Abstract
Advances in assembling microbial genomes have led to growth of reference genome databases, which have been transformative for applied and basic microbiome research. Here we show that published microbial genome databases from humans, mice, cows, pigs, fish, honeybees, and marine environments contain significant sequencing-adapter contamination that systematically reduces assembly accuracy and contiguousness. By removing the adapter-contaminated ends of contiguous sequences and reassembling MGnify reference genomes, we improve the quality of assemblies in these databases.
Supplementary Information
The online version contains supplementary material available at 10.1186/s12864-024-10956-1.
Keywords: Bacterial genomes, Metagenome, Microbiota, Symbiosis, Microbial ecology
Background
Recent work has generated unprecedented numbers of microbial genome sequences from the microbiomes of eukaryotic hosts and free-living habitats [1–3]. Databases of thousands of microbial-genome assemblies from isolates and metagenomes (i.e., metagenome-assembled genomes—MAGs) are now available from humans [4], mice [5], cows [6], pigs [7], chicken [8], fish [3], and honeybees [9] as well as marine environments [3]. These resources are enabling previously intractable functional and evolutionary studies of microbiomes [10, 11].
The large size of recently published microbial genome databases requires automated approaches for inspection and quality control of individual assemblies [12]. Automated tools for detecting chimeras and measuring strain heterogeneity, completeness, contamination, and contiguousness have been developed [13–17]. Sequencing adapter contamination is a known issue with assembly of reads from commonly used technologies (e.g., Illumina) in which sequences from adapters used during the sequencing process are erroneously incorporated into assemblies [18–22]. To mitigate this issue, studies typically remove adapter sequences from reads prior to assembly [10], such that adapter contamination is not expected to be prevalent in these databases. For instance, studies from which reference-genome databases in the MGnify repository were derived all reported efforts to clean sequence reads of adapter contamination before assembly [3–9]. However, the incidence of adapter contamination in these databases has not been investigated. Here, we demonstrate a significant extent of sequencing adapter contamination in MGnify microbial genome databases—and develop an approach for the elimination of this contamination—with the goal of improving the accuracy, contiguousness, and utility of these resources for future studies.
Results
Significant evidence of adapter contamination in MGnify databases
To evaluate the extent to which assemblies contain sequencing-adapter contamination, we calculated the baseline rate at which adapter sequences are expected to be observed by chance in a genome assembly of a given length. Illumina sequencing of TruSeq libraries employs the 12-base universal adapter sequence ‘AGATCGGAAGAG’, which has a probability of being observed by chance in a biological sequence of 12 bases in length, assuming equal probability of each nucleotide at each site and independence among sites. Thus, ‘λ’, the number of adapter sequences expected to be observed by chance in an assembly of ‘X’ length containing ‘y’ contiguous sequences (contigs) is given by Eq. 1. The integer ‘11’ in Eq. 1 reflects that the last 11 bases in each contig cannot be the start of a 12-base adapter sequence.
| 1 |
The probability of observing greater than or equal to a specific number of ‘k’ sequences in a sequence of ‘X’ sites can be calculated using the Poisson cumulative distribution function (Online Methods):
| 2 |
Equations 1 and 2 can be used to calculate a p-value corresponding to the probability of observing by chance k or more adapter sequences, providing a test for significant levels of adapter contamination in an assembly given its length and number of contigs.
