflurane and maintained at 2%. SAH was induced using the modified endovascular perforation method, as previously described18. All experimental procedures were approved by the Shanxi Provincial People’s Hospital Animal Care and Use Committee (Approval No. 2024125). Following the 3R principles (reduce, refine, replace), we minimized the number of animals used while maintaining statistical robustness. Healthy adult male C57BL/6J mice (22–25 g, GemPharmatech Co., Ltd., Nanjing, China) were housed at 20–25 °C under a 12-hour light/dark cycle, with ad libitum access to food and water. All methods were performed in accordance with relevant guidelines and regulations, including the ARRIVE guidelines for reporting animal research, with anesthesia and euthanasia procedures adhering to the American Veterinary Medical Association (AVMA) Guidelines for the Euthanasia of Animals (2020) to ensure ethical treatment19.
Animal experimental design
A total of 100 mice were utilized in this study, distributed across three independent experiments (Table 3). Experiment 1 focused on evaluating changes in SAH grade over time (24, 48, and 72 h) subsequent to SAH induction in mice, aiming to assess their impact. Experiment 2 aimed to investigate the potential effect of phloretin (Cat# P7912, Sigma) on SAH in mice, administered orally at a dose of 50 mg/kg/day for three consecutive days, drawing on insights from prior research. Experiment 3 sought to validate whether phloretin mitigates neuroinflammation by modulating the NF-κB pathway. To achieve this, we administered the NF-κB inhibitor PDTC (HY-18738, MCE, USA) intraperitoneally, with injections administered one hour before inducing SAH.
Table 3.
Animal experimental design.
| Groups | Mortality | Excluded |
|---|---|---|
| Experiment 1 | ||
| Sham | 0% (0/10) | 0 |
| SAH24h | 20% (2/10) | 1 |
| SAH48h | 10% (1/10) | 2 |
| SAH72h | 10% (1/10) | 1 |
| Tatol | ||
| Sham | 0% (0/10) | 0 |
| SAH | 13.33% (4/30) | 4 |
| Experiment 2 | ||
| Sham | 0% (0/10) | 0 |
| SAH + Vehicle | 20% (2/10) | 2 |
| SAH + Phloretin | 30% (3/10) | 1 |
| Tatol | ||
| Sham | 0% (0/10) | 0 |
| SAH | 25% (5/20) | 3 |
| Experiment 3 | ||
| SAH + Vehicle | 10% (1/10) | 2 |
| SAH + Phloretin | 10% (1/10) | 2 |
| SAH + PDTC | 30% (3/10) | 1 |
| Tatol | ||
| SAH | 16.67% (5/30) | 5 |
Neurologic score, mortality, SAH grade and brain water content
Neurological function in mice was evaluated using the modified Garcia scale and beam balance tests, following the protocol outlined by Xie et al.20. Mortality was assessed 48 h after in vivo SAH model establishment. SAH grade was determined using a previously established grading system21. The grading of SAH ranges from 0 to 18, with mice with grading scores below 7 being excluded.
Mice were euthanized 72 h after SAH induction, and the entire brain was removed. Euthanize mice by an overdose of carbon dioxide anesthesia as recommended by the institutional ethics committee. Brain specimens from each experimental group were dehydrated at 105 °C for 24 h to obtain dry weight. The formula for calculating the percentage of brain water content is: (wet weight - dry weight)/wet weight × 100%.
Statistical analysis
Public dataset analysis were conducted using R language (version 4.3.1). Visualization of analysis results was achieved through the utilization of the “ggplot2,” “glmnet,” “VennDiagram,” and “WGCNA” packages in R22,23. Experimental data analysis was performed using GraphPad Prism 8.0.1 statistical software. A t-test was used for comparisons between two groups, while ANOVA with post hoc tests was applied for comparisons involving three or more groups to account for multiple comparisons. Statistical significance was set at p-value < 0.05.