Using this approach, we tested for adapter enrichment in every microbial species’ reference genome assembly in microbial genome databases from environments represented in MGnify [3], including ‘human gut’, ‘human oral’, ‘human vaginal’, ‘mouse gut’, ‘pig gut’, ‘cow rumen’, ‘honeybee gut’, ‘non-model fish gut’, ‘zebrafish fecal’, ‘chicken gut’, and ‘marine’. The number of adapter sequences observed per assembly (including both forward and reverse complement orientations of the adapter sequence) ranged from 0 to 805, with a Paenibacillus lactis assembly from the human gut (accession MGYG000003402) displaying the most adapter sequences. A histogram of assemblies containing 10 or more adapter sequences is shown in Fig. 1a. Of the 15,657 species reference genome assemblies in all MGnify databases, only ~ 157, ~ 15.7, and ~ 1.57e-12 assemblies were expected to be observed by chance at the thresholds of p-value < 0.01, 0.001, and 1e-16, respectively. In contrast, 1110, 888, and 433 assemblies contained significant enrichment of adapters at these p-value thresholds, respectively (Fig. 1). An enrichment of assemblies displaying significant p-values was also observed within individual databases (Fig. 1c–j). A total of 1020 assemblies displayed significant evidence of adapter contamination after false-discovery rate (FDR) correction for testing of multiple assemblies, and enrichment of adapters was evident in assemblies derived from isolates as well as MAGs (Table S1). These results show significant adapter contamination in microbial genome assemblies in these reference databases.
Fig. 1.
Significant enrichment of Illumina adapter sequences in published microbial genome databases. a Histogram shows the number of assemblies in all databases containing 10 or more exact matches to the Illumina universal adapter sequence or its reverse complement. Of the 15,657 species reference genome assemblies, the number of assemblies expected to contain 10 or more exact matches by chance was ~ 1.57e-12, i.e., ~ 0. b Bar plot shows the number of assemblies displaying significant evidence of adapter enrichment at three p-value thresholds. Expected number of assemblies is shown for each threshold. c–j Histograms show the number of assemblies in individual databases for specific ranges of p-values. In (c–j), Red bars indicate the number of assemblies for which p-values were < 0.01. Dashed red lines indicate the number of assemblies expected to display p-values of < 0.01 by chance (i.e., ~ 1% of assemblies in each database)
Concentration of adapter sequences in extremities of contigs
Adapter sequences were concentrated at the ends of contigs, and the reverse complements of adapter sequences were concentrated at the beginnings of contigs (Table S1) (Fig. 2a). For example, in the Paenibacillus lactis assembly containing 319 adapter sequences in the forward orientation, the average distance of the end of the adapter sequence to the end of the contig in which it was found was only ~ 10 bases, with a maximum distance of 74 bases and a minimum distance of 0 bases (i.e., the last base in the contig was the last base of the adapter sequence), despite the average length of contigs in this assembly being ~ 2900 bases (Fig. 2b, Table S1). Conversely, the reverse complements of the adapter sequence were clustered near the beginnings of contigs in this assembly (Fig. 2c, Table S1). Instances of the adapter sequence were also adjacent to portions of known forward- or reverse-specific adapter sequences (‘CACACGTCTGAACTCCAGTCA’ and ‘CGTCGTGTAGGGAAAGAGTGT’, respectively) or their reverse complements (Fig. 2b, c). Concentration of contamination at the beginning or ends of contigs was also observed in the other adapter-contaminated assemblies (Table S1).
Fig. 2.