Result
Subarachnoid hemorrhage induces impaired neurologic function and promotes apoptosis and inflammation in mice
Figure 2A depicts a schematic diagram of SAH. Experiment 1 involved 40 mice (10 in the Sham group and 30 in the SAH group), with an overall SAH model mortality rate of 13.33%. Importantly, no significant differences in SAH grade were observed across all groups (Fig. 2B). Furthermore, we assessed the Garcia score of mice 72 h post SAH induction, revealing a significant decrease, indicative of pronounced neurological impairment (Fig. 2C). Cerebral edema following SAH has been linked to unfavorable prognoses24,25. Our investigation revealed a significant increase in water content in both left and right hemispheres of mice at the 72-hour mark post SAH induction (Fig. 2D). The onset of SAH often coincides with cell pyroptosis and inflammation26,27. As illustrated in Fig. 2E, expression levels of TNF-α, IL-1β, GSDMD-N, Bax, cleaved caspase 1, and cleaved caspase 3 markedly increased in the brains of SAH-afflicted mice, while Bcl-2 levels decreased, signifying SAH’s propensity to enhance both cell apoptosis and inflammation (Fig. 2E).
Fig. 2.
Subarachnoid hemorrhage induces impaired neurologic function and promotes apoptosis and inflammation in mice. (A) Schematic diagram of subarachnoid hemorrhage. (B) SAH grade assessment revealed no significant inter-group differences. (C) The Garcia score of mice exhibited a significant decrease 72 hours post SAH treatment. (D) There was a significant increase in brain water content in mice 72 hours following SAH induction. (E) The expression levels of key genes (TNF-α, IL-1β, GSDMD-N, Bax, cleaved caspase 1, cleaved caspase 3, and Bcl-2) in the brains of mice in the SAH group exhibited significant alterations compared to the Sham group (set as 1). * p< 0.05; ** p < 0.01; ** p < 0.001, compared to Sham group.
Phloretin can significantly improve the prognostic characteristics of SAH mice
Phloretin, primarily isolated from apples, is a natural dihydrochalcone known for its role in inflammation treatment (Fig. 3A). However, research on its application in SAH remains inadequate. Consequently, we aim to explore the potential therapeutic value of phloretin in SAH further. HT22 cells were employed as an in vitro model to simulate SAH. Following exposure to varying concentrations of hemin (ranging from 100 to 400 µM) for 24 h, cell viability was assessed using the CCK-8 assay. The findings revealed a concentration-dependent induction of cell death by hemin. Notably, hemin markedly diminished cell viability across all groups, with 200 µM (cell viability-46.67%) deemed the most suitable concentration for subsequent in vitro investigations (Fig. 3B). This concentration was consistently maintained in subsequent in vitro model studies. It is noteworthy that phloretin demonstrates the capability to inhibit hemin-induced cytotoxicity (Fig. 3C). Moreover, our investigation into the potential effects of phloretin on SAH mice in an in vivo model revealed that phloretin did not exert a significant effect on SAH grade in these mice (Fig. 3D). However, administration of phloretin notably enhanced the Garcia score (Fig. 3E) and significantly reduced brain water content (Fig. 3F) in mice 72 h following SAH induction. These findings suggest potential benefits of phloretin against SAH. We conducted additional investigations to determine whether phloretin exerts an inhibitory effect on SAH-induced apoptosis and inflammation (Fig. 3G). The findings indicated that phloretin treatment significantly suppressed the expression of TNF-α, IL-1β, GSDMD-N, Bax, and cleaved caspase 1. Conversely, Bcl-2 levels were increased. These results suggest that phloretin holds promise in alleviating inflammation associated with SAH.
Fig. 3.
Phloretin can significantly improve the prognostic characteristics of SAH mice. (A) Schematic diagram of phloretin. (B) Impact of varying concentrations of hemin on HT22 cell viability. (C) Phloretin mitigates hemin toxicity to HT22 cells. (D) Phloretin treatment showed no significant impact on SAH grade in SAH mice. (E) Phloretin significantly enhances the Garcia score of SAH mice. (F) Phloretin markedly decreases brain water content in SAH mice. (G) Expression levels of key genes (TNF-α, IL-1β, GSDMD-N, Bax, cleaved caspase 1, and Bcl-2) in the phloretin-treated group exhibited significant changes compared to the control group (set as 1). *, p < 0.05; **, p < 0.01; and ***, p < 0.001.
Identification of key genes in SAH
We analyzed SAH-related human expression profiles (GSE13353 and GSE65801) retrieved from the GEO public datasets to identify key genes in SAH group. Figure 4A illustrates genes exhibiting significant differences between patients in the normal and SAH groups. Employing the WGCNA method (Fig. 4B), we determined a soft threshold (β = 5) conducive to constructing a scale-free network (no scale R2 = 0.88). This analysis yielded four potential key gene modules (Fig. 4C), with the turquoise module demonstrating the strongest correlation with SAH (Fig. 4D). Intersection of genes within the turquoise module and those previously identified as significantly different revealed 24 shared genes (Fig. 4E; Table 4). These genes underwent additional screening using the lasso regression method, which indicated that genes TLR2, UPP1, and NCF2 are potential key contributors to SAH (Fig. 4F). Notably, these genes exhibited significantly elevated expression levels in the SAH group (Fig. 4G and I).
Fig. 4.
Identification of key genes in SAH. (A) The identification of genes significantly differentially expressed in the SAH group was based on public data from GSE13353 and GSE65801. (B) SAH-related gene modules were identified through WGCNA analysis, involving the screening of appropriate soft thresholds and validation of scale-free network properties. A soft threshold of 5 was chosen based on the distribution curve and network connectivity (k), indicating the establishment of a satisfactory scale-free network. (C) The correlation between various gene modules and control and treatment groups (SAH) was examined. (D) The Turquoise module exhibits the highest correlation with SAH. (E) The intersection of genes within the Turquoise module with previously identified significantly different genes revealed 24 shared genes. (F) The 24 genes underwent further screening using the lasso regression method to identify key genes. TLR2 (G), UPP1 (H) and NCF2 (I) exhibit high expression levels in the SAH group. *, p < 0.05; **, p < 0.01; and ***, p < 0.001.
Table 4.
24 key intersection genes.
| Genes |
|---|
| NCF2 |
| UPP1 |
| TLR2 |
| FPR1 |
| TNFAIP3 |
| CD163 |
| MAFB |
| RGS7BP |
| CSTA |
| FGR |
| ID4 |
| CCDC109B |
| CXCR4 |
| RRAD |
| FERMT3 |
| PRKG1 |
| MS4A7 |
| TTLL7 |
| ANTXR1 |
| PNMAL1 |
| PPP1R12B |
| SLA |
| KCNS3 |
| EFHD1 |
Phloretin mitigates SAH-induced inflammation by inhibiting TLR2
The expression levels of these three genes in the SAH model underwent further examination, and the effects of phloretin on them were compared. The results indicated a significant increase in TLR2 expression in both in vitro (Fig. 5A) and in vivo (Fig. 5B) SAH models, which was subsequently inhibited by phloretin. However, phloretin had no significant effect on UPP1 and NCF2 (Supplementary Fig. 1A, 1B). Thus, phloretin likely modulates SAH-related inflammation via TLR2 regulation. Notably, in a prior study, Kim et al. demonstrated that phloretin reduced Pam3CSK4-induced inflammation in human HEK293-hTLR2 cells28. However, the precise mechanisms underlying this effect in the context of SAH remain to be elucidated. Molecular docking was conducted to assess the binding affinity of phloretin and TLR2, revealing a robust binding capacity between the two (Autodock Vina score: -7.3). Phloretin, a small molecule, forms hydrogen bonds with residues LEUA:399, ASNA:397, LYSA:422, SERA:424, and HISA:398 of the TLR2 protein (2Z7X). Additionally, it engages in Pi-Pi stacking interactions with HISA:398, enhancing structural stability. Furthermore, phloretin establishes Pi-Sulfur bonds and van der Waals forces, contributing to its binding with TLR2 (Fig. 5C). Three distinct siRNAs targeting TLR2 were constructed, demonstrating efficacy in inhibiting TLR2 expression (Fig. 5D). Among these, siRNA-1 exhibited superior TLR2 inhibition. Subsequently, we investigated the effects of phloretin treatment or TLR2 knockdown on inflammation-related factors (IL-6, IL-1β, and TNFα) within an in vitro model of induced SAH. Our findings indicate that both phloretin treatment or TLR2 knockdown markedly suppress the expression of inflammation-related factors in the in vitro SAH model (Fig. 5E). This suggests that phloretin may mitigate SAH-induced inflammation via TLR2 modulation.
Fig. 5.
Phloretin mitigates SAH-induced inflammation by inhibiting TLR2. (A) In the in vitro model, phloretin significantly inhibits the expression level of TLR2 following SAH treatment. (B) In the in vivo model, phloretin significantly inhibits the expression level of TLR2 following SAH treatment. (C) Molecular docking 3D model diagram and force analysis of phloretin and TLR2. (D) The knockdown efficiency of three different siRNAs targeting TLR2 was evaluated. (E) Treatment with phloretin or knockdown of TLR2 significantly inhibited the expression of inflammation-related factors in the in vitro SAH model. *, p < 0.05; **, p < 0.01; and ***, p < 0.001.