Adapter contamination is concentrated at the beginnings and ends of contigs, and its removal improves assembly contiguousness. a Histogram shows the concentration of Illumina universal adapter sequences near the extremities of contigs in the genomes showing significant evidence of adapter contamination (p-value < 0.01). Mean distances in bases from beginnings or ends of contigs were calculated for adapter sequences and reverse complements of adapter sequences, respectively. b DNA sequences show five examples of contamination by Illumina adapters (red sequences) at the ends of contigs (grey squares) in Paenibacillus lactis assembly MGYG000003402 from the human gut. c DNA sequences show five examples of contamination by the reverse complement of Illumina adapters (red sequences) at the beginnings of contigs in assembly MGYG000003402. In (b) and (c) blue and yellow sequences correspond to forward- and reverse-specific adapter sequences, respectively, adjacent to the universal adapter sequence. d Barplot shows for each database the per-assembly average number of contigs merged with other contigs after the removal of adapter contamination and reassembly (of the 1110 contaminated assemblies at p-value < 0.01). e Scatterplot shows the positive relationship between the number of adapter sequences present in assemblies showing the strongest evidence of contamination (FDR-corrected p-value < 1e-16) (x-axis) and the number of contigs that were able to be merged by reassembly after adapter contamination removal (y-axis). Red line shows best-fit regression of log transformed values (transformation was made to reduce heteroscedasticity). The p-value was calculated from a generalized linear model with Poisson-distributed errors for count data
Removing adapter contamination and reassembling contigs improves assembly contiguousness
Previous work has shown that adapter contamination can inhibit the merging of contigs during the assembly process [21, 22]. Because the clustering of adapter contamination at the beginnings or ends of contigs is consistent with the possibility that adapter contamination broke contigs during the assembly process, we reasoned that the contiguousness of assemblies might be improved by trimming the ends of contaminated contigs and attempting to stitch together the trimmed contigs. We trimmed the last (or first) 450 bases of every contig containing an adapter sequence within 300 bases of the end (or beginning) of the contig—thereby removing the adapter sequences and their flanking regions—and reassembled the trimmed contigs of every species reference genome assembly. Trimming 450 bases yielded the highest average increase in the contiguousness of assemblies, as measured by N50, compared to other trimming lengths tested (Online Methods). Reassembly following removal of adapter contamination increased N50 for 327 of the 1110 assemblies containing significant evidence of adapter sequences at the p-value < 0.01 threshold, with an average increase of 917 bases and a maximum increase of 10,258 bases (Table S2). These values correspond to improvements in N50 of up to 20% for individual assemblies.
Contiguousness of assemblies was improved in each individual database (Fig. 2d). On average, ~ 2 contigs per assembly, corresponding to ~ 0.8% of all contigs, were merged with other contigs after removing adapter contamination. For 211 assemblies, 10 or more contigs were merged, with a maximum of 54 contigs merged for a single assembly. Moreover, we observed a positive relationship between the number of adapter sequences present in an assembly and the number of contigs that were assembled with other contigs after removing adapter contamination (Fig. 2e) (generalized linear model with Poisson-distributed errors for count data, p-value = 1.99e-5). These results further indicate that adapter contamination negatively affects assembly contiguousness and that these negative effects can be mitigated by removal of adapter contamination and reassembly.
Discussion
In this study, we identified and remedied widespread sequencing-adapter contamination in published MGnify microbial genome databases. Corrected assemblies generated by this study (trimmed assemblies and reassemblies) are available at https://zenodo.org/records/10547057. Scripts for detecting and assessing the extent of adapter contamination in assemblies, removing the ends of adapter-contaminated contigs, and reassembling trimmed contigs are available at github.com/CUMoellerLab/MalAdapter. The increased contiguousness of assemblies reported here may improve their utility for studies focused on structural features of microbial genomes such as gene order, operons, accessory chromosomes, and repetitive elements. Moreover, removing adapter sequences increases assembly accuracy, which may improve the utility of assemblies for any future study.
Methods
Data sources
Genome assemblies for this study were downloaded from the MGnify [3] ftp site at https://ftp.ebi.ac.uk/pub/databases/. Most recent versions of each database were used as follows: ‘chicken-gut’ = v1.0.1, ‘cow-rumen’ = v1.0.1, ‘honeybee-gut’ = v1.0.1, ‘human-gut’ = v2.0.2, ‘human-oral’ = v1.0.1, ‘human-vaginal’ = v1.0, ‘marine’ = v1.0, ‘mouse-gut’ = v1.0, ‘non-model-fish-gut’ = v2.0, ‘pig-gut’ = v1.0, ‘zebrafish-fecal’ = v1.0.
Derivation of expectations and probabilities and correction for multiple testing
The term ‘k minus 1’ in Eq. 2 allows the calculation of the probability of observing greater than or equal to ‘k’ adapter sequences. Because multiple genomes were tested, corrections to p-values were made based on a false-discovery rate of 0.1, yielding q-values for each assembly. The results were qualitatively robust to the choice of q-value threshold: significant evidence of adapter contamination was observed at q-value thesholds as low as 1e-16.