Phloretin reduces neuroinflammation by inhibiting TLR2/MYD88/NF-κB pathway
In the nervous system, Toll-like receptors (TLRs) are pivotal in regulating neuronal numbers and brain size, with the TLR2/MYD88/NF-κB pathway implicated in modulating neuroinflammation29. To unravel the potential mechanism of phloretin, we evaluated the expression levels of key factors within the NF-κB signaling pathway following phloretin treatment in an in vitro SAH model (Fig. 6A). Our results demonstrated significant inhibition of MYD88 and NF-κB-p65 expression after phloretin treatment, mirroring the effect observed when TLR2 was inhibited by siRNA-1. These outcomes underscore a noteworthy inhibition of the TLR2/MYD88/NF-κB pathway by phloretin. To validate these findings, we introduced the NF-κB inhibitor PDTC (Pyrrolidinedithiocarbamate) (Fig. 6B) and established an in vivo model (Fig. 6C). Consistently, both phloretin and PDTC effectively suppressed MYD88 and NF-κB-p65 expression, affirming their ability to inhibit the TLR2/MYD88/NF-κB pathway (Fig. 6D). Furthermore, the suppression of the TLR2/MYD88/NF-κB pathway was associated with a significant decrease in inflammation-related factors (Fig. 6E). Thus, our findings suggest that phloretin may alleviate SAH-induced inflammation by modulating the TLR2/MYD88/NF-κB pathway (Fig. 6F).
Fig. 6.
Phloretin reduces neuroinflammation by inhibiting TLR2/MYD88/NF-κB pathway. (A) The effects of phloretin and TLR2 knockdown on key genes in the TLR2/MYD88/NF-κB pathway were investigated in an in vitro model. (B) PDTC significantly suppressed the expression of key genes in the TLR2/MYD88/NF-κB pathway in vitro model. (C) In the SAH-induced in vivo model, the impact of PDTC, phloretin, and Vehicle on SAH grade in mice was assessed 72 hours post-treatment. (D) Both phloretin and PDTC markedly reduced the expression of key genes in the TLR2/MYD88/NF-κB pathway in the in vivo model. (E) Following inhibition of the TLR2/MYD88/NF-κB pathway, expression levels of inflammation-related factors decreased. (F) The potential mechanism through which phloretin alleviates SAH may involve the attenuation of neuroinflammation via inhibition of the TLR2/MYD88/NF-κB pathway. *, p < 0.05;**, p < 0.01; and ***, p < 0.001.
Discussion
A diverse array of natural compounds is showing promise in addressing neuroinflammation and brain injury, sparking considerable interest in screening these compounds and uncovering their mechanisms of action30–35. Among these, phloretin, a natural compound found in dietary sources, boasts antioxidant and anti-inflammatory properties. However, its specific role in SAH remains unclear. This article aims to delve into the potential mechanism underlying phloretin’s impact on SAH-induced inflammation.
Early brain injury occurring within 72 h post-SAH lays the groundwork for subsequent pathophysiological changes and poor patient prognosis36,37. Key mechanisms driving early brain injury include heightened intracranial pressure, oxidative stress, neuroinflammation, blood-brain barrier disruption, brain edema, and cell death. Therapeutic strategies targeting neuroinflammation have shown promise in mitigating neuronal damage and improving neurological function. Our findings indicate that phloretin markedly improves prognostic indicators in SAH mice. Specifically, phloretin treatment notably enhances the Garcia score while significantly reducing brain water content and levels of inflammation-related factors 72 h post-SAH induction in mice. To elucidate the underlying mechanism, we initially identified key SAH-associated genes using expression profile data. Among these genes, TLR2 displayed significantly increased expression in the SAH group. Importantly, phloretin demonstrates a significant inhibitory effect on TLR2 expression both in vitro and in vivo. Molecular docking analyses suggest a strong binding affinity between phloretin and TLR2, indicating that phloretin may modulate SAH-related inflammation via TLR2 regulation.
The role of inflammasomes in neuroinflammatory responses, particularly following SAH, is well-established38,39. Inflammasomes are multi-protein complexes that activate caspase-1, which in turn drives the maturation and secretion of pro-inflammatory cytokines such as IL-1β and IL-18. Pyroptosis, a form of inflammatory cell death, is closely associated with inflammasome activation40,41. This process is primarily mediated by the cleavage of GSDMD by caspase-1, generating the N-terminal fragment GSDMD-N, which disrupts the cell membrane and releases pro-inflammatory contents. In our study, we observed a significant increase in the expression of GSDMD-N, TNF-α, IL-1β, and cleaved caspase-1 following SAH (Figs. 2E and 3G), indicating that inflammasome activation plays a key role in SAH pathophysiology. These findings align with previous studies that highlight the involvement of the NLRP3 inflammasome in SAH-induced inflammation and neuronal damage.
Phloretin treatment notably suppressed the expression of GSDMD-N, TNF-α, IL-1β, and cleaved caspase-1 (Fig. 3G), suggesting that phloretin may inhibit inflammasome activation, thereby reducing pyroptosis and inflammation. This anti-inflammatory effect of phloretin on the inflammasome pathway is supported by findings from other disease models. For example, phloretin has been shown to inhibit NLRP3 inflammasome activation in models of acute lung injury, leading to a reduction in pro-inflammatory cytokine release and tissue damage. These results suggest that phloretin may exert similar protective effects in SAH by modulating the inflammasome pathway.
Toll-like receptors (TLRs) play a critical role in the brain’s innate immune and inflammatory responses42. NF-κB, a central regulator of inflammation, is involved in the transcription of pro-inflammatory genes such as TNF-α, IL-1β, and IL-6, all of which contribute to the development of SAH pathology43,44. Based on this, we hypothesized that phloretin’s anti-inflammatory effects in SAH may be mediated through the TLR2/MyD88/NF-κB pathway. To test this hypothesis, we evaluated the expression of key components within the NF-κB signaling pathway in an in vitro SAH model following phloretin treatment. Our results demonstrated a significant downregulation of genes associated with the TLR2/MyD88/NF-κB pathway. Moreover, using the NF-κB inhibitor PDTC in an in vivo SAH model, we further confirmed that phloretin’s anti-inflammatory effects are mediated through suppression of this pathway. Together, these findings suggest that phloretin alleviates SAH-induced inflammation by modulating the TLR2/MyD88/NF-κB signaling cascade.
However, our study still has certain limitations. While this article focuses on TLR2, it is important to acknowledge the potential involvement of TLR4 activation, which may act as a co-stimulatory molecule for T cell activation. In the brain’s immune microenvironment, cytokines such as IFN-γ and IL-1 play pivotal roles in regulating neuroinflammation and T cell activation. Additionally, the potential synergistic relationship between TLR2 and TLR4 warrants further investigation. Another limitation is the relatively small sample size in our experiments, which may affect the robustness of the results. Future studies will aim to include larger sample sizes to improve the accuracy and reliability of our findings. In addition to the direct effects of phloretin on neuronal cells, as demonstrated in our current study, it is important to consider the role of glial cells—particularly microglia—in the inflammatory response following SAH. Microglia are the resident immune cells of the brain and play a central role in both the initiation and resolution of neuroinflammation45,46. Activated microglia release pro-inflammatory cytokines, such as TNF-α and IL-1β, which exacerbate neuronal damage and contribute to the secondary injury cascade following SAH. Phloretin has been shown to suppress microglial activation, reduce oxidative stress, and modulate microglia-mediated synaptic pruning, which suggests potential neuroprotective effects beyond neuronal cells13. These findings imply that phloretin may mitigate microglia-driven neuroinflammation in the context of SAH as well, although further studies are required to confirm this hypothesis.
In summary, our study highlights the potential application of phloretin in SAH management, demonstrating its significant inhibition of SAH-related inflammation. The underlying mechanism is through inhibiting the TLR2/MYD88/NF-κB pathway.
Electronic supplementary material
Below is the link to the electronic supplementary material.
Acknowledgements
We would like to acknowledge the technical assistance provided by Shanxi Provincial People’s Hospital.
Author contributions
XH and YB designed the overall study and revised the manuscript. XH, YB, and WL completed most of the experiments for this study. YB and MZ collected and processed raw data. XD and YB analyzed data and drafted the manuscript. All authors reviewed the manuscript.
Funding
No.
Data availability
Data are available on reasonable request. The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.