Identification and removal of adapter sequences
Illumina universal adapter sequences (‘AGATCGGAAGAG’) and their reverse complements (‘CTCTTCCGATCT’) were identified and counted in assemblies using custom bash scripts available at github.com/CUMoellerLab/MalAdapter. When adapter sequences were detected within the first or last 300 bases of a contig, the first or last 450 of the contig was removed, respectively. Testing trimming lengths of 150, 250, 350, 550, and 650 bases supported that 450 bases yielded the highest mean improvement to N50, although all choices of trimming length yielded qualitatively similar results (mean N50 increase was within 6.2% regardless of trimming length chosen).
Reassembly of contigs and calculation of N50
To reassemble trimmed contigs after the removal of adapter contamination at the ends of contigs, we employed CAP3 [23] using the following settings: -z 1 -y 6 -f 2 -p 99. These choices enabled the stitching together of the ends of contigs with perfectly overlapping and identical regions. N50 was calculated using custom bash scripts available at github.com/CUMoellerLab/MalAdapter.
Supplementary Information
Supplementary Material 1: Table S1. Results of analyses of adapter enrichment.
Supplementary Material 2: Table S2. Differences in N50 resulting from adapter removal. Table shows MAGs display increases in N50 values after adapter removal compared to before adapter removal.
Acknowledgements
We thank Howard Ochman for useful discussion and for suggesting the name ‘MalAdapter’.
Authors’ contributions
A.H.M. designed the study, conducted analyses, and wrote and edited the manuscript. B.A.D., S.L.G., M.V.F.R, and D.D.S. conducted analyses and edited the manuscript.
Funding
This work was funded by grants from the National Institutes of Health R01 DK139214 and R35 GM138284 to A.H.M and training grant T32 AI145821 to D.D.S.
Data availability
All data used in this study were generated by previous work and are publicly available at https://www.ebi.ac.uk/metagenomics.
Declarations
Ethics approval and consent to participate
Not applicable.
Consent for publication
Not applicable.
Competing interests
The authors declare no competing interests
Footnotes
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.Bickhart DM, Kolmogorov M, Tseng E, Portik DM, Korobeynikov A, Tolstoganov I, Smith TP. Generating lineage-resolved, complete metagenome-assembled genomes from complex microbial communities. Nat Biotechnol. 2022;40(5):711–9. [DOI] [PubMed] [Google Scholar]
- 2.Sanders JG, Yan W, Mjungu D, Lonsdorf EV, Hart JA, Sanz CM, Moeller AH. A low-cost genomics workflow enables isolate screening and strain-level analyses within microbiomes. Genome Biol. 2022;23(1):212. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Mitchell AL, Almeida A, Beracochea M, Boland M, Burgin J, Cochrane G, Finn RD. MGnify: the microbiome analysis resource in 2020. Nucleic Acids Res. 2020;48(1):570–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Almeida A, Nayfach S, Boland M, Strozzi F, Beracochea M, Shi ZJ, Finn RD. A unified catalog of 204,938 reference genomes from the human gut microbiome. Nat Biotechnol. 2021;39(1):105–14. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Beresford-Jones BS, Forster SC, Stares MD, Notley G, Viciani E, Browne HP, Pedicord VA. The MouseGastrointestinal Bacteria Catalogue enables translation between the mouse andhuman gut microbiotas via functional mapping. Cell Host Microbe. 2022;30(1):124–38. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Stewart RD, Auffret MD, Warr A, Wiser AH, Press MO, Langford KW, Watson M. Assembly of 913 microbial genomes frommetagenomic sequencing of the cow rumen. Nat Commun. 2018;9(1):870. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Chen C, Zhou Y, Fu H, Xiong X, Fang S, Jiang H, Huang L. Expanded catalog of microbial genes and metagenome-assembledgenomes from the pig gut microbiome. Nat Commun. 2021;12(1):1106. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Glendinning L, Stewart RD, Pallen MJ, Watson KA, Watson M. Assembly of hundreds of novel bacterial genomes from the chicken caecum. Genome Biol. 2020;21(1):1–16. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Li Y, Leonard SP, Powell JE, Moran NA. Species divergence in gut-restricted bacteria of social bees. Proc Natl Acad Sci. 2022;119(18): e2115013119. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Pasolli E, De Filippis F, Mauriello IE, CumboF Walsh AM, Leech J, Ercolini D. Large-scale genome-wide analysislinks lactic acid bacteria from food with the gut microbiome. Nat Commun. 2020;11(1):2610. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Sanders JG, Sprockett DD, Li Y, Mjungu D, Lonsdorf EV, Ndjango JBN, Moeller AH. Widespread extinctions of co-diversified primate gut bacterial symbionts from humans. Nat Microbiol. 2023;8(6):1039–50. [DOI] [PMC free article] [PubMed]
- 12.Shaiber A, Eren AM. Composite metagenome-assembled genomes reduce the quality of public genome repositories. mBio. 2019;10(3):10–1128. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Orakov A, Fullam A, Coelho LP, Khedkar S, Szklarczyk D, Mende DR, Bork P. GUNC: detection of chimerism and contamination in prokaryotic genomes. Genome Biol. 2021;22:1–19. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Pasolli E, Asnicar F, Manara S, Zolfo M, Karcher N, Armanini F, Segata N. Extensive unexplored human microbiome diversity revealed by over 150,000 genomes from metagenomes spanning age, geography, and lifestyle. Cell. 2019;176(3):649–62. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Simão FA, Waterhouse RM, Ioannidis P, Kriventseva EV, Zdobnov EM. BUSCO: assessing genome assembly and annotation completeness with single-copy orthologs. Bioinformatics. 2015;31(19):3210–2. [DOI] [PubMed] [Google Scholar]
- 16.Chklovski A, Parks DH, Woodcroft BJ, Tyson GW. CheckM2: a rapid, scalable and accurate tool for assessing microbial genome quality using machine learning. Nat Methods. 2023;20(8):1203–12. [DOI] [PubMed] [Google Scholar]
- 17.Parks DH, Imelfort M, Skennerton CT, Hugenholtz P, Tyson GW. CheckM: assessing the quality of microbial genomes recovered from isolates, single cells, and metagenomes. Genome Res. 2015;25(7):1043–55. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Howe K, Chow W, Collins J, Pelan S, Pointon DL, Sims Y, Wood J. Significantly improving the quality of genome assemblies through curation. Gigascience. 2021;10(1):153. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Sim SB, Corpuz RL, Simmonds TJ, Geib SM. HiFiAdapterFilt, a memory efficient read processing pipeline, prevents occurrence of adapter sequence in PacBio HiFi reads and their negative impacts on genome assembly. BMC Genomics. 2022;23(1):157. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Martin M. Cutadapt removes adapter sequences from high-throughput sequencingreads. EMBnet J. 2011;17(1):10–2. [Google Scholar]
- 21.Sim SB, Corpuz RL, Simmonds TJ, Geib SM. HiFiAdapterFilt, a memory efficient read processing pipeline, prevents occurrence of adapter sequence in PacBio HiFi reads and their negative impacts on genome assembly. BMC Genomics. 2022;23(1):157. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Bolger AM, Lohse M, Usadel B. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics. 2014;30(15):2114–20. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Huang X, Madan A. CAP3: A DNA sequence assembly program. Genome Res. 1999;9(9):868–77. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Supplementary Material 1: Table S1. Results of analyses of adapter enrichment.
Supplementary Material 2: Table S2. Differences in N50 resulting from adapter removal. Table shows MAGs display increases in N50 values after adapter removal compared to before adapter removal.
Data Availability Statement
All data used in this study were generated by previous work and are publicly available at https://www.ebi.ac.uk/metagenomics.