Declarations
Ethics approval and consent to participate
The experimental procedures were approved by the Animal Care and Use Committee of Shanxi Provincial People’s Hospital (approval number 2024125) and were in accordance with the ARRIVE guidelines (https://arriveguidelines.org).
Patient consent for publication
Not applicable.
Consent for publication
All the authors have approved the manuscript.
Competing interests
The authors declare no competing interests.
Footnotes
Publisher’s note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.van Gijn, J., Kerr, R. S. & Rinkel, G. J. Subarachnoid haemorrhage. Lancet (London England). 369 (9558), 306–318. 10.1016/S0140-6736(07)60153-6 (2007). [DOI] [PubMed] [Google Scholar]
- 2.Bonita, R. & Thomson, S. Subarachnoid hemorrhage: epidemiology, diagnosis, management, and outcome. Stroke. 16(4), 591-4 10.1161/01.str.16.4.591. (1985). [DOI] [PubMed]
- 3.Wu, H. et al. The autophagy-lysosomal system in subarachnoid haemorrhage. J. Cell. Mol. Med.20 (9), 1770–1778. 10.1111/jcmm.12855 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Coulibaly, A. P. & Provencio, J. J. Aneurysmal subarachnoid hemorrhage: an overview of inflammation-induced cellular changes. Neurotherapeutics. 17 (2), 436–445. 10.1007/s13311-019-00829-x (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Dodd, W. S. et al. Pathophysiology of delayed cerebral ischemia after subarachnoid hemorrhage: a review. J. Am. Heart Assoc.10 (15), e021845. 10.1161/JAHA.121.021845 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Geraghty, J. R. et al. Systemic Immune-inflammation index predicts delayed cerebral vasospasm after Aneurysmal Subarachnoid Hemorrhage. Neurosurgery. 89 (6), 1071–1079. 10.1093/neuros/nyab354 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Tian, Q. et al. Inhibition of CCR2 attenuates neuroinflammation and neuronal apoptosis after subarachnoid hemorrhage through the PI3K/Akt pathway. J. Neuroinflammation. 19 (1), 312. 10.1186/s12974-022-02676-8 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Dierckx, T. et al. Phloretin suppresses neuroinflammation by autophagy-mediated Nrf2 activation in macrophages. J. Neuroinflammation. 18 (1), 148. 10.1186/s12974-021-02194-z (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Mao, W. et al. Phloretin ameliorates diabetes-induced endothelial injury through AMPK-dependent anti-EndMT pathway. Pharmacol Res. 179, 106205. 10.1016/j.phrs.2022.106205. (2022). [DOI] [PubMed]
- 10.de Oliveira, M. R. Phloretin-induced cytoprotective effects on mammalian cells: a mechanistic view and future directions. Biofactors 42(1), 13–40. 10.1002/biof.1256. (2016). [DOI] [PubMed]
- 11.Hytti, M. et al. Phloretin inhibits glucose transport and reduces inflammation in human retinal pigment epithelial cells. Mol. Cell. Biochem.478 (1), 215–227. 10.1007/s11010-022-04504-2 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Zhou, Q., Gong, J. & Wang, M. Phloretin and its methylglyoxal adduct: implications against advanced glycation end products-induced inflammation in endothelial cells. Food Chem. Toxicol.129, 291–300. 10.1016/j.fct.2019.05.004 (2019). [DOI] [PubMed] [Google Scholar]
- 13.Li, C. et al. Phloretin decreases microglia-mediated synaptic engulfment to prevent chronic mild stress-induced depression-like behaviors in the mPFC. Theranostics. 13 (3), 955–972. 10.7150/thno.76553 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Zheng, Y. et al. Probenecid-blocked Pannexin-1 Channel protects against early brain Injury via inhibiting neuronal AIM2 inflammasome activation after subarachnoid hemorrhage. Front. Neurol.13, 854671. 10.3389/fneur.2022.854671 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Pillai-Kastoori, L., Schutz-Geschwender, A. R. & Harford, J. A. A systematic approach to quantitative Western blot analysis. Anal. Biochem.593, 113608. 10.1016/j.ab.2020.113608 (2020). Epub 2020 Jan 31. PMID: 32007473. [DOI] [PubMed] [Google Scholar]
- 16.Sun, Y. et al. WGCNA and machine learning to construct immune-related EMT patterns to predict HCC prognosis and immune microenvironment. Aging (Albany NY)15(14), 7146–7160. 10.18632/aging.204898 (2023). [DOI] [PMC free article] [PubMed]
- 17.Wu, J., Luo, M., Chen, Z., Li, L. & Huang, X. Integrated analysis of the expression characteristics, prognostic value, and immune characteristics of PPARG in breast cancer. Front. Genet.12, 737656. 10.3389/fgene.2021.737656 (2021). [DOI] [PMC free article] [PubMed]
- 18.Guo, Z. et al. Lipoxin A4 reduces inflammation through Formyl peptide receptor 2/p38 MAPK signaling pathway in subarachnoid hemorrhage rats. Stroke. 47 (2), 490–497. 10.1161/STROKEAHA.115.011223 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Kilkenny, C., Browne, W. J., Cuthill, I. C., Emerson, M. & Altman, D. G. Improving bioscience research reporting: the ARRIVE guidelines for reporting animal research. PLoS Biol.8 (6), e1000412. Published 2010 Jun 29. 10.1371/journal.pbio.1000412 (2010). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Xie, Y. et al. Biglycan regulates neuroinflammation by promoting M1 microglial activation in early brain injury after experimental subarachnoid hemorrhage. J. Neurochem. 152 (3), 368–380. 10.1111/jnc.14926 (2020). [DOI] [PubMed] [Google Scholar]
- 21.Gustavsson, E. K., Zhang, D., Reynolds, R. H., Garcia-Ruiz, S. & Ryten, M. Ggtranscript: an R package for the visualization and interpretation of transcript isoforms using ggplot2. Bioinformatics. 38 (15), 3844–3846. 10.1093/bioinformatics/btac409 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Ning, S. et al. Identification of CD4 + conventional T cells-related lncRNA signature to improve the prediction of prognosis and immunotherapy response in breast Cancer. Front. Immunol.13, 880769. 10.3389/fimmu.2022.880769 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Zhao, H., Li, S. T., Zhu, J., Hua, X. M. & Wan, L. Analysis of peripheral blood cells’ transcriptome in patients with subarachnoid hemorrhage from ruptured aneurysm reveals potential biomarkers. World Neurosurg.129, e16–e22. 10.1016/j.wneu.2019.04.125 (2019). [DOI] [PubMed] [Google Scholar]
- 24.Claassen, J. et al. Global cerebral edema after subarachnoid hemorrhage: frequency, predictors, and impact on outcome. Stroke 33(5), 1225-32. 10.1161/01.str.0000015624.29071.1f. (2002). [DOI] [PubMed]
- 25.Said, M. et al. Subarachnoid hemorrhage early brain edema score (SEBES) as a radiographic marker of clinically relevant intracranial hypertension and unfavorable outcome after subarachnoid hemorrhage. Eur. J. Neurol.28 (12), 4051–4059. 10.1111/ene.15033 (2021). [DOI] [PubMed]
- 26.Schneider, U. C., Xu, R. & Vajkoczy, P. Inflammatory events following subarachnoid hemorrhage (SAH). Curr. Neuropharmacol.16 (9), 1385–1395. 10.2174/1570159X16666180412110919 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Yan, A., Pan, X., Wen, X., Nie, X. & Li, Y. Activated protein C overexpression suppresses the pyroptosis of subarachnoid hemorrhage model cells by regulating the NLRP3 inflammasome pathway. Exp. Ther. Med.22 (6), 1391. 10.3892/etm.2021.10827 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Kim, J. et al. Phloretin as a potent natural TLR2/1 inhibitor suppresses TLR2-Induced inflammation. Nutrients. 10 (7), 868. 10.3390/nu10070868 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Squillace, S. & Salvemini, D. Toll-like receptor-mediated neuroinflammation: relevance for cognitive dysfunctions. Trends Pharmacol. Sci.43 (9), 726–739. 10.1016/j.tips.2022.05.004 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Li, M., Shang, H., Wang, T., Yang, S. Q. & Li, L. Huanglian decoction suppresses the growth of hepatocellular carcinoma cells by reducing CCNB1 expression. World J. Gastroenterol.27 (10), 939–958. 10.3748/wjg.v27.i10.939 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Li, T. et al. Integrated metabolomics and network pharmacology to reveal the mechanisms of hydroxysafflor yellow A against acute traumatic brain injury. Comput. Struct. Biotechnol. J.19, 1002–1013 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Suzuki, H. et al. Cerebrovascular pathophysiology of delayed cerebral ischemia after aneurysmal subarachnoid hemorrhage. Histol. Histopathol. 36 (2), 143–158. 10.14670/HH-18-253 (2021). [DOI] [PubMed] [Google Scholar]
- 33.Deng, X. et al. The mechanism of ferroptosis in early brain injury after subarachnoid hemorrhage. Front. Immunol.14, 1191826. 10.3389/fimmu.2023.1191826 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Mao, Z. et al. Ligustilide ameliorates hippocampal neuronal injury after cerebral ischemia reperfusion through activating PINK1/Parkin-dependent mitophagy. Phytomedicine. 101, 154111. 10.1016/j.phymed.2022.154111 (2022). [DOI] [PubMed] [Google Scholar]
- 35.Zhang, X. S. et al. Astaxanthin ameliorates oxidative stress and neuronal apoptosis via SIRT1/NRF2/Prx2/ASK1/p38 after traumatic brain injury in mice. Br. J. Pharmacol.178 (5), 1114–1132. 10.1111/bph.15346 (2021). [DOI] [PubMed] [Google Scholar]
- 36.Gesuete, R., Kohama, S. G. & Stenzel-Poore, M. P. Toll-like receptors and ischemic brain injury. J. Neuropathol. Exp. Neurol.73 (5), 378–386. 10.1097/NEN.0000000000000068 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Wang, L. et al. Progress in research on TLR4-Mediated inflammatory response mechanisms in brain injury after subarachnoid hemorrhage. Cells. 11 (23), 3781. 10.3390/cells11233781 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Xia, D. Y. et al. SIRT1 promotes M2 Microglia polarization via reducing ROS-Mediated NLRP3 Inflammasome Signaling after Subarachnoid Hemorrhage. Front. Immunol.12, 770744. 10.3389/fimmu.2021.770744 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Hu, X. et al. INT-777 attenuates NLRP3-ASC inflammasome-mediated neuroinflammation via TGR5/cAMP/PKA signaling pathway after subarachnoid hemorrhage in rats. Brain. Behav. Immun.91, 587–600. 10.1016/j.bbi.2020.09.016 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Hu, X. et al. Emerging role of STING signalling in CNS injury: inflammation, autophagy, necroptosis, ferroptosis and pyroptosis. J. Neuroinflamm.19 (1), 242. 10.1186/s12974-022-02602-y (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Cai, W. et al. LDC7559 inhibits microglial activation and GSDMD-dependent pyroptosis after subarachnoid hemorrhage. Front. Immunol.14, 1117310. 10.3389/fimmu.2023.1117310 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.DiDonato, J. A., Mercurio, F. & Karin, M. NF-κB and the link between inflammation and cancer. Immunol Rev. 246(1), 379–400. 10.1111/j.1600-065X.2012.01099.x. (2012). [DOI] [PubMed]
- 43.HaddadJJ Redox regulation of pro-inflammatory cytokines and IkappaB-alpha/NF-kappaB nuclear translocation and activation. Biochem. Biophys. Res. Commun.296 (4), 847–856. 10.1016/s0006-291x(02)00947-6 (2002). Erratum in: Biochem Biophys Res Commun. 2003;301(2):625. PMID: 12200125. [DOI] [PubMed]
- 44.Hoesel, B. & Schmid, J. A. The complexity of NF-κB signaling in inflammation and cancer. Mol. Cancer. 12, 86. 10.1186/1476-4598-12-86 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Smith, A. N., Shaughness, M., Collier, S., Hopkins, D. & Byrnes, K. R. Therapeutic targeting of microglia mediated oxidative stress after neurotrauma. Front. Med.9, 1034692. 10.3389/fmed.2022.1034692 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Luo, Y. & Wang, Z. The impact of Microglia on Neurodevelopment and Brain function in Autism. Biomedicines. 12 (1), 210. 10.3390/biomedicines12010210 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Citations
- Sun, Y. et al. WGCNA and machine learning to construct immune-related EMT patterns to predict HCC prognosis and immune microenvironment. Aging (Albany NY)15(14), 7146–7160. 10.18632/aging.204898 (2023). [DOI] [PMC free article] [PubMed]
Supplementary Materials
Data Availability Statement
Data are available on reasonable request. The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.